Origin and fixation of the individuals of Eisenia foetida

The individuals of Eisenia foetida used in this study came from both Instituto de Reconversión Productiva y Bioenergética (IRBIO), state of Chiapas and Colegio de Postgraduados (COLPOS), State of Mexico, Mexico. The worms fed on pasture and cattle manure in the first case and organic waste (fruit peels, vegetable residue and eggshell) in the second case. Ten individuals of each locality were used. The specimens were washed superficially with distilled water until they were free of soil; then, they were immersed in 70 % ethanol three times for 30 s; subsequently, they were rinsed in sterile distilled-water and fixed with distilled water at 50 ºC for 10 s (^{Kim et al., 2004}). The earthworms were longitudinally dissected with a sterile scalpel to reach the intestine. The oligochaete digestive tract was divided into three sections: a) including the segments 1 to 45, b) segments 46 to 90, and c) segments 91 to 135.

Bacterial isolation from the digestive tract of Eisenia foetida

A portion of the intestinal content of each gut section was inoculated on plates of Brain Heart Infusion (BHI) (DIFCO®) culture medium. Plates were incubated at 30 ºC for 24 h. Isolation and purification of the bacterial colonies occurred by repeated streaking of a single colony on fresh BHI plates (^{Valle-Molinares et al., 2007}).

Colonial and cellular morphologies of bacterial isolates

Colonial morphology was analyzed according to ^{Gómez et al. (2006)}, with the aid of a stereomicroscope SMZ140/143 (Motic® Instruments Inc., Richmond, Canada). The Gram stain and purity of isolates was confirmed using an optical microscope MOTICBA-200 (Motic® Instruments Inc., Richmond, Canada).

Bacterial DNA extraction, amplification and sequencing of the 16S rRNA gene

DNA extraction was performed using 2 % CTAB protocol (Tris-HCl 100mM pH 8.0; EDTA 20 mM; CTAB 2 %; NaCl 1.4 M) (^{Doyle and Doyle, 1990}).

The amplification of the 16S rRNA gene was performed using primers 8F (5´AGAGTTTGATCCTGGCTCAG3´) and 1492R (5´GGTTACCTTGTTACGACTT3´). The PCR was performed in a C1000 Touch™ thermal cycler (BIO-RAD, Hercules, CA, USA) with the following conditions: initial denaturation temperature 95 ºC for 2 min; 30 cycles of denaturation at 95 ºC for 1 min, annealing temperature 50 ºC for 30 s and extension at 72 ºC for 2 min, and a final extension at 72 ºC for 10 min (^{Silva et al., 2009}; ^{Vickerman et al., 2007}). An agarose gel stained with 1.5 % GelRed® (Biotium, Fremont, CA, USA) exhibited the amplified fragment. The sequencing was carried out using the BigDye™ Terminator version 3.0 kit (Applied Biosystems, Foster City, CA, USA). Finally, the sequences were compared to the GenBank of the NCBI employing the option Blast_nucleotide 2.2.29 (^{Benson et al., 2009}). The phylogenetic analysis was performed using the MEGA 6.0 software (^{Tamura et al., 2013}). The evolutionary history of the sequences of the both sites was inferred using Maximum Parsimony method. The Maximum Parsimony trees were obtained using the algorithm Tree-Bisection-Regrafting (^{Lewis, 2001}). The reliability of the formed trees associated in groups of taxa was conducted with the bootstrap test with 1000 replicates.

Biochemical analysis of bacterial isolates

Biochemical characterization required BioMerieux kits: API® 20NE identification system for non-fastidious and non-enteric Gram-negative rods, and API® 50 CHB for the species of the genus Bacillus. Each API gallery, inoculated according to the manufacturer recommendations, was incubated at 30 ºC and read at 24 and 48 h. The biochemical profile obtained in the database was compared using the program ApiwebTM (^{Logan and Berkeley, 1984}). Catalase and oxidase activities were assayed using hydrogen peroxide (3 % v/v) and tetramethyl-p-phenylenediamine dihydrochloride 1 % (Sigma Co.), respectively.

Colonial and cellular morphology of bacterial isolates

One hundred bacterial isolates from E. foetida digestive tract were obtained, 56 and 44 from IRBIO and COLPOS earthworms, respectively. The colonial morphology of the bacteria isolated from earthworms at both sites was similar. There were yellow and white colonies, with convex or flat elevation and wavy or whole edges; however, only rhizoid-shaped colonies were observed in digestive tract of IRBIO earthworms (Figure 1). Microscopic analysis revealed that the bacterial population consisted of 44 Gram-negative and 56 Gram-positive isolates. Over 50 % of the bacterial isolations corresponded to shaped-bacilli cells.

Figure 1 Colonial morphology of the bacterial strains isolated from Eisenia foetidadigestive tract. A) yellow colony, mucoid, with whole edge and convex; B) white colony, circular, whole edge and conve; C) rhizoid-shaped colony, filamentous, high and umbilicated; D) whitish colony, flat, irregularly shaped, lobed edge with dry appearance, like a fried egg; E) whitish colony like wax, convex, fusiform and circular, with rounded edge; F) irregular-shaped colony, umbilicated with wavy edge. 

Molecular identification of bacterial isolates

The amplification of the 16S rRNA gene of the strains isolated from the E. foetida digestive tract exhibited a band of 1500 base pairs (bp) (Figure 2).

Figure 2 Amplification products of the 16S rRNA gene of bacteria isolated from the intestinal content of Eisenia foetida,using primers 8F and 1492R. J and Cp refer to the bacterial DNA of worms from A) Instituto de Reconversión Productiva y Bioenergética and B) Colegio de Postgraduados. Lines 1kb correspond to the molecular weight markers.  

Nine bacterial genera were identified in the worms of IRBIO (Table 1). Bacillus was the predominant genus with eight species (Bacillus sp., B. subtilis, B. cereus, B. megaterium, B. safensis, B. pumilus, B. simplex and B. flexus). Six genera were identified in the COLPOS oligochaetes. Similarly, Bacillus was the predominant genus with six species (B. subtilis, B. cereus, B. megaterium, B. safensis, B. aryabhattai and B. stratosphericus). Ten different Bacillus species of E. foetida that were present in some intestine sections (A, B and C) were found in both worm populations, (Tables 1 and 2). As in the present experiment, ^{Valle-Molinares et al. (2007)} and ^{Kim et al. (2004)} reported the predominance of the genus Bacillus in the digestive tract of worms Onychochaeta boricana and E. foetida, respectively.

Seven bacterial species were present only in the worms of IRBIO: Bacillus pumilus, B. simplex, B. flexus, Solibacillus sp., Paenibacillus sp., Arthrobacter sp. and Pantoea agglomerans, while just three bacterial species were found in the oligochaetes of COLPOS: Bacillus aryabhattai, B. stratosphericus and Staphylococcus warneri (Table 1). Probably, the highest bacterial diversity observed in the digestive tract of worms of IRBIO was due to pasture and the cattle manure ingested. Particularly, bovine manure is a rich source of bacterial species, including some species potentially pathogenic to humans. Brito et al. (2010 Pers. Com¹) reported larger bacterial diversity in the gut of Pontoscolex coretrurus, inhabitant of a livestock area.

Bacillus is a typical inhabitant of the soil. It is a Gram-positive spore-forming bacterium. Spore formation is a reproductive strategy ensuring its survival and spread not only in the soil but also in the digestive tract of the Oligochaeta (^{Kim et al., 2004}; ^{Valle-Molinares et al., 2007}).

The mostly represented bacterial species in the intestine of worms of both sites were Bacillus subtilis and Bacillus sp., with 16 and 9 isolates (Table 1), respectively. Staphylococcus warneri was another species with significant representation in the E. foetida intestine, with nine isolates. This species is a Gram-positive coccus, coagulase negative, commonly found on the skin microbiota of humans and animals, which can cause infection in humans with weakened immune system (^{Predari, 2007}); however, it is necessary to corroborate in this species the existence of human pathogenicity genes.

A single isolation of Pantoea agglomerans was detected in the worms of IRBIO. P. agglomerans is a Gram-negative bacillus, inhabitant of soil, plant pathogen, but also reported as a pathogen of humans. It has been associated with bacteremia in blood, soft tissues and joints in children (^{Cruz et al., 2007}). As in the case of S. warneri, it is necessary to determine the presence genes for human pathogenicity in this isolate.

The bacterial species were not uniformly distributed throughout the digestive tract, except for Bacillus sp., which was found in sections A, B and C of the worms of both IRBIO and COLPOS, with a total of 16 isolates (Table 2). Some bacterial species were detected in the three intestinal sections of either worms, as is the case of Bacillus simplex, Solibacillus sp. and Arthrobacter sp., present in sections A, B and C of the digestive tract of IRBIO worms, with frequencies of 5, 5 and 4, respectively. Staphylococcus warneri was present in the three sections of the worms of COLPOS, with frequencies of 3, 4 and 2, respectively (Table 2).

There is no experimental evidence to explain the distribution of bacterial species in the digestive tract of the studied oligochaetes. The different bacterial species found in the three intestinal sections of E. faetida, as well as their metabolic variability, could explain the role of the earthworm in the modification of microbial populations in the composted materials (^{Pathma and Sakthivel, 2012}); however, similar bacterial communities are reported in vermicomposts of different organic wastes (^{Fernández-Gómez et al., 2012}).

Phylogenetic analysis of bacterial populations

Figures 3 and 4 show the phylogenetic trees of the bacterial strains isolated from intestine of worms of IRBIO and COLPOS, respectively. The terminal nodes of the tree correspond to the studied organisms, while internal nodes represent the common ancestors that share two or more taxa (^{Gregory, 2008}).

Figure 3 shows that some species of the genus Bacillus are within the same clade (B. subtilis, B. safensis and B. pumilis); however, other species of the same genus, such as B. flexus, B. megaterium and B. simplex, share Staphylococcus sp. as a common ancestor. That means that the conservative gene for these three bacilli species arose from some Staphylococcus. Moreover, as the bacillary morphology groups different species, four species of Solibacillus sp. present in the worms of IRBIO denote proximity to the genus Bacillus, which arose from Paenibacillus sp. Figure 4 presents an overview of the major taxonomic groups. It exhibits the sequences of 45 bacterial isolates of the intestine of E. foetida from COLPOS. It is noted that some Bacillus species lie within the same clade (Bacillus sp. and B. subtilis).

Figure 3 Phylogenetic tree constructed using partial 16S rRNA gene sequences obtained with Maximum Parsimony method. The bacteria were isolated from the intestine of Eisenia foetida from IRBIO, State of Chiapas, Mexico. The analysis included 57 nucleotide sequences. The consistency index was 0.607890, the retention index was 0.901973 and the composite index was 0.598406 for all sites. Numbers in parenthesis correspond to the access numbers in the GenBank. 

Figure 4 Phylogenetic tree constructed using partial 16S rRNA gene sequences obtained with Maximum Parsimony method. The bacteria were isolated from the intestine of Eisenia foetida from COLPOS, State of Mexico, Mexico. The analysis included 45 nucleotide sequences. The consistency index was 0.697309, the retention index was 0.927575 and the composite index was 0.709227 for all sites. Numbers in parenthesis correspond to the access numbers in the GenBank. 

Biochemical analysis of bacterial populations

Table 3 shows the enzyme activity and use of C source by Gram-negative bacteria isolated from the gut of E. foetida. Stentrophomonas showed catalase, β-glucosidase, protease, and β-galactosidase activities. Aeromonas and Arthrobacter only showed β-glucosidase and catalase activities, respectively, while Acinetobacter presented protease and β-galactosidase activities. This is evidence of the biochemical potential of bacterial communities along the different sections of the E. foetida intestine. The transformation of organic matter passing through the intestine is closely related to the biochemical versatility of the bacterial species of composting worms (^{Pathma and Sakthivel, 2012}).

Stentrophomonas was the most versatile genus in the use of C source because it assimilated glucose, arabinose, mannose and mannitol. Arthrobacter and Acinetobacter shared with Stentrophomonas the use of mannitol; however, these two genera, along with Aeromonas, used caprate and malate as C source. Acinetobacter was the only positive citrate genus. Probably, the biochemical versatility of Stentrophomonas enables it to be present in the digestive tract of worms of IRBIO and COLPOS (Table 2). ^{Hong et al. (2012)} reported the same biochemical versatility, but in different bacterial species associated o the gut of the red Californian worm.

Table 4 shows the capacity of Bacillus species of the digestive tract of E. foetida to use different C sources. B. safensis hydrolyzed 11 of the 20 tested carbon sources, while Bacillus sp., B. cereus and B. flexus used 10 of those. Paenibacillus was the less versatile species since it only used three carbon sources: esculin, salicin and sucrose. All Bacillus species used esculin as C source, except B. pumilus. Seven of the 10 species of Bacillus used salicin and sucrose. Ribose was used only by B. cereus, whereas inulin and starch were hydrolyzed only by Bacillus sp. In addition to the spore-formation strategy, that ensures the survival and spread, the versatility of Bacillus to use different C sources contributes to the exploration and permanence in niches such as the digestive tract of E. foetida.

This research represents the basis for future studies in order to know the bacterial diversity of the gut of E. foetida. The ultimate goal is to ​​improve vermicompost biotechnology. There is the possibility of modifying the bacterial flora of the worm, favoring the presence of most efficient bacterial species for transformation of organic matter or detoxification of xenobiotic compounds.