Servicios Personalizados
Revista
Articulo
texto en 
Inglés (pdf)
Artículo en XML
Referencias del artículo
Traducción automática
Enviar artículo por emailIndicadores
-
Citado por SciELO -
Accesos
Links relacionados
-
Similares en
SciELO
Compartir
Permalink
Revista mexicana de fitopatología
versión On-line ISSN 2007-8080versión impresa ISSN 0185-3309
Rev. mex. fitopatol vol.43 no.1 Texcoco ene. 2025 Epub 27-Mayo-2025
https://doi.org/10.18781/r.mex.fit.2401-7
Review Articles
Tobamovirus fructirugosum an emerging disease: review and current situation in Mexico
1 Departamento de Parasitología Agrícola, Postgrado en Ciencias en Parasitología Agrícola, Universidad Autónoma Agraria Antonio Narro, #1923, Calzada Antonio Narro, Buenavista, Saltillo, Coah., CP 25315, México. d_ubilfrido.vazquezG@uaaan.edu.mx
2 Investigador por México CONAHCYT-UAAAN; México.
Results.
ToBRFV was generated from a mutation resulting from genetic recombination with TMV, considered the main progenitor and ToMMV secondary progenitor. Phylogenetic analyses report the existence of five clades with respect to the genetic diversity of ToBRFV. The first primers for detection were designed in 2015 that encode replication, movement and capsid proteins. Serological methods can be used for preventive diagnosis, while molecular and NGS can confirm virus infection even at low concentrations in the plant. Sixteen weed families and host crops are reported from 47 countries. To achieve an effective strategy, it is necessary to reduce inoculum sources, develop compounds that inhibit mechanical transmission and develop tolerant genotypes.
Conclusion.
ToBRFV is distributed nationally and represents a phytosanitary risk for Mexico; the exhaustive analysis of the study of diagnostic techniques, host range, dissemination, epidemiology and control strategies, contributes to the knowledge of ToBRFV.
Key-words: Diagnosis; epidemiology; ToBRFV; virus progression; genetic variability
Antecedentes/Objetivo.
La especie Tobamovirus fructirugosum (ToBRFV) es considerado una plaga cuarentenaria a nivel mundial que limita la producción de Solanum lycopersicum y Capsicum annum, actualmente presente en tres países del continente americano. El objetivo de este trabajo fue profundizar en la variabilidad genética del ToBRFV con respecto a los diversos aislados, la caracterización físicomolecular y sintomática, los métodos tradicionales y más actuales implementadas para el diagnóstico, rango de hospedantes reservorios del virus, y la epidemiología.
Resultados.
ToBRFV se generó de una mutación resultado de la recombinación genética con TMV, considerado principal progenitor y ToMMV progenitor secundario. Análisis filogenéticos reportan la existencia de cinco clados con respecto a la diversidad genética del ToBRFV. Los primeros cebadores para la detección se diseñaron en 2015 que codifican proteínas de replicación, movimiento y cápside. Los métodos serológicos pueden ser utilizados para un diagnóstico preventivo, mientras que las moleculares y NGS pueden confirmar la infección por el virus aún en bajas concentraciones en la planta. Se reportan 16 familias de malezas y cultivos hospedantes, registrados en 47 países. Para lograr una estrategia efectiva, es necesario disminuir las fuentes de inóculo, desarrollar compuestos inhibidores de la transmisión mecánica y el desarrollo de genotipos tolerantes.
Conclusión.
ToBRFV está distribuido a nivel nacional, y representa un riesgo fitosanitario para México; el análisis exhaustivo del estudio de técnicas de diagnóstico, rango de hospedantes, diseminación, epidemiología y estrategias de control, contribuye al conocimiento del ToBRFV.
Palabras clave: Diagnóstico; epidemiología; ToBRFV; progreso del virus; variabilidad genética
Introduction
Tobamovirus research has gained importance across agronomic and scientific fields due to the viruses’ genetic diversity, transmission mechanisms, adaptability, host range evolution, new taxonomic classifications, and virus-plant interactions (Aiewsakun and Katzourakis, 2016). The genus Tobamovirus is believed to have emerged 140-120 million years ago, coinciding with the rise of angiosperms (Gibbs, 1999). Initially, these viruses existed in wild plants without plant-pathogen interactions, maintaining ecological homeostasis. However, the onset of agriculture transformed them into pathogens affecting solanaceous plants and other families (Lartey et al., 1996).
The Virgaviridae family encompasses 5 phytopathogenic virus genera, including the globally significant Tobamovirus, which comprises 37 species (Adams et al., 2017; Dombrovsky et al., 2017a). Economically important tobamoviruses include: tobacco mosaic virus (TMV, Tobamovirus tabaci), tomato mosaic virus (ToMV, Tobamovirus tomatotessellati), tobacco mild green mosaic virus (TMGMV, Tobamovirus mititessellati), pepper mild mottle virus (PMMoV, Tobamovirus capsici), tomato mottle mosaic virus (ToMMV, Tobamovirus maculatessellati), and tomato brown rugose fruit virus (ToBRFV, Tobamovirus fructirugosum) (EPPO, 2023). TMV, the first identified tobamovirus (Ivanovsky, 1892), caused an epidemic in Dutch tobacco-producing regions before spreading worldwide (Shen et al., 2013). Later discoveries include yellow tailflower mild mottle virus (YTMMV, Tobamovirus anthocercis) in Australia, affecting ornamental solanaceous species (Wylie et al., 2014), and ToMV (Skotnicki et al., 1976) and ToMMV infecting tomato and pepper plants in Mexico (Li et al., 2013). While all tobamovirus species are aggressive emerging pathogens causing significant crop losses, the tomato brown rugose fruit virus stands out for its economic impact. Notably, it is considered the first plant virus to cause a global pandemic since SARS-CoV-2 (Salem et al., 2023).
Origin and Genetic Diversity of ToBRFV
Viral species of the genus Tobamovirus are significant pathogens in solanaceous crops, notable for the symptoms they induce and the need for specific serological methods for their identification. Nevertheless, some symptoms produced are similar among the causative species, such as TMV, ToMV, ToMMV, and ToBRFV (Alon et al., 2021). Some studies report that TMV, ToMV, and ToBRFV can produce mixed infections in tomato plants, complicating diagnosis (Jamous et al., 2022; Yan et al., 2021a). ToBRFV was first identified in 2014 in the Ohad province of southern Israel. Subsequently, an outbreak in tomato nurseries in Jordan led to the isolation named “Tom1-jo”, and the new virus was designated tomato brown rugose fruit virus (Salem et al., 2016; Luria et al., 2017). Through phylogenetic analyses including
TMV, ToMV, ToMMV, and BPMV, Salem et al. (2016) validated ToBRFV as a new species within the genus Tobamovirus. Luria et al. (2017), using Koch’s postulates, transmission electron microscopy (TEM), partial host range determination, and antisera analysis to rule out cross-reactivity with other viruses, concluded that the ToBRFV-IL isolate showed high identity with the Jordanian isolate.
Current biogenomic studies on ToBRFV, following new outbreaks, have demonstrated genetic variability, with over 99% identity among different isolates (Chanda et al., 2020). Eichmeier et al. (2023) found 99.3 to 100% similarity among 50 ToBRFV genomes, while Zhang et al. (2022) clearly differentiated ToBRFV isolates from TMV and ToMV in a study of 78 genomic sequences. Yan et al. (2021b) reported over 99.6% similarity among Tom1-Jo “KT383474.1”, ToBRFV IL, and ToBRFV MX isolates, suggesting a common ancestor for all ToBRFV isolates (Oladokun et al., 2019). Additionally, recombination of ToBRFV with other viral species has been identified, indicating ToMMV as a secondary progenitor and the TMV Ohio V strain as the main progenitor (Salem et al., 2016).
A phylogenetic analysis based on the ORF4/CP gene (Figure 1) grouped
34 isolates from Turkey in the first clade, while 49 isolates were placed in the
Figure 1 Phylogenetic analysis of ToBRFV sequences reported in NCBI. For the reconstruction of the phylogenetic tree, Molecular Evolutionary Genetics Analysis version 11 software was used with the Neighbor joining model and 10,000 replicates (Bootstrap). With a genetic distance of 0.02.
second (Çelik et al., 2022). Two French isolates “MW284988.1, MW284987.1” were classified in the third clade, while 12 isolates from various regions including USA (MT002973.1), Mexico (TBRFV-MX-CP “MK319944.1, MW349655.1”),
Netherlands “MW314116.1”, Italy “OK62464678.1”, Belgium (OM515231.1), and United Kingdom (TBRFV.21930919) formed the fifth group (Van de Vossenberg et al., 2020). Abrahamian et al. (2022) revealed a phylogenetic analysis of isolates from USA, Mexico, and Peru, reporting that most of these group in clade three, evidencing limited genetic diversity among isolates worldwide. Eichmeier et al. (2023) analyzed the complete virus genome, identifying the Czech ToBRFV isolate “OP413740.1” as belonging to an independent group within the fifth clade, distinguishing it from other European isolates. This overview underscores the complexity of ToBRFV genomics and the influence of multiple factors on its evolution and relationship with hosts.
Physical and Molecular Characteristics of ToBRFV
ToBRFV has rigid rod-shaped particles 300 nm long and 18 nm in diameter. The genome is a positive-sense single-stranded RNA (ssRNA+) of ~6,400 nt. It contains four distinct open reading frames (ORF1, 2, 3, and 4), encoding two replication-related protein complexes of 126 kDa (ORF1a) and 183 kDa (ORF1b), the movement protein (MP) of ~30 kDa (ORF2), and the coat protein (CP) of ~17.5 kDa (ORF3), expressed through coterminal subgenomic RNAs (Eichmeier et al., 2023). The 126 kDa protein can act as an RNA silencer, while the 30 kDa MP facilitates cell-to-cell virus translocation (Zhang et al., 2022). It has been noted that the ToBRFV control strategy focuses on the CP, which plays a crucial role in viral particle assembly and long-distance movement within the host plant (Ishikawa et al., 2022).
Description of Symptoms
ToBRFV, a distinctive tobamovirus, induces a wide array of symptoms in its hosts. The severity and type of symptoms vary based on the host plant species, season, temperature, growth conditions (greenhouse or open field), and plant age at infection (Caruso et al., 2022). These symptoms, both direct and indirect, significantly diminish fruit quality and commercial value, leading to substantial crop losses (Menzel et al., 2019). Symptom expression varies with crop type and environmental factors (Figure 2A and C). Tomato plants exhibit systemic symptoms, while species like Nicotiana tabacum, N. glutinosa, N. clevelandii, N. benthamiana, and Chenopodium amaranticolor primarily display localized symptoms (Chanda et al., 2021; Vásquez-Gutiérrez et al., 2024). Although tobamoviruses generally
Figure 2 Symptoms manifested in tomato plants by ToBRFV grown in greenhouse. A) Tomato plants at 180 days after sowing showing high incidence of ToBRFV; B) Irregularities in fruit ripening; C) Plants in a state of collapse due to severe ToBRFV infection; D) Presence of mosaic patterns, mottling, and blistering on leaves.
cause similar symptoms such as mosaics and yellowing, ToBRFV stands out for its particularly severe syndrome. Foliar symptoms include mosaics, blistering, curling, deformations (Figure 2D), reduced leaf size, and stunted growth. Fruits exhibit deformation, brown spots, mottling, irregular ripening (Figure 2B), yellow spots, and both external and internal necrosis (González-Concha et al., 2023; Jewehan et al., 2022a; Vásquez-Gutiérrez et al., 2023a; Zhang et al., 2022). This symptom diversity highlights the critical need for effective identification and management of ToBRFV to mitigate its impact on agricultural productivity.
Diagnostic methods
Diagnostic methods begin with the identification of plant symptoms. The observation of dark mosaics, deformation and narrowing of leaves in young apical shoots, and brown rugosity on fruits confirms the presence of ToBRFV (Alfaro- Fernández et al., 2021). Currently, there are various alternatives for ToBRFV
identification and detection, which can be classified into different types: differential plant diagnosis, transmission electron microscopy (TEM), serological methods, reactive strips, and molecular techniques (González-Garza, 2017).
Diagnosis using Differential Plants. Tobamoviruses exhibit distinct symptomatic patterns that distinguish them from other genera (Roistacher, 1991). Initially, ToBRFV was thought to naturally infect only pepper and tomato (Luria et al., 2017). However, recent studies have expanded our understanding of its host range. Cultrona et al. (2024) demonstrated that ToBRFV can naturally infect Convolvulus arvensis and Polycarpon tetraphyllum, which serve as reservoirs. Furthermore, Vásquez-Gutiérrez et al. (2024) identified and confirmed through ELISA that ToBRFV can naturally infect 21 different host species.
ToBRFV’s host range encompasses over 40 species across four families: Amaranthaceae, Apocynaceae, Asteraceae, and Solanaceae (Table 1). Its host range similarity to ToMV reflects their close phylogenetic relationship (Chanda et al., 2020). Differential plants enhance ToBRFV diagnosis by leveraging the hypersensitive response (HR), though mixed infections with other tobamoviruses can complicate interpretation (González et al., 2017). When mechanically inoculated, experimental plants exhibit an HR that isolates ToBRFV particles, limiting systemic spread (Fidan et al., 2021).
Experimental host range studies for ToBRFV primarily focus on species from
Chenopodiaceae, Amaranthaceae, and Solanaceae families. Notably, it does not
Table 1 Hypersensitivity response in the range of hosts susceptible to ToBRFV
| Host/Observed symptomatology | References |
|---|---|
| Amaranthaceae | |
| Gomphrena globosa3, 18, Amaranthus viridis14 | Salem et al., 2022 |
| Asteraceae | |
| Emilia sonchifolia9, 10, 21, Glebionis coronaria3, 20, Lactuca serriola4, Verbesina encioloides14, Bidens pilosa14, Helianthus annus14, Sonchus oleraceus14, Titonia tubaeformis14 | Sabra et al., 2022; Salem et al., 2022; Matzrafi et al., 2023; Luria et al., 2017; Chanda et al., 2021a; Vásquez-Gutiérrez et al., 2024 |
| Labiatae | |
| Marrubium vulgare13, 21 | Vásquez-Gutiérrez et al., 2024 |
| Solanaceae | |
| Salanum lycopersicum3, 11, 23, S. eleagnifolium1, S. rostratum 4, 20, 21, 22, S. melongena1, S. arcanum8, 19, 20, 22, 24, S. Cheesmaniae7, 16, 19, 22, S. habrochaites3, 7, 16, S. nigrum3, 4, 12, 18, 20, S. pennellii3, 8, 22, S. peruvianum3, 8, 16, 22, S. pimpinellifolium3, 8, 16, 22, S. tuberosum1, 7, 21, S. sitiens3, Nicotiana glutinosa5, 10, N. tabacum Samsun 3, 5, 10, 20, N. occidentalis subsp. Hesperis5, 15, N. benthamiana2, 6, 5, 15, 21, 22, N. clevelandii 3, 10, 21 N. sylvestris3, 10, N. rustica2, 12, 14, 28, N. longiflora12, N. glauca14, Petunia hibrida3, Physalis angulata3, P. pubescens5, 7, Datura stramonium10, 14, Capsicum annum3, 5, 8, 13, 21 | Matzrafi et al., 2023; Salem et al., 2022; Yan et al., 2021a; Sabra et al., 2022; Jewehan et al., 2022b; Chanda et al., 2021a; Zhang et al., 2022; Vásquez- Gutiérrez et al., 2024; Luria et al., 2017; Ortiz-Martínez et al., 2021 |
| Chenopodiaceae | |
| Chenopodium berlandieri12, 18, Ch. amaranticolor14, Ch. album8, 12, 17 Ch. quinoa10, 12, 17, 18, Ch. glaucum12, Ch. Murale14 | Chanda et al., 2021a; Luria et al., 2017; Sabra et al., 2022; Sabra et al., 2022; Salem et al., 2016; Sabra et al., 2022; Vásquez-Gutiérrez et al., 2024 |
| Convolvuláceae | |
| Ipomoea purpurea4,7 | Vásquez-Gutiérrez et al., 2024 |
| Apocynaceae | |
| Catharanthus roseus1 | Chanda et al., 2021a |
| Malvaceae | |
| Malva parviflora21, Malva neglecta14, Malvastrum coromandelianum14 | Salem et al., 2022; Vásquez-Gutiérrez et al., 2024 |
| Nyctaginaceae | |
| Mirabilis jalapa4, 21, 7, 24 | |
| Oxalidaceae | |
| Oxalis latifolia14 | |
| Resedaceae | |
| Reseda luteola14 | |
| Araliaceae | |
| Hedera hélix14 | |
| Plantaginaceae | Vásquez-Gutiérrez et al., 2024 |
| Plantago lanceolata14 | |
| Polygonaceae | |
| Polygonum convolvulus14 | |
| Ranunculaceae | |
| Clematis drummondii4, 7. 21, 24 | |
| Euphorbiaceae | |
| Ricinus comunis14 |
¹asymptomatic; ²plant death; ³mosaic; ⁴mosaic, ⁵necrosis, ⁶blistering, ⁷Leaf distortion, ⁸deformation, ⁹local black spots, ¹¹plant stunting ¹²Necrotic local lesions, ¹³necrotic spots, ¹⁴chlorotic local lesions, ¹⁵Plant death, ¹⁶blister formation, ¹⁷chlorosis, ¹⁸necrotic ring spot, ¹⁹leaf narrowing, ²⁰mottling, ²¹yellowing, ²²leaf curling, ²³stunting, ²⁴leaf deformation.
infect species from Brassicaceae, Cucurbitaceae, and Verbenaceae (Yan et al., 2021a; Chanda et al., 2021a). While most indicator plants display both systemic and local symptoms, some species like Solanum tuberosum and S. melongena were initially reported as asymptomatic (Yan et al., 2021b). However, Vásquez- Gutiérrez et al. (2024) recently observed that S. tuberosum plants in contact with ToBRFV-infected tomatoes developed visual symptoms including yellowing, leaf deformation, and size reduction, subsequently confirmed by ELISA.
Alternative hosts. ToBRFV has proven to be a pathogen with a wide range of potential hosts, including crops and various weeds (Chanda 2021a; Zhang et al., 2022; Matzrafi et al. 2023) (Table 1). Weeds play a significant role in the spread of ToBRFV inoculum (Matzarafi et al., 2023), highlighting the importance of integrated management that includes weed control to limit virus propagation.
Microscopic diagnosis. Microscopic methods are crucial for diagnosis but can be imprecise due to variability in viral particle size among species (Luria et al., 2017). Optical microscopy, particularly when combined with fluorescence techniques, supports tobamovirus diagnosis through viral inclusions in plant tissues (Pepperkok and Ellenberg, 2006). Virus classification using inclusions is done by genera, as most tobamovirus species form hexagonal and needle-shaped inclusions like tobacco mosaic virus (Khamphirapaeng et al., 2017), while potato virus Y (species Potyvirus yituberosi) produces amorphous spherical bodies (Guo et al., 2022). ToBRFV inclusions were previously undescribed; recently, Vásquez-Gutiérrez et al. (2024) reported X-bodies, rounded and stacked plates as infection responses to ToBRFV in tomato and tobacco tissues. Transmission electron microscopy (TEM) has contributed to ToBRFV’s morphological identification since its first sighting (Luria et al., 2017; Zhang et al., 2022) and is considered a classic method for visualizing plant tissues (Home et al., 2018). TEM diagnosis aids in characterizing viral particles based on morphological features (Kitajima et al., 2004). However, TEM can be imprecise as viral particles vary in size, complicating identification (Luria et al., 2017). Electron microscopy also detects cellular alterations during ToBRFV infections related to viral inclusions. Despite being recently identified, TEM proved valuable for ToBRFV’s viral characterization and particle observation. Luria et al. (2017), Cambrón-Crisantos et al. (2019), Eichmeier et al. (2023), Fidan et al. (2021), Levitzky et al. (2019), and Mahillon et al. (2022) sampled infected tomato leaflets and fruits cv. Mose and Ikram with unusual symptoms, then purified the unknown virus following Cohen et al. (2000). They found viral particles averaging 265.6±56.2nm long and 19±1.41nm in diameter, noting that
particles differ based on sample origin and can be short or elongated rods.
Serological detection of ToBRFV. Serological detection of ToBRFV employs techniques like Double Antibody Sandwich Enzyme-Linked Immunosorbent Assay (DAS-ELISA), in situ immunofluorescence, and Western blot. Previously, these methods lacked specificity in distinguishing ToBRFV from related species like TMV and ToMV, possibly due to cross-reactivity between antibodies and coat proteins (CP) of different tobamoviruses. Luria et al. (2017) serologically characterized ToBRFV, generating antibodies for virus CP detection using DAS- ELISA (1:12,000 dilution). Their analysis showed slight cross-reactivity with TMV
and PMMoV. Field diagnosis typically uses symptomatic leaflets, increasing DAS-
ELISA accuracy.
Yan et al. (2021b) developed monoclonal antibodies specific to ToBRFV CP, improving diagnostic sensitivity and specificity. Eads et al. (2023) validated an Agdia® DAS-ELISA with high analytical sensitivity (64 to 320 pg mL-1) and specificity for ToBRFV, noting cross-reactivity with TMV, ToMV, and ToMMV at higher concentrations. Luria et al. (2017) implemented Western blot diagnosis using ToBRFV-specific polyclonal antibodies, analyzing CP band intensity via t-student test.
In situ immunofluorescence, enhanced by specific fluorophores for laser scanning microscopy, enables direct ToBRFV detection in infected samples, differentiating between tobamoviruses (Klap et al., 2020). This technique often uses Alexa Fluor 594®, a bright, stable red-spectrum fluorophore (Salem et al., 2022). Another variant involves staining seeds, plant tissues, and roots for fluorescence in situ hybridization and microscopic detection (Ragasová et al., 2022).
These serological methods contribute to accurate diagnosis and characterization of ToBRFV’s physicochemical effects on infected hosts, offering valuable tools for virus management and control.
Diagnosis with test strips. The quest for rapid virus diagnosis in field conditions has gained importance (Fillmer et al., 2015; Li et al., 2019). Following ToBRFV’s emergence (Salem et al., 2016; Luria et al., 2017), rapid immunochromatographic assays using test strips for plant virus detection have become significant due to their sensitivity and field applicability (Byzova et al., 2009). Agdia® test strips for ToBRFV specifically detect isolates from Israel, the Netherlands, Italy, Germany, and Mexico, validating field monitoring results (Levitzky et al., 2019; Eldan et al., 2022). Despite a ToBRFV detection limit of 200 ng mL-1, cross-reactions with related viruses occur. These strips may cross-react with TMV, ToMV, and ToMMV at low concentrations, necessitating validation through molecular assays (Wilstermann and Ziebell, 2019). Eads et al. (2023) recently determined a 1:259,000 dilution limit for ToBRFV detection in infected tissue with 64-320 pg mL-1 of purified virus. Their validation of Agdia® strips revealed slight cross-reactivity with TMV and ToMV at a 200 ng mL-1 detection limit for purified virus. However, the strips showed no cross-reaction with other ToBRFV-related species. Notably, all 384 ToBRFV-positive samples tested positive using these strips (Figure 3 A and B).
Molecular techniques for ToBRFV detection. Early detection through molecular diagnosis of ToBRFV presents an opportunity to reduce the risk of virus entry and spread (Luigi et al., 2022). Consequently, various protocols based on nucleic acid amplification have been developed, including: reverse transcription polymerase
Figure 3 Rapid detection procedure for ToBRFV using Agdia® immunological strips. A) Selection of symptomatic tissue (young leaves); B) Macerated sample and positive reaction to ToBRFV, showing the control line and the test line (both in red color).
chain reaction (RT-PCR), quantitative reverse transcription PCR (RT-qPCR), and digital PCR (ddPCR) for detection in leaflets, fruits, and seeds (Panno et al., 2019b; Rodríguez et al., 2019; Chanda et al., 2021b; Yan et al., 2021b; Menzel & Winter, 2021). The development of these molecular techniques has gained relevance in expanding real-time virus diagnostic strategies. Due to result variation and the efficacy of existing molecular methods, new techniques have been continuously developed to allow specific detection of genes in ToBRFV viral proteins. These primers, described in Table 2, are used for preventive diagnosis of ToBRFV, reducing the risk of entry into countries where the virus is absent.
Vargas-Hernández et al. (2022) implemented a digital droplet polymerase chain reaction (ddPCR) assay that enables the detection of the virus using recombinant plasmids encoding a specific gene of the virus coat. This is the first report of ToBRFV detection in tomato seeds using ddPCR. However, the technique has not been widely implemented for field application. Another recent method is the application of AmplifyRP XRT, a technique based on the molecular principle, which utilizes recombinase polymerase amplification. This technique is designed to be a hybrid tool for field and/or laboratory detection. Therefore, it is considered a highly sensitive and precise technique, with an analytical sensitivity of 16 fg µL-1 and an analytical specificity that encompasses all ToBRFV isolates, without producing cross-reactions (Eads et al., 2023). Detection based on loop-mediated isothermal amplification (LAMP) offers an efficient and robust alternative for ToBRFV
Table 2 Primers Reported for the International Detection of ToBRFV.
| Tejido de detección | Iniciadores | Secuencias de nucleótidos 5´ a 3´ | Región blanco | Tamaño del amplicón | Autores |
|---|---|---|---|---|---|
| ToBRFV-F ToBRFV-R | AACCAGAGTCTTCCTATACTCGGAA CTCWCCATCTCTTAATAATCTCCT | RdRp1 | 475 bp | Rodríguez et al., 2019 | |
| Foliolos y frutos | |||||
| TBRFV-F-5722 TBRFV-R-6179 | CACAATCGCAACTCCATCGC CAGAGGACCATTGTAAACCGG | Panno et al., 2019a | |||
| PC1 | 458 bp | ||||
| Foliolos | AB5520F AB5598R | GTAAGGCTTGCAAAATTTCGTTCG CTTTGGTTTTTGTCTGGTTTTCGG | PC1 | 101 bp | Panno et al., 2019b |
| Foliolos y frutos | ToBRFV-F-Alk ToBRFV-R-Alk | AATGTCCATGTTTGTTACGCC CGAATGTGATTTAAAACTGTGAAT | RdRp1 | 560 bp | Alkowni et al., 2019 |
| Foliolos y frutos | ToBRFV-F ToBRFV-R | GAAGTCCCGATGTCTGTAAGG GTGCCTACGGATGTGTATGA | PC1 | 842 bp | Ling et al., 2019 |
| Foliolos, frutos y semillas | ToBRFVqs1 ToBRFVp1 ToBRFVqas2 | CAATCAGAGCACATTTGAAAGTGCA FAM-ACAATGGTCCTCTGCACCTG-BHQ1 CAGACACAATCTGTTATTTAAGCATC | PC2 | 96 bp | Menzel and Winter, 2021 |
| Foliolos | CP FOR CP REV | AGAACAACCGTTCAACGGCAATTTA CTCAAGATGCAGGTGCAGAGGACCATTGT | PC4 | 359 bp | Magaña-Álvarez et al., 2021 |
| Foliolos, frutos y semillas | CaTa28-FW CaTa28-Pr CaTa28-Rv | GGTGGTGTCAGTGTCTGTTT FAM-AGAGAATGGAGAGAGCGGACGAGG -BHQ1 GCGTCCTTGGTAGTGATGTT | PM3 | 139 bp | Federación In- ternacional de Semillas, 2020 |
| CSP13251Fw CSP1325 Pr CSP1Rv | CATTTGAAAGTGCATCCGGTTT HEX-ATGGTCCTCTGCACCTGCATCTTGAGA -BHQ1 GTACCACGTGTGTTTGCAGACA | PC3 | 100 bp | Federación In- ternacional de Semillas, 2020 | |
| Foliolos y semillas | AB-620 AB-621 | CAGATGTGTCGTTGGTCAGAT CATCACTACGGTGTAATACTTC | PM1 y PM2, ORF5 | 144 bp | Bernabé-Orts et al., 2022* |
| Foliolos | ToBRFV-R1 ToBRFV-P1 | GCCCATGGAACTATCAGAAGAA TTCCGGTCTTCGAACGAAAT | PM3 | 92 bp | Chanda et al., 2021a* |
| Foliolos, frutos y semillas | F ToBRFV_F3 ABRFV_B3 | TTGGAGTCTTAGATGTTGCG GGACACCGTCAACTAGGA | PM6 | 279 bp | Sarkes et al., 2020; Rizzo et al., 2021 |
| F-3666 R-4718 | ATGGTACGAACGGCGGCAG CAATCCTTGATGTGTTTAGCAC | RdRp1 | 1052 bp | Luria et al., 2017 | |
| Foliolos | ToBRFV-1534-F ToBRFV-3733-R | AGATTTCCCTGGCTTTTGGA ATCATCGCCACCAAATTTTC | RdRp1 | 1052 bp | Yan et al., 2019 |
| ToBRFV MP1- 59-F1 ToBRFV MP1- 59-R | GAAGTTTGTTTATAGATGGCTCTTGTTA- AGGGTAAA GTATCCACTATCGATGAGTTTTACACCTT- TAAGTAAATTGAC GTCAATTTACTTAAAGGTGTAAAACT- CATCGATAGTGGATAC | PM1 | 15 bp | Yan et al., 2021aA | |
| ToBRFV MP60-126-F ToBRFV MP60-126-R | AAAGGAGTTAAGCTTATTGATGGTGGC- TATGTACAT TGCGTCCTGGGTGGTGATGTTGTAATTTG- GAACGACT | PM1 | 15 bp | ||
| ToBRFV MP127-186-F ToBRFV MP127-186-R | GACGGAGGTCCCATGACTACCAAGGACG- CAGAAA TTCTTCTGTAAGTTCCATGGGCCCTCCATC | PM1 | 15 bp | ||
| Foliolos | ToBRFV MP187-266- FToBRFV MP187-266-R1 | GACGGAGGTCCCATGGAACTAT- CAGAAGAAGTTGTTGATG TTGTGTAAGATCTATTTAATACGAATCT- GAATCGGC | PM1 | 15 bp | |
| ToBRFV-CP- detection- FToBRFV-CP- detection-R | ATGTCTTACACAATCGCAACTC TCAAGATGCAGGTGCAGAG | PC1 | 1019 bp | ||
| q-ToBRFV CP-Fq-ToBRFV CP-R | AAATCAGGCGAACCCG GCAGAGGACCATTGTAAACC | PC1 | 173 bp | ||
| q-ToBRFV RdRp-Fq- ToBRFV RdRp-R | CAATACCTTGGTCAACGAT TTGGGCATACAGCAGTG | RdRp1 | 329 bp |
Technique: ¹RT-PCR endpoint; ²RT-qPCR; ³RT-qPCR multiplex, ⁴SEqPCR; ⁵CRISPR/Cas; ⁶LAMP; ᴬPrimers used in the study
reported by the corresponding author; *real-time monitoring; RdRp: RNA-dependent RNA polymerase; MP: movement protein.
diagnosis. Sarkes et al. (2020) describe the principle of this technique, which is based on the specificity of a set of primers; F3: TTGCAAGTCTTAGATGCG, B3: GGACACCGTCAACTAGG with a size of 279 bp. FIP(F1c+F2): CCTTCTCCAACTGTCGCAAGTCACATGCTAGGAAGTACCAC, BIP (B1c+B2) CCGTGAGTTCTGAGTCAATGGTTGAGGCTCACCACCATCTC
TTAA and loopF; CTCCATGCTCATCATACCCAA. LAMP assays are performed
in a WarmStart LAMP colorimetric master mix (NEB Canada). The reaction program consists of a single step, where tubes are incubated at 65°C for 30 min, after which the reactions are visualized and the results are recorded photographically. Positive results confirm the presence of the virus when there is a color change in the reaction mixture from pink to yellow. These results indicate that LAMP can detect six molecules in a 25 μL reaction, being more specific than RT-PCR. On the other hand, LAMP-PCR has been used in combination with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology for the specific detection of ToBRFV in the field (Rizzo et al., 2022).
Next-generation sequencing (NGS) has gained relevance with the emergence of new omic technologies. NGS remains dominant in plant virus detection due to its high throughput and low cost (Dumschott et al., 2020). The importance lies in the ability to generate enormous data and its rapid processing (Mehetre et al., 2016). NGS shares processes that are common for plant virus detection, such as the extraction of nucleic acids (DNA/RNA) from infected samples, the subsequent fragmentation of the nucleic acid for library preparation, and finally, the development of several synthetic primers in the fragmented DNA for the consecutive development of different sequencing chemistries and platforms for ToBRFV analysis (Luria et al., 2017; Riesenfeld et al., 2004). NGS coupled with MiSeq Illumina, known as second-generation technology, allows the detection of ToBRFV at low concentrations in the plant, even in asymptomatic infections, through metagenomic analysis (Mehetre et al., 2021). The technique could be used for the mass monitoring of emerging viruses, limiting their spread and impact on economically important crops.
Spread of the virus
The tomato brown rugose fruit virus was first identified in Israel in 2014 in tomato plantations under shade mesh, according to Luria et al. (2017). However, it was not until 2015 that the first report of its presence in tomato greenhouses in Jordan was made, where atypical symptoms were observed compared with other viruses; on leaves, mosaics, blistering, and on fruits, yellow spots to brown rugosity (Salem et al., 2016). Molecular analyses confirmed the presence of a new tobamovirus in tomato plants, which was identified as tomato brown rugose fruit virus (Salem et al., 2016; Luria et al., 2017)*. The appearance and severity of symptoms in fruits affected by ToBRFV constituted a significant obstacle to their commercialization, and the absence of adequate diagnostic methods along with epidemiological plans delayed the implementation of quarantine control measures (Zhang et al., 2023). After its discovery, the virus spread rapidly worldwide, mainly through contaminated seeds, as Israel and Jordan are prominent seed exporters.
This marked the beginning of the global expansion of the virus (Van de Vossenberg et al., 2020). Currently, ToBRFV is present on five continents: America, Asia, Africa, Europe, and Oceania, covering 47 countries where it has been reported in *Solanum lycopersicum *and Capsicum annum crops (Figure 4). Although its presence has not been officially confirmed in Oceania, it has been indicated that seeds from Australia were contaminated with ToBRFV, suggesting its existence in the region (EPPO, 2023; Zhang et al., 2022).
Figure 4 ToBRFV records in producing regions of the World, indicating its presence in 47 countries distributed across the continents of America, Asia, Africa, Europe, and Oceania. Affected countries are marked with an arrow and highlighted according to the first host found.
With the importation of seeds to Mexico, in 2017, symptoms of a disease that spread mechanically in tomato greenhouses were evidenced. In July 2018, the first case of ToBRFV was registered in Ensenada, Baja California. The analyzed samples showed 100% identity with the 1052 bp region of the RdRP gene of the ToBRFV isolates identified in Israel and Jordan, according to the sequences deposited in GenBank (KX619418 and KT383474.1) (Camacho-Beltrán et al., 2019). In September 2018, the virus was also detected in tomato and chili pepper greenhouses in the Yurécuaro region of Michoacán, confirmed by RT-PCR with a 100% identity to the Israeli strains (Cambrón-Crisantos et al., 2019). Likewise, Ling et al. (2019) in September of the same year, reported the presence of ToBRFV in a greenhouse with tomato plants from Baja California. This evidence shows that the virus spread rapidly through the tomato and pepper production areas in Mexico,
currently being widely distributed throughout the national territory, according to
official reports (Figure 5).
Epidemiology
The dynamics of the spread and evolution of the disease caused by ToBRFV in tomato crops are articulated through different epidemiological phases, reflecting an inherent complexity in the behavior of the virus. The polycyclic ToBRFV disease has a constant production of inoculum mediated by the processes of virus replication within the host cells (Smith and Dambrovsky, 2019), as well as the rapid dispersal and subsequent infection of new individuals (Madden et al., 2007). The epidemiological development stages of ToBRFV can be described (Figure 6) during infection and disease progression in tomato plants. It begins with an initial phase (Figure 6A), where the infection rate is relatively low, which is attributed to the pathogen’s acclimatization phase to its new environment and host. The initial phase is usually triggered by the germination of contaminated seeds; the
Figure 6 Evolution of a ToBRFV epidemic in tomato crops (Hypothetical design). A) Start of infection; B) Growth phase or exponential stage; C) Peak infection point; D) Deceleration phase or stationary phase.
hypocotyl activates the replication of the virus, which was in a latent state in the cotyledons (Dombrovsky et al., 2017b). As the disease progresses, an exponential growth phase is observed (Figure 6B), during which the transmission speed and viral replication intensify drastically, in direct correlation with the observed incidence. Given the high mechanical transmission capacity of ToBRFV and the start of cultural practices in the crop, the virus spreads rapidly (Levitzky et al., 2019). During this period, the relative rate of the disease increases in such a way that it produces a maximum transmission point (Figure 6C), driven by secondary infections in the set of evaluated plants. Crop management practices, together with insufficient disinfection measures, create a scenario where the incidence can reach 100% (Jeger et al., 2018; Klein et al., 2023). At the end of this phase, the epidemic enters a deceleration or stationary phase (Figure 6D), indicating the moment when the disease has infected the maximum possible number of individuals within the plant population. Unlike other members of the Tobamovirus genus, ToBRFV is capable of causing particularly severe infections (Temple et al., 2023), which can be fatal to the plant, especially in the presence of mixed infections with other tobamoviruses. (Vásquez-Gutiérrez et al., 2023b; Abou et al., 2023).
The symptoms caused by ToBRFV in tomato are influenced by biotic and/
or abiotic factors, such as precipitation, humidity, and temperature, which play a crucial role in the incidence and severity of the virus (Nolasco et al., 2023). González-Concha et al. (2023) highlight that the symptomatology in tomato
plants grown in open fields differs significantly from those grown in greenhouses, with high temperatures exacerbating both the incidence and severity of the virus (Salem et al., 2016). Menzel et al. (2019) reported the appearance of dark green protuberances on tomato leaflets under high temperature conditions, while Oladokun et al. (2019) identified necrotic lesions on leaflet peduncles and stem necrosis. Panno et al. (2019a) observed calyx and leaflet petiole necrosis in tomato. Although tobamoviruses generally do not act as necrotrophic parasites with their hosts, ToBRFV constitutes a notable exception to this trend (Caruso et al., 2022). Under favorable conditions, this virus has the ability to cause the collapse of its hosts, demonstrating a distinct and more severe pathogenic impact compared to other members of its genus (Dombrosky and Smith, 2017).
Management strategies
In the absence of specific methods for the control and management of ToBRFV, various cultural strategies have been implemented that partially reduce the spread of the virus in the work area. These strategies include the use of virus-free seeds, avoiding the reuse of substrates (García-Estrada et al., 2024), or, failing that, applying thermal inactivation and disinfection treatments for ToBRFV (Michael et al., 2022; Samarah et al., 2021; Ling et al., 2022), removing symptomatic plants after transplanting, keeping the work area free of weeds that can act as virus reservoirs, and considering crop rotation specifically with legumes. In addition, it is crucial to keep workers located in specific areas (Ehlers et al., 2022b), properly clean workers’ clothing and shoes, and disinfect tools before and after entering the production area (Ehlers et al., 2022a). These are some mitigation strategies that could contribute to good management of ToBRFV. Although there are currently no chemical products specifically effective against ToBRFV in host plants, disinfectant products have been investigated to reduce its incidence and severity in the field (Iobbi et al., 2022; Nourinejhad-Zarghani et al., 2023; Pablo et al., 2022). For example, the use of hydrogen peroxide (HP) in polyvinyl alcohol (PVA)/polyvinylpyrrolidone (PVP) hydrogel for controlled release in field applications has been reported. The release rate of HP hydrogel through direct and indirect contact with soil (gas phase) has shown low phytotoxicity and high efficacy against ToBRFV in tomato and tobacco plants (Eldan et al., 2022; Liao et al., 2013). The use of resistance inducers applied directly to the crop to counteract the damage caused by ToBRFV is still limited due to the recent emergence of the virus. However, recent studies have evaluated (Ortiz-Martínez and Ochoa-Martínez, 2023) the effect of 14 elicitors and biostimulants on agronomic parameters of morphology, yield, and fruit quality in tomato plants infected with ToBRFV. They determined that Virablock® 3G50, Optifert®, Silicant®, and Haifa ProtekTM improved the evaluated agronomic
parameters, while Haifa ProtekTM induced a larger root system. ToBRFV is considered the first tobamovirus capable of breaking the resistance to the Tm-2, Tm-1, and Tm-22 genes that confer resistance to TMV, ToMV, and ToMMV in solanaceous plants (Hak and Spiegelman, 2021). Therefore, the selection of wild materials for the application of genetic improvement with resistance to ToBRFV has provided favorable results in research, as indicated by Kabas et al. (2022), who evaluated tomato materials including 10 wild species and 11 interspecific F1 hybrids derived from Solanum habrochaites and S. pennellii. These were tested with ToBRFV isolates using the biological test method. In the end, they found that
S. pimpinellifolium (LA1651), S. penellii (LA0716), and S. chilense (LA4117A, LA2747) could be tolerant to ToBRFV with a severity index (SI) lower than 19.6, 28.3, 35.0, and 35.2%, respectively. Additionally, there are reports indicating that ToBRFV is capable of systemically infecting pepper plants carrying L1 or L2 genes resistant to ToMV (Eldan et al., 2022), although in pepper with L2 and L4 genes, ToBRFV produces local lesions as resistance to the virus (Fidan, 2021). Pelletier and Moffett (2022) indicated that Nicotiana tabacum cultivar BY-2 conferred resistance to ToBRFV through the recognition of the viral P50 and CP fragments, respectively; this could have been achieved by the resistance mediated by the N and N’ genes by not inducing a hypersensitivity response (HR) in N. tabacum. This highlights the limited availability of genetic materials, both wild and commercial, that offer resistance to ToBRFV, a crucial aspect for mitigating losses in tomato and pepper crops (Avni et al., 2021; García-Estrada et al., 2022). It is important to mention that, although there are genotypes in the market considered resistant, they do not always counteract the infection by ToBRFV. In other words, genotypes established at normal temperatures (20 to 28 °C) may tolerate the pathogen, but at extreme temperatures (30 to 48 °C), they may manifest as susceptible. Therefore, it is necessary to consider the validation of resistance to ToBRFV before its establishment in production zones (González-Concha et al., 2023; Nolasco et al., 2023).
Legal control and regulations
The phytosanitary problem of the presence of ToBRFV prompted the United States in 2018, through the California Department of Food and Agriculture (CDFA) and the Department of Agriculture (USDA), to assess the risks that the presence of ToBRFV would entail. With this, they established restrictions on imports of vegetative material and tomato and pepper seeds that could allow the dispersal of the inoculum. Despite these measures, ToBRFV was detected for the first time in tomato greenhouses in Southern California, USA (Ling et al., 2019). In Mexico, after the detection of the virus, the National Epidemiological Surveillance System
(SINAVEF) implemented measures that classified the pest status as “Actionable and eradicable transient pest (AETP),” given that there were no reports by the International Standards for Phytosanitary Measures (ISPMs) (FAO, 2023) to prevent its spread. These actions included: diagnosis, elimination of plantations with the presence of ToBRFV, and destruction of contaminated propagative material (seeds). However, the results were not satisfactory, so in that same year, the status changed to “Quarantine pest, under official control (QPOC).” Regarding the appearance of the virus in our country, the following hypothesis has been proposed: The inoculum came from a block of seeds imported from Jordan to Israel (Luria et al., 2017), which was distributed throughout the Mexican republic, being detected for the first time in Baja California and later in Michoacán. From 2019 to date, the virus has been considered a “Regulated non-quarantine pest (RNQP),” so regulations for seeds and plant material have continued to be implemented to reduce its impact on Mexican production. In 2019, the first circular was issued aimed at seeds, seedlings, and fresh fruits of tomatoes and peppers for export purposes and the absence of ToBRFV (SENASICA, 2023). Finally, the European Union issued an Implementing Decision notification (EU) 2019/1615, which establishes emergency measures to prevent the introduction and spread of ToBRFV in the EU. For this reason, in 2021, Circular No. 040 was published for the export of tomato and pepper seeds destined for the EU. These guidelines continue to be respected today for the import and export of seeds to the USA, EU, and Mexico.
Conclusions
The lack of knowledge about ToBRFV following its detection resulted in rapid spread worldwide, as it is a pathogen that can be transmitted through seeds and plant debris, facilitating greater dissemination. Currently, five clades are reported based on the existing genetic diversity. ToBRFV infects 16 families of weeds and host crops distributed across 47 countries, with Solanum lycopersicum being the most economically significant. Genetic resistance is a promising alternative for developing resistant genotypes; however, studies in this area are currently limited. The current status of ToBRFV in Mexico and its presence in tomato-producing regions reveals that the fundamental problem lies not only in contaminated seeds but also in the phytosanitary measures implemented for detecting emerging diseases. This review emphasizes the need for a comprehensive analysis of ToBRFV, from its genetic diversity to specific management strategies. The absence of corrective measures for viral diseases could lead to the recurrence of similar scenarios, underscoring the importance of conducting further research focused on emerging viral diseases, such as ToBRFV.
Acknowledgments
Agradecemos el apoyo a la Universidad Autónoma Agraria Antonio Narro y al Consejo Nacional de Humanidades, Ciencia y Tecnología por la beca de maestría otorgada a Ubilfrido Vásquez Gutiérrez (No. 1223150).
REFERENCES
Abou-Kubaa, R. Choueiri, E. Heinoun, K. Cillo, F. Saponari, M. 2022 First report of Tomato brown rugose fruit virus infecting sweet pepper in Syria and Lebanon Journal of Plant Pathology 104 1 425 10.1007/s42161-021-00987-y [ Links ]
Abou-Kubaa, R. Amoia, SS. Altamura, G. Minafra, A. Chiumenti, M. Cillo, F. 2023 Nanopore Technology Applied to Targeted Detection of Tomato Brown Rugose Fruit Virus Allows Sequencing of Related Viruses and the Diagnosis of Mixed Infections Plants 12 5 886-999 10.3390/plants12050999 [ Links ]
Abrahamian, P. Cai, W. Nunziata, SO. Ling, KS. Jaiswal, N. Mavrodieva, VA. Rivera, Y. Nakhla, MK. 2022 Comparative Analysis of Tomato Brown Rugose Fruit Virus Isolates Shows Limited Genetic Diversity Viruses 14 12 2816 10.3390/v14122816 [ Links ]
Adams, MJ. Adkins, S. Bragard, C. Gilmer, D. Li, D. MacFarlane, SA. Wong, SM. Melcher, U. Ratti, C. Ryu, KH. Consortium IR 2017 ICTV Virus Taxonomy Profile: Virgaviridae Journal of General Virology 98 8 1999-2000 10.1099/jgv.0.000884 [ Links ]
Aiewsakun, P. Katzourakis, A. 2016 Time-dependent rate phenomenon in viruses Journal of Virology 90 16 7184-7195 10.1128/jvi.00593-16 [ Links ]
Alfaro-Fernández, A. Castillo, P. Sanahuja, E. Rodríguez-Salido, MC. Font, MI. 2021 First report of Tomato brown rugose fruit virus in tomato in Spain Plant Disease 105 2 515 10.1094/PDIS-06-20-1251-PDN [ Links ]
Alkowni, R. Alabdallah, O. Fadda, Z. 2019 Molecular identification of Tomato brown rugose fruit virus in tomato in Palestine Journal of Plant Pathology 101 719-723 10.1007/s42161-019-00240-7 [ Links ]
Alon, DM. Hak, H. Bornstein, M. Pines, G. Spiegelman, Z. 2021 Differential Detection of the Tobamoviruses Tomato Mosaic Virus (ToMV) and Tomato Brown Rugose Fruit Virus (ToBRFV) Using CRISPR-Cas12a Plants 10 6 1256 10.3390/plants10061256 [ Links ]
Amer, MA. Mahmoud, SY. 2020 First report of Tomato brown rugose fruit virus on tomato in Egypt New Disease Reports 41 2044-0588 10.5197/j.2044-0588.2020.041.024 [ Links ]
Avni, B. Gelbart, D. Sufrin-Ringwald, T. Zinger, A. Chen, L. Machbash, Z. Bekelman, I. Segoli, M. Dombrovsky, A. Kamenetsky, R. Levin, I. Lapidot, M. 2021 Tomato genetic resistance to tobamoviruses is compromised SHS Acta Horticulturae 1316 89-98 10.17660/ActaHortic.2021.1316.13 [ Links ]
Beris, D. Malandraki, I. Kektsidou, O. Theologidis, I. Vassilakos, N. Varveri, C. 2020 First report of Tomato brown rugose fruit virus infecting tomato in Greece Plant Disease 104 7 2035 10.1094/PDIS-01-20-0212-PDN [ Links ]
Bernabé-Orts, JM. Hernando, Y. Aranda, MA. 2022 Toward a CRISPR-based point-of-care test for Tomato brown rugose fruit virus detection PhytoFrontiers™ 2 2 92-100 10.1094/PHYTOFR-08-21-0053-TA [ Links ]
Beris D Malandraki I Kektsidou O Theologidis I Vassilakos N Varveri C 2020 First report of Tomato brown rugose fruit virus infecting tomato in Greece Plant Disease 104 7 2035 10.1094/PDIS-01-20-0212-PDN [ Links ]
Bernabé-Orts JM Hernando Y Aranda MA 2022 Toward a CRISPR-based point-of-care test for Tomato brown rugose fruit virus detection PhytoFrontiers™ 2 2 92-100 10.1094/PHYTOFR-08-21-0053-TA [ Links ]
Bustin AS Benes V Garson JA Hellemans J Huggett J Kubista M Muelller R Nolan Pfaffl MW 2009 The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments Clinical Chemistry 55 4 611-622 10.1373/clinchem.2008.112797 [ Links ]
Byzova NA Safenkova IV Chirkov SN 2009 Development of immunochromatographic test systems for express detection of plant viruses Applied Biochemistry and Microbiology 45 204-209 10.1134/S000368380902015X [ Links ]
Camacho-Beltrán E Pérez-Villarreal A Pérez-Leyva NE Rodríguez-Negrete EA Ceniceros-Ojeda EA Méndez-Lozano J 2019 Occurrence of Tomato brown rugose fruit virus infecting tomato crops in Mexico Plant Disease 103 6 10.1094/PDIS-11-18-1974-PDN [ Links ]
Cambrón-Crisantos JM Rodríguez-Mendoza J Valencia-Luna JB Alcasio-Rangel S García-Ávila CJ López-Buenfil JA Ochoa-Martínez DL 2019 First report of Tomato brown rugose fruit virus (ToBRFV) in Michoacan, Mexico Revista Mexicana de Fitopatología 37 1 185-192 10.18781/R.MEX.FIT.1810-5 [ Links ]
Caruso AG Bertacca S Parrella G Rizzo R Davino S Panno S 2022 Tomato brown rugose fruit virus: A pathogen that is changing the tomato production worldwide Annals of Applied Biology 181 3 258-274 10.1111/aab.12788 [ Links ]
Çelik A Coşkan S Morca AF Santosa AI Koolivand D 2022 Insight into Population Structure and Evolutionary Analysis of the Emerging Tomato Brown Rugose Fruit Virus Plants 11 23 3279 10.3390/plants11233279 [ Links ]
Chanda B Gilliard A Jaiswal N Ling KS 2021 Comparative analysis of host range, ability to infect tomato cultivars with Tm-22 gene, and real-time reverse transcription PCR detection of Tomato brown rugose fruit virus Plant Disease 105 3643-3652 10.1094/PDIS-05-20-1070-RE [ Links ]
Chanda B Rivera Y Nunziata SO Galvez ME Gilliard A Ling KS 2020 Complete genome sequence of a Tomato brown rugose fruit virus isolated in the United States Microbiology Resource Announcements 9 29 e00630-20 10.1128/MRA.00630-20 [ Links ]
Chanda B Shamimuzzaman M Gilliard A Ling KS 2021 Effectiveness of disinfectants against the spread of Tobamoviruses: Tomato brown rugose fruit virus and Cucumber green mottle mosaic virus Virology Journal 18 7 10.1186/s12985-020-01479-8 [ Links ]
Cohen J Zeidan M Rosner A Gera A 2000 Biological and Molecular Characterization of a New Carlavirus Isolated from an Aconitum sp Phytopathology 90 4 340-4 10.1094/PHYTO.2000.90.4.340 [ Links ]
Dey KK Velez-Climent M Soria P Batuman O Mavrodieva V Wei G Zhou J Adkins S McVay J 2021 First report of Tomato brown rugose fruit virus infecting tomato in Florida, USA New Disease Reports 44 e12028 10.1002/ndr2.12028 [ Links ]
Dombrovsky A Tran-Nguyen LTT Jones R 2017 Cucumber green mottle mosaic virus: rapidly increasing global distribution, etiology, epidemiology, and management Annual Reviews Phytopathology 55 231-256 10.1146/annurev-phyto-080516-035349 [ Links ]
Dombrovsky A Smith E 2017 Seed Transmission of Tobamoviruses: Aspects of Global Disease Distribution Advances in Seed Biology 12 233-260 10.5772/intechopen.70244 [ Links ]
Dumschott K Schmidt MH Chawla HS Snowdon R Usadel B 2020 Oxford Nanopore Sequencing: New opportunities for plant genomics? Journal of Experimental Botany 71 18 5313-5322 10.1093/jxb/eraa263 [ Links ]
Eads A Groth-Helms D Davenport B Cha X Li R Walsh C Schuetz K 2023 The Commercial Validation of Three Tomato Brown Rugose Fruit Virus Assays PhytoFrontiers 3 1 206-213 10.1094/PHYTOFR-03-22-0033-FI [ Links ]
Ehlers J Nourinejhad ZS Kroschewski B Büttner C Bandte M 2022 Cleaning of Tomato brown rugose fruit virus (ToBRFV) from Contaminated Clothing of Greenhouse Employees Horticulturae 8 751 10.3390/horticulturae8080751 [ Links ]
Ehlers J Nourinejhad ZS Kroschewski B Büttner C Bandte M 2022 Decontamination of Tomato Brown Rugose Fruit Virus-Contaminated Shoe Soles under Practical Conditions Horticulturae 8 1210 10.3390/horticulturae8121210 [ Links ]
Eichmeier A Hejlova M Orsagova H Frejlichova L Hakalova E Tomankova K Linhartova S Kulich P Cermak V Cechova J 2023 Characterization of Tomato Brown Rugose Fruit Virus (ToBRFV) Detected in Czech Republic Diversity 15 301 10.3390/d15020301 [ Links ]
Eldan O Ofir A Luria N Klap C Lachman O Bakelman E Belausov E Smith E Dombrovsky A 2022 Pepper Plants Harboring L Resistance Alleles Showed Tolerance toward Manifestations of Tomato Brown Rugose Fruit Virus Disease Plants 11 2378 10.3390/plants11182378 [ Links ]
EPPO 2023 Tomato brown rugose fruit virus EPPO Global database Distribution World https://gd.eppo.int/taxon/TOBRFV/distribution Accessed 14th April 2023 [ Links ]
Esmaeilzadeh F Koolivand D 2022 Occurrence of Tomato brown rugose fruit virus in tomato in Iran Journal of Plant Pathology 104 1 457-457 10.1007/s42161-021-01009-7 [ Links ]
FAO 2023 Organización de las Naciones Unidas para la Alimentación y la Agricultura. Normas Internacionales para Medidas Fitosanitarias (NIMF) FAO https://www.ippc.int/es/core-activities/standards-setting/ispms/ consulta, junio 2023 [ Links ]
Fidan H Sarikaya P Calis O 2019 First report of Tomato brown rugose fruit virus on tomato in Turkey New Disease Reports 39 18 10.5197/j.2044-0588.2019.039.018 [ Links ]
Fidan H Sarikaya P Yildiz K Topkaya B Erkis G Calis O 2021 Robust molecular detection of the new Tomato brown rugose fruit virus in infected tomato and pepper plants from Turkey Journal of Integrative Agriculture 20 8 2170-2179 10.1016/S2095-3119(20)63335-4 [ Links ]
Fillmer K Adkins S Pongam Elia T 2015 Complete genome sequence of a Tomato mottle mosaic virus isolate from the United States Genome Announcements 3 2 e00167-15 10.1128/genomeA.00167-15 [ Links ]
García-Estrada RS Diaz-Lara A Aguilar-Molina VH Tovar-Pedraza JM 2022 Viruses of Economic Impact on Tomato Crops in Mexico: From Diagnosis to Management—A Review Viruses 14 1251 10.3390/v14061251 [ Links ]
Ghorbani A Rostami M Seifi S Izadpanah K 2021 First report of Tomato brown rugose fruit virus in greenhouse tomato in Iran New Disease Reports 44 e12040 10.1002/ndr2.12040 [ Links ]
Gibbs A 1999 Evolution and Origins of Tobamoviruses Philosophical Transactions of the Royal Society B: Biological 354 593-602 10.1098/rstb.1999.0411 [ Links ]
González-Concha LF Ramírez-Gil JG Mora-Romero GA García-Estrada RS Carrillo-Fasio JA Tovar-Pedraza JM 2023 Development of a scale for assessment of disease severity and impact of Tomato brown rugose fruit virus on tomato yield European Journal of Plant Pathology 165 3 579-592 10.1007/s10658-022-02629-0 [ Links ]
González-Concha LF Ramírez-Gil JG García-Estrada RS Rebollar-Alviter Á Tovar-Pedraza JM 2021 Spatiotemporal Analyses of Tomato Brown Rugose Fruit Virus in Commercial Tomato Greenhouses Agronomy 11 7 1268 10.3390/agronomy11071268 [ Links ]
González-Garza R 2017 Evolución de técnicas de diagnóstico de virus fitopatógenos Revista mexicana de fitopatología 35 3 591-610 10.18781/r.mex.fit.1706-1 [ Links ]
Guo Y Wu W Zhang X Ding M Yu J Zhang J Jia M Tian Y 2022 Triplex Lateral Flow Immunoassay for Rapid Diagnosis of Tobacco mosaic virus, Tobacco vein banding mosaic virus and Potato virus Y Plant Disease 106 12 3033-3039 10.1094/pdis-08-21-1756-re [ Links ]
Hak H Spiegelman Z 2021 The Tomato brown rugose fruit virus movement protein overcomes Tm-22 resistance in tomato while attenuating viral transport Molecular Plant-Microbe Interactions 34 1024-1032 10.1094/MPMI-01-21-0023-R [ Links ]
Hasan ZM Salem NM Ismail ID Akel EH Ahmad AY 2022 First report of Tomato brown rugose fruit virus on greenhouse tomato in Syria Plant Disease 106 772 10.1094/PDIS-07-21-1356-PDN [ Links ]
Federación Internacional de Semillas 2020 Detection of infectious Tomato brown rugose fruit virus (ToBRFV) in tomato and pepper seed https://www.worldseed.org/wp-content/uploads/2020/03/TomatoToBRFV_2020.03.pdf (consulta, septiembre 2022) [ Links ]
Iobbi V Lanteri AP Minuto A Santoro V Ferrea G Fossa P Bisio A 2022 Autoxidation Products of the Methanolic Extract of the Leaves of Combretum micranthum Exert Antiviral Activity against Tomato Brown Rugose Fruit Virus (ToBRFV) Molecules 27 760 [ Links ]
Ishikawa MY Matsuyama M Kouzai Y Kano A Ishibashi K 2022 Tomato Brown Rugose Fruit Virus Resistance Generated by Quadruple Knockout of Homologs of TOBAMOVIRUS MULTIPLICATION1 in Tomato Plant Physiology 189 2 10.1093/plphys/kiac103 [ Links ]
Ivanovsky D 1892 Ueber die Mosaikkrankheit der Tabakspflanze St Petersb. Acad. Imp. Sci. Bull 35 67-70 [ Links ]
Jamous RM Zaitoun SYA Mallah OB Ali-Shtayeh MS 2022 Biological and Molecular Characterization of Tomato brown rugose fruit virus (ToBRFV) on Tomato Plants in the State of Palestine Research in Plant Disease 28 2 99 10.5423/RPD.2022.28.2.98 [ Links ]
Jeger MJ Madden LV Bosch FVD 2018 Plant virus epidemiology: Applications and prospects for mathematical modeling and analysis to improve understanding and disease control Plant Disease 102 837-854 10.1094/PDIS-04-17-0612-FE.4 [ Links ]
Jewehan A Kiemo FW Salem N 2022 Isolation and molecular characterization of a Tomato brown rugose fruit virus mutant breaking the tobamovirus resistance found in wild Solanum species Arch Virol 167 1559-1563 10.1007/s00705-022-05438-2 [ Links ]
Jewehan A Salem N Tóth Z Salamon P Szabó Z 2022 Screening of Solanum (sections Lycopersicon and Juglandifolia) germplasm for reactions to the Tomato brown rugose fruit virus (ToBRFV) Journal of Plant Diseases and Protection 129 1-7 10.1007/s41348-021-00535-x [ Links ]
Kabas A Fidan H Kucukaydin H Atan HN 2022 Screening of wild tomato species and interspecific hybrids for resistance/tolerance to Tomato brown rugose fruit virus (ToBRFV) Chilean Journal of Agricultural Research 82 189-196 10.4067/S0718-58392022000100189 [ Links ]
Khamphirapaeng P Cheewangkoon R McGovern R Wong SM To-Anun C 2017 Detection of Tobacco mosaic virus in petunia and tobacco by light microscopy using a simplified inclusion body staining technique IJAT 13 2 163-168 http://www.ijat-aatsea.com/ [ Links ]
Kitajima EW 2004 Electron microscopy in plant virology: Past, present and future Microscopy and Microanalysis 10 212-213 10.1017/S1431927604881467 [ Links ]
Klap C Luria N Smith E Hadad L Bakelman E Sela N Belausov E Lachman O Leibman D Dombrovsky A 2020 Tomato Brown Rugose Fruit Virus Contributes to Enhanced Pepino Mosaic Virus Titers in Tomato Plants Viruses 8 879 10.3390/v12080879 [ Links ]
Klein E Smith E Klap C Bakelman E Ophir A Sela A Poverenov E Rein D Cohen Y Eliahu D Shahal S Mechrez G Mani KA Guruprasad Reddy P Domb AJ Pass N Dombrovsky A 2023 A Novel Platform for Root Protection Applies New Root-Coating Technologies to Mitigate Soil-Borne Tomato Brown Rugose Fruit Virus Disease Viruses 15 728 10.3390/v15030728 [ Links ]
Lartey RT Voss TC Melcher U 1996 Tobamovirus Evolution: Gene Overlaps, Recombination, and Taxonomic Implications Molecular Biology and Evolution 13 1327-38 10.1093/oxfordjournals.molbev.a0255798 [ Links ]
Levitzky N Smith E Lachman O Luria N Mizrahi Y Bakelman H Sela N Laskar O Milrot E Dombrovsky A 2019 The bumblebee Bombus terrestris carries a primary inoculum of Tomato brown rugose fruit virus contributing to disease spread in tomatoes PloS ONE 14 1 e0210871 10.1371/journal.pone.0210871 [ Links ]
Li R Gao S Fei Z Ling KS 2013 Complete genome sequence of a new Tobamovirus naturally infecting tomatoes in Mexico Genome Announcements 1 5 e00794-13 10.1128/genomea.00794-13 [ Links ]
Liao YWK Sun ZH Zhou YH Shi K Li X 2013 The Role of Hydrogen Peroxide and Nitric Oxide in the Induction of Plant-Encoded RNA-Dependent RNA Polymerase 1 in the Basal Defense against Tobacco Mosaic Virus PLOS ONE 8 9 e76090 10.1371/journal.pone.0076090 [ Links ]
Ling KS Gilliard AC Zia B 2022 Disinfectants Useful to Manage the Emerging Tomato Brown Rugose Fruit Virus in Greenhouse Tomato Production Horticulturae 8 12 1193 10.3390/horticulturae8121193 [ Links ]
Ling KS Tian T Gurung S Salati R Gilliard A 2019 First Report of Tomato Brown Rugose Fruit Virus Infecting Greenhouse Tomato in the United States Plant Disease 103 6 1439 10.1094/PDIS-11-18-1959-PDN [ Links ]
Luigi M Manglli A Tiberini A Bertin S Ferretti L Taglienti A Faggioli F Tomassoli L 2022 Inter-Laboratory Comparison of RT-PCR-Based Methods for the Detection of Tomato Brown Rugose Fruit Virus on Tomato Pathogens 11 207 10.3390/pathogens11020207 [ Links ]
Luria N Smith E Reingold V Bekelman I Lapidot M Levin I 2017 A new Israeli Tobamovirus isolate infects tomato plants harboring Tm-22 resistance genes PLOS ONE 12 e0170429 10.1371/journal.pone.0170429 [ Links ]
Magaña-Álvarez AA Pérez-Brito D Vargas-Hernández BY Ramírez-Pool JA Núñez-Muñoz LA Salgado-Ortiz H Xoconostle-Cázares B 2021 Detection of Tomato brown rugose fruit virus (ToBRFV) in solanaceous plants in Mexico Journal of Plant Diseases and Protection 128 1627-1635 10.1007/s41348-021-00496-1 [ Links ]
Mahillon M Kellenberger I Dubuis N Brodard J Bunter M Weibel J Sandrini F Schumpp O 2022 First report of Tomato brown rugose fruit virus in tomato in Switzerland New Disease Reports 45 e12065 10.1002/ndr2.12065 [ Links ]
Matzrafi M Abu-Nassar J Klap C Smith E Dombrovsky A 2023 Solanum elaeagnifolium and S. rostratum as potential hosts of the Tomato brown rugose fruit virus PLOS ONE 18 3 e0282441 10.1371/journal.pone.0282441 [ Links ]
Mehetre GT Paranjpe AS Dastager SG Dharne MS 2016 Complete metagenome sequencing based bacterial diversity and functional insights from basaltic hot spring of Unkeshwar, Maharashtra, India Genomics Data 7 140-143 10.1016/j.gdata.2015.12.031 [ Links ]
Mehetre GT Leo VV Singh G Sorokan A Maksimov I Yadav MK Upadhyaya K Hashem A Alsaleh AN Dawoud TM 2021 Current Developments and Challenges in Plant Viral Diagnostics: A Systematic Review Viruses 13 412 10.3390/v13030412 [ Links ]
Menzel W Winter S 2019 Identification of novel and known Tobamoviruses in tomato and other solanaceous crops using a new pair of generic primers and development of a specific RT-qPCR for ToBRFV VI International Symposium on Tomato Diseases: Managing Tomato Diseases in the Face of Globalization and Climate Change 1316 143-148 10.17660/ActaHortic.2021.1316.20 [ Links ]
Menzel W Knierim D Winter S Hamacher J Heupel M 2019 First report of Tomato brown rugose fruit virus infecting tomato in Germany New Disease Reports 39 1 10.5197/j.2044-0588.2019.039.001 [ Links ]
Michael V Hagit H Tzahi A Ziv S 2022 The Impact of Tobamovirus Infection on Root Development Involves Induction of Auxin Response Factor 10a in Tomato Plant and Cell Physiology 63 12 980-1993 10.1093/pcp/pcab179 [ Links ]
Nolasco-García LL Marín-León JL Mireles-Arriaga AI Ruiz-Nieto JE Hernández-Ruíz J 2022 Geographic areas susceptible to Tomato brown rugose fruit virus (ToBRFV) in Guanajuato, Mexico Bioagro 35 1 13-20 10.51372/bioagro351.2 [ Links ]
Nourinejhad-Zarghani S Ehlers J Monavari M Von-Bargen S Hamacher J Büttner C Bandte M 2023 Applicability of Different Methods for Quantifying Virucidal Efficacy Using MENNO Florades and Tomato Brown Rugose Fruit Virus as an Example Plants 12 894 10.3390/plants12040894 [ Links ]
Oladokun JO Halabi MH Barua P Nath PD 2019 Tomato brown rugose fruit virus disease: Current distribution, knowledge and future prospects Plant Pathology 68 9 1579-1586 10.1111/ppa.13096 [ Links ]
Ortiz-Martínez LE Ochoa-Martínez DL Rojas-Martínez RI Aranda-Ocampo S Cruz MAG 2021 Respuesta de variedades de chile a la infección con Tomato brown rugose fruit virus Summa Phytopathologica 47 4 209-215 10.1590/0100-5405/250747 [ Links ]
Ortiz-Martínez LE Ochoa-Martínez DL 2023 Elicitors and biostimulants in the production of tomato infected with Tomato brown rugose fruit virus Journal of Plant Disease Protection 130 351-360 10.1007/s41348-022-00693-6 [ Links ]
Pablo VM Daniel A Salas-Aranda IJ 2022 A ToBRFV similar to a European isolate in a Mexican greenhouse, its presence in seeds and its inactivation for virus integrated management Research Square 10.21203/rs.3.rs-1697399/v [ Links ]
Panno S Caruso AG Davino S 2019 First report of Tomato brown rugose fruit virus on tomato crops in Italy Plant Disease 103 6 1443-1443 10.1094/PDIS-12-18-2254-PDN [ Links ]
Panno S Ruiz-Ruiz S Caruso AG Alfaro-Fernandez A San Ambrosio MIF Davino S 2019 Real-time reverse transcription polymerase chain reaction development for rapid detection of Tomato brown rugose fruit virus and comparison with other techniques PeerJ 7 e7928 10.7717/peerj.7928 [ Links ]
Pelletier A Moffett P 2022 N and N’-mediated recognition confers resistance to Tomato brown rugose fruit virus microPublication Biology 10.17912/micropub.biology.000660 [ Links ]
Pepperkok R Ellenberg J 2006 High-throughput fluorescence microscopy for systems biology Nature Reviews Molecular Cell Biology 7 690-696 10.1038/nrm1979 [ Links ]
Ragasová L Hakalová E Ferby V Čechová J Klapcová G Pokluda R 2022 Effect of Plant Growth Promoting Microorganisms on Pepper Plants Infected with Tomato Brown Rugose Fruit Virus Diversity 14 635 10.3390/d14080635 [ Links ]
Riesenfeld CS Schloss PD Handelsman J 2004 Metagenomics: genomic analysis of microbial communities Annual Review of Genetics 38 525-552 10.1146/annurev.genet.38.072902.091216 [ Links ]
Rizzo D Da Lio D Panattoni A Salemi C Cappellini G Bartolini L Parrella G 2021 Rapid and sensitive detection of Tomato brown rugose fruit virus in tomato and pepper seeds by reverse transcription loop-mediated isothermal amplification assays (real time and visual) and comparison with RT-PCR end-point and RT-qPCR methods Frontiers in Microbiology 12 640932 10.3389/fmicb.2021.640932 [ Links ]
Rodríguez-Mendoza J García-Ávila CJ López-Buenfil JA Araujo-Ruiz K Quezada-Salinas A Cambrón-Crisantos JM Ochoa-Martínez DL 2019 Identificación de Tomato brown rugose fruit virus por RT-PCR de una región codificante de la replicasa (RdRP) Revista mexicana de fitopatología 37 2 345-356 10.18781/r.mex.fit.1902-6 [ Links ]
Roistacher CN 1991 Graft-transmissible Diseases of Citrus. Handbook for detection and diagnosis Riverside, Rome IOCV, FAO 286 https://archive.org/details/bub_gb_9zY1uFGchAgC [ Links ]
Sabra A Amer MA Hussain K Zakri A AlShahwan IM Al-Saleh MA 2023 Occurrence and Distribution of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia Plants 11 22 3157 10.3390/plants11223157 [ Links ]
Salem NM Jewehan A Aranda MA Fox A 2023 Tomato Brown Rugose Fruit Virus Pandemic Annual Review of Phytopathology 61 137-164 10.1146/annurev-phyto-021622-120703 [ Links ]
Salem N Mansour A Ciuffo M Falk BW Turina M 2016 A new Tobamovirus infecting tomato crops in Jordan Archives of Virology 161 2 503-506 10.1007/s00705-015-2677-7 [ Links ]
Salem NM Abumuslem M Turina M Samarah N Sulaiman A Abu-Irmaileh B Ata Y 2022 Localization and mechanical transmission of Tomato brown rugose fruit virus in tomato seeds Plant Disease 106 1 275-281 10.3390/plants11172287 [ Links ]
Salem NM Cao MJ Odeh S Turina M Tahzima R 2020 First report of Tobacco mild green mosaic virus and Tomato brown rugose fruit virus infecting Capsicum annuum in Jordan Plant Disease 104 2 601-601 https://apsjournals.apsnet.org/doi/full/10.1094/PDIS-06-19-1189-PDN [ Links ]
Samarah N Sulaiman A Salem NM 2021 Disinfection treatments eliminated Tomato brown rugose fruit virus in tomato seeds European Journal Plant Pathology 159 153-162 10.1007/s10658-020-02151-1 [ Links ]
Sánchez-Sánchez M 2023 The Tomato brown rugose fruit virus is restricted to specific areas in Sonora, México a study of 2021-2022 season Tropical and Subtropical Agroecosystems 26 3 http://dx.doi.org/10.56369/tsaes.4674 [ Links ]
Sarkes A Fu H Feindel D Harding M Feng J 2020 Detection of Tomato brown rugose fruit virus (ToBRFV) in solanaceous plants in Mexico PLOS ONE 15 6 e0230403 10.1371/journal.pone.0230403 [ Links ]
Sarkes A Fu H Feindel D Harding M Feng J 2020 Development and evaluation of a loop-mediated isothermal amplification (LAMP) assay for the detection of Tomato brown rugose fruit virus (ToBRFV) PLOS ONE 15 6 e0230403 10.1371/journal.pone.0230403 [ Links ]
SENASICA. Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria 2023 Módulo de consulta de requisitos para la importación de mercancías fitosanitarias https://sistemasssl.senasica.gob.mx/mcrfi/ConsultaCatalogos.xhtml Consulta, noviembre 2023 [ Links ]
Shen L Wang F Liu Y Qian Y Yang J Sun H 2013 Suppression of Tobacco mosaic virus by Bacillus amyloliquefaciens strain Ba33 Journal of Phytopathology 161 4 293-294 10.1111/jph.12058 [ Links ]
SINAVEF-SENASICA 2020 Sistema Nacional de Vigilancia Epidemiológica-Servicio Nacional de Sanidad e Inocuidad en Calidad Agroalimentaria. Panorama Nacional del Virus del fruto rugoso del tomate ToBRFV 9p [ Links ]
Skelton A Buxton-Kirk A Ward R Harju V Frew L Fowkes A Fox A 2019 First report of Tomato brown rugose fruit virus in tomato in the United Kingdom New Disease Reports 40 12 2044-0588 10.5197/j.2044-0588.2019.040.012 [ Links ]
Skelton A Gentit P Porcher L Visage M Fowkes A Adams IP Fox A 2022 First report of Tomato brown rugose fruit virus in tomato in France New Disease Reports 45 1 10.1002/ndr2.12061 [ Links ]
Skotnicki A Gibbs A Wrigley NG 1976 Further studies on Chara corallina virus Virology 75 2 457-468 10.1016/0042-6822(76)90043-X [ Links ]
Smith E Dombrovsky A 2019 Aspects in Tobamovirus management in intensive agriculture In Plant Diseases-Current Threats and Management Trends. IntechOpen 9 133 [ Links ]
Tatineni S Hein GL 2023 Plant Viruses of Agricultural Importance: Current and Future Perspectives of Virus Disease Management Strategies Phytopathology 113 2 117-141 10.1094/PHYTO-05-22-0167-RVW [ Links ]
Temple C Blouin AG Tindale SJ Steyer S Marechal K Massart S 2023 High Throughput Sequencing technologies complemented by growers perception highlight the impact of tomato virome in diversified vegetable farms Frontiers in Sustainable Food Systems 7 10.1101/2023.01.12.523758 [ Links ]
Van de Vossenberg BT Visser M Bruinsma M Koenraadt HMS Westenberg M 2020 Real-time tracking of Tomato brown rugose fruit virus (ToBRFV) outbreaks in the Netherlands using Nextstrain PLOS ONE 15 10 e0234671 10.1371/journal.pone.0234671 [ Links ]
Vargas-Hernández BY Ramírez-Pool JA Núñez-Muñoz LA Calderón-Pérez B De La Torre-Almaráz R Hinojosa-Moya J Xoconostle-Cázares B Ruiz-Medrano R 2022 Development of a droplet digital polymerase chain reaction (ddPCR) assay for the detection of Tomato brown rugose fruit virus (ToBRFV) in tomato and pepper seeds Journal of Virological Methods 302 114466 10.1016/j.jviromet.2022.114466 [ Links ]
Vargas-Mejía P Rodríguez-Gómez G Salas-Aranda DA 2023 Identification and management of Tomato brown rugose fruit virus in greenhouses in Mexico Archives of Virology 168 135 10.1007/s00705-023-05757-y [ Links ]
Vásquez-Gutiérrez U Delgado-Ortiz JC Frías-Treviño GA Aguirre-Uribe LA Flores-Olivas A 2023 Pathogenicity of three Tomato brown rugose fruit virus isolates and response in tomato (Solanum lycopersicum L.) Proceedings of the 3rd International Electronic Conference on Agronomy 2023 https://sciforum.net/paper/view/14988 [ Links ]
Vásquez-Gutiérrez U Frías-Treviño GA Delgado-Ortiz JC Aguirre-Uribe LA Flores-Olivas A 2023 Severity of Tomato brown rugose fruit virus in tomato (Solanum lycopersicum L.) from a region of Coahuila, México International Journal of Horticulture, Agriculture and Food Science (IJHAF) 7 2 1-6 10.22161/ijhaf.7.2 [ Links ]
Vásquez-Gutiérrez U López López H Frías Treviño GA Delgado Ortiz JC Flores Olivas A Aguirre Uribe LA Hernández Juárez A 2024 Biological Exploration and Physicochemical Characteristics of Tomato Brown Rugose Fruit Virus in Several Host Crops Agronomy 14 2 388 10.3390/agronomy14020388 [ Links ]
Wilstermann A Ziebell H 2019 Tomato brown rugose fruit virus (ToBRFV) JKI Data Sheets - Plant Diseases and Diagnosis 1 1-4 10.5073/20190607-160917 [ Links ]
Wylie SJ Li H Jones MG 2014 Yellow Tailflower Mild Mottle Virus: A New Tobamovirus Described From Anthocercis littorea (Solanaceae) in Western Australia Archives of Virology 159 791-5 10.1007/s00705-013-1891-4 [ Links ]
Yan ZY Ma HY Han SL Geng C Tian YP Li XD 2019 First report of Tomato brown rugose fruit virus infecting tomato in China Plant Disease 103 11 2973-2973 10.1094/PDIS-05-19-1045-PDN [ Links ]
Yan ZY Ma HY Wang L Tettey C Zhao MS Geng C 2021 Identification of genetic determinants of Tomato brown rugose fruit virus that enable infection of plants harbouring the Tm-22 resistance gene Molecular Plant Pathology 22 1347-1357 10.1111/mpp.13115 [ Links ]
Yan ZY Zhao MS Liu LZ Yang GL Geng C Tian YP Li XD 2021 Biological and molecular characterization of Tomato brown rugose fruit virus and development of quadruplex RT-PCR detection Journal of Integrative Agriculture 20 7 1871-1879 10.1016/S2095-3119(20)63275-0 [ Links ]
Zamora-Macorra EJ Aviña-Padilla K Rosemarie HW Ochoa-Martínez DL 2023 Comparison of molecular protocols to detect Tomato brown rugose fruit virus in solanaceae hosts Mexican Journal of Phytopathology 41 4 2 10.18781/R.MEX.FIT.2023-5 [ Links ]
Zamora-Islas E Santiago-Aspiazu GC Mundo-Hernández JJ 2021 Aproximaciones teórico-metodológicas para el análisis territorial y el desarrollo regional sostenible Colección: Recuperación transformadora de los territorios con equidad y sostenibilidad 1 México UNAM-AMECIDER 20 978-607-30-5332-7 [ Links ]
Zhang G Zhang Z Wan Q Zhou H Jiao M Zheng H Wu J 2023 Selection and Validation of Reference Genes for RT-qPCR Analysis of Gene Expression in Nicotiana benthamiana upon Single Infections by 11 Positive-Sense Single-Stranded RNA Viruses from Four Genera Plants 12 4 857 10.3389/fphys.2018.01614 [ Links ]
Zhang S Griffiths JS Marchand G Bernards MA Wang A 2022 Tomato brown rugose fruit virus: An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide Molecular Plant Pathology 23 1262-1277 10.1111/mpp.13229 [ Links ]
Received: January 28, 2024; Accepted: September 11, 2024
Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons
