Isolation of the pathogen

The isolations used in this investigation were obtained from soils, roots or cankers on Quercus salicifolia trees from El Arrayanal, Col. (COL-A); Quercus elliptica from Tecoanapa, Gro. (GRO-P), Quercus peduncularis from Manantlán, Jal. (JAL-C), Pseudotsuga mensiezii from Edo. de México (EDO-T), and Persea americana, from Peribán Mich. (MICH-P), which were identified with a morphological analysis on the genus, and a molecular analysis on the species.

The trees displayed characteristic symptoms caused by P. cinnamomi, including regressive death, wilting, chlorosis, premature defoliation, cankers, and a dark colored exudate in the bark. In order to obtain the pathogen directly in the field from cankers, we used the selective medium PARPH (pimaricin-ampicilin-rifampicin-PCNB e hymexazol) (^{Jeffer and Martín, 1986}; ^{Erwin and Ribeiro, 1996}. In the lab, the root samples were disinfected and planted in a PARPH selective medium. For the soil samples, a method of trapping was used with camellia discs, a water soil + root and selective medium suspension was used (^{Almaraz et al., 2013}). The avocado isolation was provided by Dr. Salvador Ochoa Ascencio of the Department of Agrobiology "Presidente Juárez" of the UMSNH. The avocado tree isolation was obtained by the characteristic symptoms of the avocado tristeza disease by P. cinnamomi.

Morphological identification

The colonies obtained from Phytophthora were performed at hypha point, transferred to Petri dishes with a PDA (potato-dextrose-agar) medium and incubated for 7 days in the dark at a temperature of ± 25 °C (^{Zentmyer, 1980}). Later, were identified to genus based on the morphology of the colony and reproductive structures. The development of the colonies was measured on a daily basis from each of the isolations, until the oomycete filled the Petri dish. For the production of sporangia, a soil extract was suspended in sterile distilled water, and mycelia discs with a diameter of 5 mm in Petri dishes were placed inside them (Romero, 1996); these Petri dishes were kept at a temperature of ± 25 °C under continuous light for six days. The sporangia were observed under the microscope and each isolation was described, along with their measurements for height and length; 100 sporangia were measured from each isolation.

Once the genus of each isolation was identified, they were placed in test tubes containing PDA and mineral oil was added. All this was carried out in the Forest Pathology lab of the Colegio de Postgraduados.

Molecular characterization

The DNA of each isolation used for the identification of species was extracted from mycelial colonies developed in a PDA medium with a growth of approximately seven days. For the extracion of DNA, the technique used was ^{Sambrook and Russell (2001)}. The total DNA obtained was observed by electrophoresis in agarose gel at 0.8 % and quantified in a Nanodrop 1000 (Termoscientific) spectrophotometer.

PCR. To perform the analysis by PCR of the DNA extracted, we amplified the ITS regions with the primers ITS'5 (GGAAGTAAAAGTCGTAACAAGG) and ITS'4 (TCCTCCGCTTATTGATATGC) of rRNA genes of the subunits 18S-5.8S and 5.8S-28S (^{White et al., 1990}). For the PCR reaction, we used a final volume of 25 μL with the following formulation: 13.22 μL of ultrapure sterile water, 2.5 μL with a buffer solution 5X, 2.08 μL of MgCl2 at 2.5 mM, 2 μL dNTPs at 2.0 mM, 2 μL of each primers at 20 ρMol, 0.2 μL of Taq-DNA polymerase at 1.5 U and 1 of an 80 ng DNA sample. The amplification of the primers was performed in a Perkin-Elmer (Mod. CT 2400) thermocycler, with the following program: one initial DNA denaturation cycle at 95 °C for 2 min; 30 cycles at 95 °C for 1 min, aligning at 50 °C for 30 s and extension at 72 °C for 2 min; the final extension was at 72 °C for 10 min. The amplified fragment was purified using the KIT Quiagen^® and the quality was verified by electrophoresis in agarose gel at 1 % stained with ethidium bromide. La banda se visualizó en un transilluminator (GelDoc 2000, BIO RAD^®), and analyzed with the program Quantity One 4.0.3 (^{Sambrook and Russel, 2001}). The PCR product was sent to the company Macrogen, U.S.A. for sequencing (Automatic Sequencer 3700xl DNA Analyzer).

The sequences obtained with the primers ITS5-ITS4 were aligned with those available in the genebank of the National Center for Biotechnology Information (NCBI), in the U.S.A. (http://www.ncbi.nlm.nih.gov). Of the quantitative values generated, only the sequences with the highest values were reduced in order to compare them with those obtained in this study. The sequences were aligned with Clustal W version 1.6. and were deposited in the database of the Gen Bank to obtain their accession number.

Pathogenicity tests

Once the colonies were developed in the seven-day old PDA medium, the pathogenicity tests began. For each one of the isolations obtained, the tests were carried out under greenhouse conditions on three-year old Pseudotsuga menziesii trees planted in pots, with a height of 45 to 47 cm. The inoculation was carried out with the method of mycelium discs in the stem (^{O'Gara et al., 1996}). In the point of inoculation, the stems of the plants were cleaned with sterile distilled water, using a dissection needle disinfected with alcohol at 70 % and heated with a burner, ten punctures were performed, from each isolation, disks were taken with a diameter of 0.5 mm with a mycelium of the pseudofungus grown in a PDA medium, which were placed in the area and covered with moist sterile cotton, and covered with a gauze and parafilm tape around the stem in order to retain humidity. All this was carried out under aseptic conditions.

Five plants were inoculated for each of the isolations (repetitions), and there was a control which was only applied PDA madium, giving a total of 30 inoculated plants. Finally, each plant was covered with a plastic bag to produce conditions of relative humidity. They remained in this way for one week, and were kept at a temperature of ± 25 °C. The plants were distributed at random on tables in the greenhouse and watered every three days at field capacity. The number of days before the appearance of symptoms and death of each plant was evaluated on a weekly basis for eight months, and the results obtained underwent a statistical analysis (Kruskall-Wallis test) using the program SAS (^{SAS, 2012}) to determine the behavior of the P. cinnamomi isolations.

Morphological identification

The five isolated colonies of Q. salicifolia, Q. elliptica, Q. peduncularis, Pseudotsuga mensiezii and Persea americana trees showed a uniform growth in a PDA medium, displaying a mycelial growth with a cotton-like aspect, white colored, camellia-shaped (Figure 1) due to the depressed growth; coenocytic mycelium, torulose, with coralloid hyphea and abundant swellings, all at the genus level. This pathogen was observed to produce spherical, oval, piriform, terminal or intercalated chlamydospores, frequently in bunches. Some authors mention that they persist in the soil for years, which constitute an organ of conservation and survival as reported by ^{Erwin and Ribeiro (1996)}; ^{Jung et al., (2013)} and ^{Zentmyer et al., (1996)}.

Figure 1 A) Colonies of the six-day old heterothallic P. cinnamomi isolations coded: A) COL-A and seven days old with the codes: B) GRO-P, C) EDO-T encinos, D) JAL-C and E) MICH-P , camellia-shaped, developing in PDA medium. 

The measurements of the average length and width of 100 sporangia from each isolation were also taken, and they are as follows: COL-A 40.49 x 28.19, JAL-C 40.81 x 28.63 μm, GRO-P 48.24 x 31.47 μm, EDO-T 43.2 x 32.9 μm and MICH 56.23 x 33. 8 μm. On the other hand, ^{Erwin and Ribeiro (1996)} report values of 75 x 40 μm, and therefore they do not coincide with those obtained in this study. Regarding the size of the sporangia, these vary depending on the weather conditions and are only produced in the soil extract (^{Sánchez et al., 2002b}). The morphological characteristics of the P. cinnamomi sporangia, elongated ovoids and a non-papillated apex, agree with those reported by ^{Erwin and Ribeiro (1996)}, ^{Gallegly and Hong (2008)} and ^{Waterhouse (1963)}.

Molecular characterization

The band of the product of PCR was approximately 1200 to 1500 pb (Figure 3). The results of the sequencing of each isolation were compared with the sequences reported in the gene bank (NCBI). The sequences by isolation had a 99 % similarity index for the species P. cinnamomi. When comparing the nucleotides of each isolation and morphologically identified with those reported in the gene bank (NCBI), they corresponded to the same species. This corroborated the morphological identification of each isolation (Table 3).

Figure 2 A) Development of symptoms in three-year old Pseudotsuga menziesii plants inoculated with the different P. cinnamomi isolations, coded (COL-A, GRO-P, EDO-T, JAL-C, and MICH-P). B) Canker in plants. C) Sap on the base of the stem. D) Progress of the disease in the plant E) Light to dark brown canker caused by the isolation COL-A. F) Control and plants inoculated during the pathogenicity tests. G) Tissue infected with the isolation COL-A and mycelia of the organism in the selective medium PARHP. H) Reaisolation COL-A of seven-day old P. cinnamomi in PDA. 

Figure 3 Electrophoresis in 1% agarose gel that shows a band of approximately 1500 pb of the product amplified by PCR with the primers ITS4 and ITS5; M. 1 kb molecular marker, lane 1. COL-A., 2. GRO-P., 3. JAL-C., 4. MICH-P, and 5. EDO-T. 

Pathogenicity tests

The Pseudotsuga mensiezii plants that were given the pathogen began showing symptoms of sprout wilting, flaccid tips, chlorosis of the needles, death of leaves on the base of the plants, along with the growth of cankers on the stem, which was characterized by the presence of necrosis on its epidermis and detachment of the bark, giving a light to dark brown color.

The isolations presented a different pathogenicity in the inoculated host. The isolation COL-A from Arrayanal, Col., found in Quercus salicifolia, was the first to cause visible symptoms at 67 ddi, and the death of plants at 120 days after inoculation. It was also observed that the isolation from El Arrayanal, Col. (COL-A) was the first to cover the Petri dish after 5 days, as well as the first to form sporangia in six days in the soil solution. Isolation GRO-P, taken from Q. elliptica, caused the symptoms 93 ddi and death at 180 days after inoculation; in the case of EDO-T, in Pseudotsuga mensiezii, 135 days were required, as with JAL-C, taken from Q. peduncularis and for the death of plants, 210; forMICH-P, isolated from Persea Americana, 160 ddi and 240 days for death (Figure 2). These results show that all the isolations were able to cause a disease, yet the isolation COL-A behaved the most pathogenic in Pseudotsuga menziesii plants, therefore it was evident that there is a variation in pathogenicity amongst the P. cinnamomi isolations from the different regions in Mexico.

The above data, specifically determine death based on the pathogenicity of the isolations. These results underwent a statistical analysis using the KrusKall-Wallis test. Significant differences between isolates (P 0.0001) were obtained (Table 2). The isolation COL-A was statistically different to the others, showing an average with a higher range than the others.

The pathogen P. cinnamomi was re-isolated from the infected tissue of the plants inoculated with each isolation. The Pseudotsuga menziesii plants used as a control presented no symptoms. No similar studies on forest species were found, although these results coincide with reports by ^{Ceja et al., (2000)} on avocado plants inoculated with P. cinnamomi, who observed that the pathogen caused wilting in the foliage, dark colored cankers in the stem with a brown internal lesion, and finally the death of the plants.

This study related the symptoms caused by for the isolations in Pseudotsuga mensiezii plants, which coincides with reports by ^{Erwin and Ribeiro (1996)}.

On the other hand, ^{Jordan and Tainter (1996)} observed that inoculating white oak or red oak trees, these species are very vulnerable to P. cinnamomi, and that symptoms may take months or years to become evident.

Likewise, ^{Robin and Desprez-Loustau (1998)}, who inoculated P. cinnamomi mycelium agar discs in chestnut and red oak trees, tested its pathogenicity and found symptoms of yellowing, defoliation, cracking, brown coloring, and cankers, but with different levels of virulence. However, ^{Chastagner (1997)}, mention that the formation or development of the canker does not always take place, since it will depend on the mechanism of the pathogen and the environment.

^{Podger (1989)}, meanwhile, mentions that when he used 14 Australian P. cinnamomi isolations, taken from 10 species of host plants, they diseased dicotyledonous species, and the main symptom consisted of an abnormal coloring in the root, and finally death. The isolates showed no difference in their pathogenicity.

The results obtained in this study on the pathogenicity of the P. cinnamomi isolations coincide with those reported by ^{Huberli et al., (2001)}, who found that the pathogenicity of Australian isolations on Eucalyptus marginata and Corymbia calophylla plants displayed three types of responses: the first, with a high capacity to kill plants after 59 days after inoculation; the second, of 182, which were considered intermediate, and the third, which do not lead to the death of plants, but are considered the least pathogenic.

At the same time, ^{Dudzinski et al., (1993)} found differences between the P. cinnamomi isolations collected in Australia inoculated in Eucalyptus marginata stems. These authors found a variation of the pathogenicity of the manifestation of symptoms, from inoculation until the death of the plant. Another study, by ^{Brasier et al., (1993)} mentions that P. cinnamomi is an aggressive pathogen on oak trees, and that the introduction and spreading of forest soil with the pathogen may be an important factor in declining and reducing cork in the Iberian Peninsula.

On the other hand, ^{Tippett et al., 1985} evaluated the inoculation method by injury in 21 Eucalytus marginata trees, and with a treatment of P. cinnamomi they discovered there is no variation in the pathogenicity of P. cinnamomi in inoculated plants.