SciELO

Revista mexicana de fitopatología

Print version ISSN 0185-3309

Online version ISSN 2007-8080

Rev. mex. fitopatol  vol. 34n. 2

Artículo de revisión

Review of diagnosis techniques for Brenneria spp in walnut ( Juglans regia )

Anguiano Cabello, Julia1

Arredondo Valdés, Roberto1

Cerna Chávez, Ernesto1

Beltran Beache, Mariana1

Delgado Ortiz, Juan Carlos1

Ochoa Fuentes, Yisa María1*

Abstract:

Brenneria nigrifluens and B. rubrifaciens cause superficial and deep canker in walnut bark, respectively. B. nigrifluen causes necrosis in the outer bark and scattered dark brown exudate spots. The symptoms of Brenneria nigrifluens involve holes in the wood, deep longitudinal cracking in the trunk; dark brown bacterial exudate flowing through branch cracks, and eventually the two diseases can cause loss of vigor and death of the trees. Walnut canker caused by Brenneria species has been reported in USA, France, Spain, Italy, Hungary, Persia and Iran. These symptoms have not been reported in Mexico; however, SENASICA (National Service of Health, Food Safety and Food Quality) has developed risk maps to prevent Brenneria, since walnut in Mexico is a profitable crop that reached 125 758.45 tons in 2014, equivalent to more than 6 173 538 million pesos. Due to Brenneria's bacterial pathogenicity timely diagnosis is crucial to achieve good disease management. The main diagnosis methods for Brenneria genera are: Traditional techniques, biochemical test (API system, Biolog and fatty-acid cell analysis); the serological technique; molecular methods such as end-point PCR and real-time PCR; as well as chromatographic techniques (HPLC, CCD) for the detection of specific metabolites like rubrifacine. The purpose of this work is to provide an outlook of domestic and global walnut canker, as well as reviewing the diagnosis techniques for this disease.

Key words::
Brenneria, canker, walnut, epidemiology, symptoms, diagnosis

The genus Brenneria was described in 1998 (Hauben et al., 1998) to group six bacterial species, previously included in the genus Erwinia (González et al., 2002). The six species included in the genus Brenneria are: B. alni, B. nigrifluens, B. paradisiaca, B. quercina, B. Rubrifacies, and B. salicis. Of these species, B. nigrifluens and B. rubrifaciens are the most studied, since they attack the common walnut tree (Juglans regia L.), which is a crop with a high economic value worldwide. B. nigrifluens causes surface bark canker and B. Rubrifaciens, deep bark canker in common walnut trees. In Europe, B. nigrifluens was identified in walnut orchards. The bacteria was later found in France and Italy in young plants and adult trees (Saccardi et al., 1998; Morone et al., 1998; Ménard et al., 2004; Nelson and Hudler, 2007; Scortichini 2008; Abeysekara, 2014; Narayanasamy, 2011). In Spain, B. rubrifaciens has been reported in walnut trees and trees imported from California (González et al., 2002; Nelson and Hudler, 2007). In Mexico, no Brenneria has been reported in the plantations of the pecan trees Carya illinoensis (Wang.) K. Koch or common walnut trees, although SENASICA has established risk maps due to the national economic importance of walnut trees, since in Mexico, the surface planted was, according to SIAP (2014) of 108 011 ha, with a surface harvested of 75 439 ha, a production of 125,758 tons, and a yield of 1.67 tons ha-1. The main walnut producing states are: Chihuahua, with 54% of the total national volume, Sonora 16 %, Coahuila 14 %, Durango 6 %, and Nuevo León 5 %; 98.8 % of the walnut trees are pecans, 1.1 % are common walnut, and 0.1 % is native (SAGARPA-SIAP, 2013). In Mexico, walnut production is three centuries old, and is concentrated in the states of Puebla, Tlaxcala, Estado de México, Oaxaca and Querétaro (Luna et al., 2013). The importance of the disease and difficulties in the control of Brenneria spp. highlight the impact of a timely diagnosis (Bettiol et al., 2014; López and Peñalver, 2005). However, the disease may be initially asymptomatic, and this may make the diagnose more difficult. Some of the techniques used to diagnose Brenneria are biochemical tests, the use of selective media, molecular techniques, serological techniques, and pathogenicity tests (Moretti and Buonario, 2010). The aim of this work is to provide an outlook of domestic and global walnut canker, as well as reviewing the diagnosis techniques for this disease..

Distribution of the disease

Worldwide. B. nigrifluens and B. rubrifaciens have been reported in different as the causes of the walnut canker. The main countries in which they have been reported are Iran (Yousefi et al., 2007; Jamalzade et al., 2012; Roshangar and Harighi, 2009), France, Spain (Loreti et al., 2008), Italy (Loreti et al., 2005; Pardatscher and Schweigkofler, 2009) and the United States (Wilson et al., 1957). Table 1 summarizes reports of Brenneria that causes walnut canker in different areas of the world, as well as the techniques used to identify the pathogens.

Table 1
Reports of Brenneria sp. as the cause of the walnut canker and diagnosis techniques.
Región Hospedero Patógeno Técnica de diagnóstico Referencia
California Nogal Inglés (Juglans regia L.) Erwinia nigrifluens Síntomas, pruebas bioquímicas Wilson et al., 1957
Persia Nogal persa (Juglans regia L.) Brenneria rubrifaciens (Erwinia rubrifaciens) Signos y síntomas Schaad y Wilson, 1971
Irán Nogal persa (Juglans regia L.) Brenneria nigrifluens Caracterización bioquímica Rahimian, 1989
España Nogal persa (Juglans regia L.) Brenneria nigrifluens Caracterización bioquímica López et al., 1994
Italia Nogal persa (Juglans regia L.) Erwinia nigrifluens Caracterización bioquímica Morone et al., 1998
Europa Juglans hindsii Brenneria rubrifaciens Caracterización bioquímica por API, ELISA y pruebas de patogenicidad González et al., 2002
Francia Nogal (Junglans regia persas) Brenneria nigrifluens Pruebas bioquímicas y pruebas de patogenicidad. Ménard et al., 2004
Iran Nogales persas (Juglans regia L.) Brenneria nigrifluens PCR (gen 16s) Roshangar y Harighi, 2009
No especifíca Nogal (Juglans regia L.) Brenneria rubrifaciens, Brenneria nigrifluens, otros. Estudios de ADN, mutagénesis y ensayo de virulencia. McClean y Kluepfel, 2009
Francia, Nueva Zelandia, Italia Nogales persas (Juglans regia L.) Brenneria sp. and Xanthomonas sp. Pruebas bioquímicas, pruebas de patogenicidad y F-AFLP Hajri et al., 2010
Iran Nogales persas (Juglans regia L.) Brenneria nigrifluens rep-PCR, secuencias de inserción (IS50-PCR), RAPD Jamalzade et al., 2012.
Italia Nogal (Juglans regia L.) Brenneria rubrifacienscis PCR de genes responsables de la producción de rubrifacina. Hibridación dot blot. Thapa et al., 2010
Iran Nogales persas (Juglans regia L.) Brenneria nigrifluens Pruebas bioquímicas, patrones electroforéticos y rep-PCR Jamalzade et al, 2012.
Serbia Nogal (Juglans regia L.) Brenneria nigrifluens Pruebas bioquímicas y PCR (gen 16s). Popovic, et al., 2013
Hungría Nogal (Juglans regia L.) Brenneria nigrifluens Pruebas bioquímicas, pruebas de patogenicidad, PCR (gen 16s), RT-PCR. Végh et al., 2014

National level. In Mexico there are no reports of infections of pecans with B. rubrifaciens or B. nigrifluens. However, there are areas with hosts and weather conditions similar to other areas of the world in which the disease has presented itself. According to statistics presented by SIAP (2013)B. rubrifaciens represents a high risk for Mexico, since the pecan is one of the most profitable crops in the country. By the year 2011, the surface planted with this crop was higher than 96,000 ha (SIAP, 2013). For these reasons, SENASICA (2013) has established a risk map, indicating areas of possible incidence of B. rubrifaciens. The proximity with the United States also places the walnut plantations at risk, since there are reports of walnut canker in California and Texas (SENASICA, 2013). Due to the risk of infection of walnut trees in Mexico, SENASICA placed the walnut canker caused by B. rubrifaciens in the list of "Pests under active surveilance" in 2010 and 2011 (López, 2013).

Biology of the pathogen

B. rubrifaciens becomes active towards the end of the spring, and begins to emerge from the cankers along with the sap of the plant (SENASICA, 2013). The bacteria spreads through the bark and the phloem, affecting the transportation of nutrients (UC IPM, 2007, SENASICA, 2013). Investigations suggest that B. rubrifaciens can reside in the vascular tissue of trees and remain latent until a change in weather conditions (such as water stress) acitvate it (McClean and Kluepfel, 2010).

Diagnosis techniques

Traditional techniques

Symptoms and signs. B. rubrifaciens present late symptoms in trees older than 15 years, causing a chronic reduction of vigor and yield (McClean and Kluepfel, 2010). The symptoms of this disease involve holes in the wood, deep and long cracks in the trunk, a dark brown exudate filled with bacteriae that flow from the cracks in branches, and deep cankers. Internally, black lines and dark channels are displayed in the bark of the walnut tree. Long and deep ruptures can appear with a dark brown to black color, and it exudates sap (SENASICA, 2013; Growing and protecting New Zealand, 2008; SAGARPA, Guía de síntomas de cancro profundo de la corteza del nogal (Brenneria rubrifaciens); McClean and Kluepfel, 2010).

Dworkin et al (2006) B. nigrifluens causes deep cankers in English walnuts. Meanwhile, the "Post-Entry Quarantine Testing" 2008 manual from New Zealand, indicates that B. nigrifluen is responsible for surface canker of the bark of the walnut tree, and it causes necrosis in the outer bark, as well as disperse spots of brown exudate on the bark of the tree.

Other Brenneria species such as B. alni causes cankers on the bark, branches, and trunks, along with exudates in cracks. B. quercina displays similar symptoms in oak trees. B. salicis is the cause of the "watermark disease" in willows, which resides in the xylem vessels of the infected trees and causes dry wilting with a brown color in leaves (Dworkin et al., 2006).

Specific and differential media. These help identify Brenneria according to the production of specific metabolites. The media King B (KB) is appropriate for the isolation of B. nigrifluens and B. rubrifaciens from canker exudates. B. rubrifaciens in media KB and YPGA (agar, yeast extract, peptone, glucose, and soluble starch) produces a characteristic pink pigment. In a KB medium, after 48 hours of incubation at 26-28 °C, B. rubrifaciens cultures grown in a circular fashion, smooth, and with a light cream color (Biosca and López, 2012). The differentiation of Pseudomonas species from Brenneria species, is achieved by examining under ultraviolet light; in this way, B. rubrifaciens produces a pink pigment, diffusible in YDCA. The YPGA or YDCA media (yeast dextrose carbonate agar) are used to isolate B. nigrifluens and B. rubrifaciens, respectively (Loreti et al., 2008; McClean et al., 2008; Biosca et al., 2008). B. rubrifaciens produces a red pigment in YDCA called rubrifaciens (SENASICA, 2013).

Brenneria sp. Displays a characteristic resistance to some antibiotics. McClean et al (2006) evaluated 11 antibiotics that revealed that B. rubrifaciens is resistant to erythromycin and novobiocin at a concentration of 10 mgL-1 and 30 mgL-1, respectively. Due to this, the use of these antibiotics in the culture medium helps create semi-selective media for B. rubrifaciens. Both antibiotics commonly affect bacterial physiology, la erythromycin inhibits protein synthesis, and novobiocin inhibits the DNA-coiling enzyme ADN. Such antibiotics can be added to culture media such as YDCA, 10% TSA, LBA, or minimum M9 medium for the elaboration of the semi-selective B. Rubrifaciens medium.

Isolation. Biosca et al. (2008), obtained Brenneria isolations from plant material (peridermis, cortical parenchyma, exudates, and fruits). These isolations were observed after 48 h of incubation at 26 °C in a King B medium, supplemented or not with cycloheximide (used to inhibit fungal growth). The isolation can be obtained from the external or internal canker or exudate tissue, the sample can be taken from the edge between infected and apparently healthy tissue (Biosca and López, 2012) . The tissue must be disinfected with sodium hypochlorite and alcohol solutions and grinded in 5 mL of sterile PBS (8 g of NaCl; 0,2 g of KH2PO4, 1,15 g of Na2HPO4, 0,2 g of KCl, pH 7.2 by 1 liter of distilled water) or sterile salt solution (SS) (0,9 % of NaCl in distilled water, pH 7,0). Later, the culture medium chosen in planted (Biosca and López, 2012; Charkhabi et al., 2011). The optimum temperature for the development of the bacteria in culture media is 30 to 33 °C. Within this range and with oxygen, the bacteria fluoresces and produces a cream- to white-colored colony (SENASICA, 2013).

Pathogenicity tests. Trees artifically inoculated with B. nigrifluens have shown the difficulty of reproducing the cankers observed in natural conditions (Biosca et al., 2008). In English walnut trees, Ménard et al., (2004) showed the pathogenicity of three strains, inoculating wounds on 7-year old branches with 108 UFC. The reference strain and water were inoculated in a similar fashion as controls. Two and five months later, necrotic lesions were observed inside the bark, along with dark lines in the internal wood, but no external cankers on the trees inoculated with local and reference strains. Later, B. nigrifluens was reisolated from the dark lines in the internal wood up to approximately 10 cm from the point of inoculation.

Biochemical techniques

Phenotypical characterization. Biosca, in the year 2008, carried out a phenotypical characterization using the system API 20 E, API 20 NE, API 50 CH, API ZYM, the Biolog system and the analysis of cellular fatty acids (Moretti et al., 2007). Dworkin et al., (2006) carried out the diagnose for conventional biochemical tests. Brenneria spp. are Gram-negative bacteria, oxidase negative, catalase-positive, fermative bacilli, 1.3 to 3 ηm long by 0.5 to 1 ηm wide (Hauben, 1998). Biochemically, the species of Brenneria are similar to Pantoea, Pectobacterim, and Erwinia, since they produce no arginine dehydrolase and cannot descarboxylate amino acids such as ornithine and lysine. Brenneria produces acids from the fermentation of D-glucose, D-fructose, salicin, mannose, and sucrose and produces no amylases. The majority of species are sensitive to carbenicilin, cephalothin, chloramphenicol, nalidixic acid and tetracycline, and resistant to bacitracin, wrythomycin, and gentamicin (Dworkin et al., 2006). The differential characteristics for the classification of species in the genus are shown in Table 2.

Table 2
Differential characteristics between Brenneria species (Dowrin et al., 2006; Hauben et al., 1998; Lelliott and Dickey, 1984).
Característica B. alni B. nigrifluens B. paradisiaca B. quercina B. rubrifaciens B. salicis
Indol - - + - - -
Β-Galactosidasa - + + + + +
Degradación de pectato - - + - + +
Producción de ácidos a partir de:
L-arabinosa + + + - + -
Rafinosa - + + - - +
Xilosa + + + - - -

Out of the Brenneria species, B. nigrifluens and B. rubrifaciens are the main causes of canker in the English walnut tree, therefore in 2012, Biosca and López used an API system to point out the biochemical differences between both species. The results of the API test to indicate the differences between B. nigrifluens and B. rubrifaciens are shown in Table 3.

Table 3
General physiology and biochemical characteristics of B. nigrifluens and B. rubrifluens strains (Biosca and López, 2012).
Prueba* B. nigrifluens NCPPB 564T B. rubrifaciens NCPPB 2020T
Tinción de Gram o KOH 3 % - -
Oxidasa - +
Catalasa + +
O/F +/+ +/+
Reducción de nitrato - -
dihidrolasa arginina - -
Ureasa - -
Indol - -
Hidrólisis de esculina + +
Degradación de pectato - -
β-galactosidasa + -
producción de ácido a partir de:
L-arabinosa + +
Rafinosa + -
Xilosa + -
Crecimiento a 36 °C + -
Crecimiento a 39 °C - -
* Results after 48h of inoculation at 26-28 °C.

Serological techniques

No specific monoclonal antibodies are yet available for B. nigrifluens and B. rubrifaciens. Some antibodies have been evaluated but have presented corssed reactions with other species of Brenneria (Biosca and López, 2012).

Molecular techniques

Among the molecular diagnose methods is the Polymerase Chain Reaction (PCR) (Poza-Carrión et al., 2008; Frutos D, 2010). McClean et al (2008) developed real time PCR techniques based on the identification of B. rubrifaciens in inoculated soil and leaves, although they did not identify pure bacteria or infected samples. Prasad et al., (2010) carried out the PCR technique to identify B. rubrifaciencies using the gene responsible for the synthesis of rubrifaciens, the red pigment produced by B. rubrifaciens, present in this species only, as the author indicates. The pairs of indicators used by Prasad (2010) were (a) BrAF and BrAR, which correspond to the positions 33-54 and 548-569 of the gene B. rubrifaciens asparagine synthetase (Genbank accession no. FJ205695) abd (b) 2BrIF y 2BrIR (see Table 4) (McClean and Kluepfel, 2009) designed for the synthetase self-inducing gene involved in the production of rubrifaciens, with an expected size of amplicons from 536 to 671 pb. The detection limit, according to work by Prasad et al. (2010) was of~5 χ 102 and 5 χ 104 UFCmL1 (~5 bacterial cells per reaction) of bacterial suspension, and ~5-50 pg total genomic DNA, respectively.

Table 4
Primers for Brenneria nigrifluens and Brenneria rubrifaciens.
Primer Secuencia (5'-3') Referencia
Fl C3 CCTGCGCCATGTTGCCAGATCGCTAT ACCTGAGTAGCAGTTTCGACTATTT Loreti et al., 2008 (B. nigrifluens)
BRI BR3 GSPIF GSPIR GSP2F GSP2R CAGCGGGAAGTAGCTTGCTACTTTGCCGG TGAAAAAGTCTCTCTTAAACCTTTCC TAGTGTTGCATTAGCCGATTTAG GCATTTAAAGACTATGTTTCCTG CATTACTGTTTCTCCTCGCTAATG GATGTAAATTAGCCATACACGGAATG McClean et al., 2008 (B. rubrifaciens)
BrAF BrAR 2 BrIF 2BrIR ATGTACGCAGTCTCTATTTGG CCATCAGCCTGAAATAACTCA CGGGATCCATGTTAGAAATATTCGATGTC ATCAGCTGTCAAGCCTCTTCCTTTTTG McClean y Kuepfel, 2009; Thapa et al., 2010 (B. rubrifaciens)

McClean et al (2006) described a pair of primers, BR-1 and BR-3, that amplify a region of 409 pb of the sequence 16S rDNA, which displayed sensitivity and specificity for the detection of B. rubrifaciens. By using these primers in PCR-real time, it is possible to detect eight colony-forming units (UFC), with a limit of detection of 0.45 UFC. Also, it is possible to identify Brenneria spp using partial sequencing analysis of the 16S rDNA (Biosca et al., 2006). The primers designed for B. nigrifluens and B. rubrifaciens are summarized in Table 4 (Biosca and López, 2012).

Chromatography methods

Brenneria and other microorganisms can be identified by the production of some metabolyte, using chromatography techniques, in which comparing with standards can help identify signs of a particular compound. Such is the case of the study by McClean et al. in 2012, which is based on the production of the red pigment rubrifaciens and homoserine lactone acyl (HLA) by strains of Brenneria. This author used HPLC for B. rubrifaciens, which was cultivated in a YDC medium at 28°C. Repeated extractions were performed from the broths using ethyl acetate, and were dried with nitrogen gas. The samples were resuspended in 200 ηL of 50% methanol and separated using a chromatography column C18 in a reverse phase HPLC (with a methanol gradient of 10 to 100 %, flow range of 1 mLmin-1, with a duration of 70min), with the purpose of quantifying total endogen AHLs; callibration curves were carried out earlier.

Thin-layer chromatography, in which the ethanol extracts (EtOAc) which contain AHLs of Brenneria strains are run with 60:40 methanol-water in a thin-layer chromatography chamber, comparing with standards. This technique was described in 2012 by McClean, who describes the analysis by liquid chromatography-mass spectrometry (LCMS) of the EtOAc extracts of B. rubrifaciens amd B. nigrifluens in which these are diluted 1:5 before the KCMS analysis. The spectres are acquired with a mass spectrophotometry with an HPLC system and a source of ionization atomizer, operatig in positive ion mode. In this study, the mobile phase contained 0.1 % formic acid in water (solvent A) and 0.1 % formic acid in acetonitrile (solvent B). Finally, the samples were separated with a C18 chromatography column using a linear gradient of 5 to 90 % solvent B/solvent A, with 60 min of flow at a flow range of 200 mLmin-1.

Control

The Brenneria rubrifaciens control for the English walnut tree outside of Mexico, since the disease has not been found in the country, and in consequence, no treatment or diagnose method has been evaluated. The culrutal control may be used, which involves maintaining the vigor of the tree through cultural practices; particularly water use del agua, using a tensometer to monitor soil moisutre. Mechanical control by the removal of infected tissue (branches, trunks) is not very recommendable, since it leaves the tree vulnerable and does not eliminate the pathogen effectively (SENASICA, 2013).

Conclusion

Due to the importance of the diseases cuased by Brenneria spp. in woody plants, a timely diagnose is crucial, which is why different methods have been developed that attempt to carry out a more efficient diagnose, even in trees that present no symptoms. Among the most widely used techniques for diagnosing Brenneria spp. are biochemical tests, the use of selective methods, molecular techniques, serological techniques, and pathogenicity tests. However, the method of choice will depend on the resources available, the speed with which one desires to obtain results, as well as the standardized normativity and methodology of each country. Most importantly, one should value the cost-benefit that a timely diagnosis can bring at the end of the production.

Literatura citada

  • Abeysekara N. 2014. Index for Volume 98 of Plant Disease. Plant Disease,1751. Links
  • Achille G and Massino G. 2014. Necrosi corticali da Brenneria nigrifluens e Altri batteri su noche in impianti piemontesis: studio delévoluzione della mattia in campo e caratterizzazione di isolat con rep-pcr. The Italian Society of Silviculture and Forest Ecology. DOI: 10.3832/EFOR1335-01 Links
  • Bettiol W, Rivera MC, Mondino P, Montealegre JR y Colmenárez.YC (eds.). 2014. Control biológico de enfermedades de plantas en América Latina y el Caribe ISBN: 978-99740-1091-8. Links
  • Biosca EG, Pérez-Laorga E, Águila Clarés B, Catalá-Senent R, Delgado Santander JF, González Abolafio R A y López González MM. 2008. Distribución de Brenneria spp. en la comunidad valenciana y especies forestales a las que afecta. Cuadernos de la Sociedad Española de Ciencias Forestales. 26: 113-118. Links
  • Biosca, EG. and López MM. 2012. Detection and identification methods and new tests as developed and used in the framework of COST873 for bacteria pathogenic to Stone fruits and nuts. Journal of Plant Pathology, 94 (1, Supplement), S1.105-S1.113 Edizioni ETS Pisa, 2012 S1.105. DOI: 10.4454/jpp.v94i1sup.017 Links
  • Biosca EG, Martín S, Águila B, Arahal DR, López-Ocaña L and López MM. 2006. Brenneria sp. causing bark cankers in Spanish poplars. In: J. Elphinstone, S. Weller, R. Thwaites, N. Parkinson, D. Stead & G. Saddler (eds.), Proceedings of the 11th International Conference on Plant Pathogenic Bacteria: 140. SASA, Edimburgo, U.K. Links
  • Charkhabi NF, Shams-Bakhsh M and Arahimian H. 2010. Genetic diversity among Brenneria nigrifluens strains in Iran. European journal of plant pathology,128(3), 303-310. DOI 10.1007/s10658-010-9667-0. Links
  • Charkhabi NF, Shams-Bakhsh M, Rahimian H, and Khodayegan P. 2011. Identification of Brenneria nigrifluens ISOLATES. Iranian Journal of Plant Pathology, 47(3). Links
  • Dworkin M, Falkow S and Rosenberg E. 2006. The Prokaryotes. A handbook on the Biology of Bacteria. Third Edition. Editorial Springer. Links
  • Frutos D. 2010. Bacterial diseases of walnut and hazelnut and genetic resources. Journal of Plant Pathology 92: S1.79-S1.85. [online] URL: http://www.jstor.org/stable/41998759 Links
  • González, R., López-López, M. J., Biosca, E. G., López, F., Santiago, R., & López, M. M. (2002). First report of bacterial deep bark canker of walnut caused by Brenneria (Erwinia) rubrifaciens in Europe. Plant Disease, 86(6), 696-696. Links
  • Growing and Protecting New Zeland. Post-Entry Quarantine Testing Manual. 2008. Juglans (Walnut). Biosecurity New Zeland. Plant Health & Environment Lab, IDC-Tamaki, 231 Morrin Road, St Johns, PO Box 2095, Auckland, New Zealand. 27 p. Links
  • Hajri A, Meyer D, Delort F, Guillaumes J, Brin C and Manceau C. 2010. Identification of a genetic lineage within Xanthomonas arboricola pv. juglandis as the causal agent of vertical oozing canker of Persian (English) walnut in France. Plant pathology, 59(6), 1014-1022. DOI: 10.1111/j.1365-3059.2010.02362.x Links
  • Hauben LE, Moore L, Vauterin M, Steenackers J, Mergaert L. Verdonck A and Swings J. 1998. Phylogenetic position of phytopathogens within the Enterobacteriaceae. Systematic and Applied Microbiology. 21: 384-397. Links
  • Jamalzade A, Shamsbakhsh M and Rahimian H. 2012. Genetic Diversity of Brenneria nigrifluens Strains in North of Iran (Margin of Caspian Sea). Cercetari Agronomice in Moldova. Volume 45, Issue 2, Pages 57-68, ISSN (Online) 2067-1865, ISSN (Print) 0379-5837, DOI: 10.2478/v10298-012-0015-8. Links
  • Lelliott RA and Dickey RS. 1984. Genus VII: ErwiniaIn: N. R. Krieg and J. G. Holt (Eds.) Bergey's Manual of Systematic Bacteriology. Williams & Wilkins. Baltimore, MD. 1:469-476. Links
  • López B. 2013. Plagas Reglamentadas bajo el Sistema Nacional de Vigilancia Epidemiológica Fitosanitaria (SINAVEF) 2013. Links
  • López MM, Marti R, Morente C, Oreliana N, Ninot T and Aletà N, 1994. Phytopathogenic bacteria identified in walnut in Spain. Investigación Agraria, Producción y Protección Vegetale Fuera de Serie 2, 307-314. Links
  • López MM y Peñalver R. 2005. Control biológico de bacterias fitopatógenas. El control biológico de plagas y enfermedades, 5, 131. Links
  • Loreti S, Galleli A, Piccirillo P and Belisario A. 2005. Bacterial bark canker on English walnut. Acta Horticulturae, 705,433-435. Links
  • Loreti, S, De Simone D and Gallelli A. 2008. Detection and identification of Brenneria nigrifluens, the causal agent of the shallow bark canker of walnut by, PCR amplification. Journal of phytopathology, 156(7-8), 464-469. DOI: 10.1111/j.1439-0434.2007.01393.x Links
  • Luna-Méndez N, Jaramillo-Villanueva JL, Ramírez-Juárez, Escobedo-Garrido S, Bustamante-González A, Campos-Ríos G. 2013. Tipología de unidades de producción de nuez de castilla en sistema de producción tradicional. Agricultura Sociedad y Desarrollo Vol.10 No.3 283-303 pp. Links
  • McClean AE and Kluepfel DA. 2009. Genetic loci involved in rubrifacine production in the walnut pathogen Brenneria rubrifaciens. Phytopathology. 99: 145-151. http://dx.doi.org/10.1094/PHYTO-99-2-0145 Links
  • McClean AE and Kluepfel DA. 2010. Biology of Brenneria rubrifaciens: screening for genes involved in pathogenesis. En línea http://cekings.ucdavis.edu/files/47896.pdf. Links
  • McClean AE, Sudarshana P and Kluepfel DA. 2008. Enhanced detection and isolation of the walnut pathogen Brennaria rubrifaciens: causal agent of deep bark canker. European Journal of Plant Pathology. 122: 413-424. Links
  • McClean AE, Duerkop BA, Greenberg EP and Kluepfel DA. 2012. AHL Signals Induce Rubrifacine Production in a bruI Mutant of Brenneria rubrifaciens. http://dx.doi.org/10.1094/PHYTO-04-11-0111. Vol. 102, No. 2, 2012 195. Links
  • McClean AE, Sudarshana P and Kluepfel DA. 2006. RealTime PCR Detection and Development of a Bioassay for the Deep Bark Canker Pathogen, Brenneria rubrifaciens. Pag. 247. En línea como PDF http://cekings.ucanr.edu/files/19155.pdf. Links
  • Ménard M, Delort, F, Baudry A and Le Saux, M. 2004. First report of bacterial canker of walnut caused by Brenneria nigrifluens in France. Plant Disease, 88(2), 220-220. Links
  • Moretti C, Silvestri FM, Rossini E, Natalini G and Buonaurio R. 2007. A Protocol for Rapid Identification of Brenneria nigrifluens amon Bacteria Isolated from Bark Cankers in Persin Walnut Plants. Journal of Plant Pathology (2007), 89(2), 211-218 Edizioni ETS Pisa. Links
  • Moretti C and Buonaurio R. 2010. Dipartimento di Scienze Agrarie e Ambientali, Sezione di Arboricoltura e Protezione delle Piante, Via Borgo XX Giugno 74, 06121 Perugia, Italy Immature walnut fruit inoculation for evaluation of Brenneria nigrifluens pathogenicity SHORT NOTES. Phytopathologia Mediterranea Journal (2010) 49, 80-83. http://dx.doi.org/10.14601/Phytopathol_Mediterr-3112 Links
  • Morone C, Janse JD and Scortichini M. 1998. Bark canker of Persian walnut (Juglans regia) tree incited by Erwinia nigrifluens in Italy. Journal of Phytopathology 146: 637-639. Links
  • Narayanasamy P. 2011. Diagnosis of bacterial diseases of plants. In Microbial Plant Pathogens-Detection and Disease Diagnosis(pp. 233-246). Springer Netherlands. Links
  • Nelson AH, and Hudler GW. 2007. A summary of North American hardwood tree diseases with bleeding canker symptoms. Arboriculture and urban forestry, 33(2), 122. Links
  • Pardatscher R, and Schweigkofler W. 2009. Microbial biodiversity associated with walnut Juglans regia L. in south Tyrol (Italy). Mitt Klosterneuburg, 59, 17-23. Links
  • Popović T, Ivanović Ž, Živković S, Trkulja N and Ignjatov M. 2013. First Report of Brenneria nigrifluens as the Causal Agent of Shallow-Bark Canker on Walnut Trees (Juglans regia) in Serbia. Forest, 97(11), 1504. http://dx.doi.org/10.1094/PDIS-03-13-0267-PDN Links
  • Poza-Carrión C, Aguilar I, Gallego FJ, Nuñez-Moreno Y, Biosca EG, González R, López MM and Rodríguez-Palenzuela P. 2008. Brenneria quercina and Serratia spp. isolated from Spanish oak trees: molecular characterization and development of PCR primers. Plant pathology, 57(2), 308-319. DOI: 10.1111/j.1365-3059.2007.01778.x Links
  • Prasad S, Keun C, Kyu S, Mo J, Hyun J and Hwan D. 2010. Direct detection of Brenneria rubrifaciens by (polymerase chain reaction) PCR-based assay using rubrifacine synthetic gene. Full length Research Paper. African Journal of Microbiology Research Vol. 4(16), pp. 1754-1757, 18 August, 2010. ISSN 1996-0808 (c)2010 Academic Journals. Links
  • Rahimian H. 1989. Bacterial cancker of waltnut trees in Sari. Proceeding of 9th Plant protection congress Iran (p.150). Mashhad. University of Fredowsi. Links
  • Roshangar R and Harighi B. 2009. Investigation of the phenotypic and genetic properties of Brenneria nigrifluens strains, the causal agent of walnut bark canker in Kurdistan province, Iran. Forest Pathology, 39: 335-342. DOI: 10.1111/j.1439-0329.2009.00594.x Links
  • Saccardi A, Bonetti V, Melegatti A and Cristanini M. 1998. Occurrence of Erwinia nigrifluens on English walnut (Juglans regia) tree in the Veneto region (Northern Italy). Journal of Phytopathology 80: 63-65. Links
  • SAGARPA. Guía de síntomas de Cancro profundo de la corteza del nogal (Brenneria rubrifaciens). le:///C:/Users/Ceci%20Faona/Downloads/Guia%20de%20sintomas_BR.pdf . Consultado en marzo del 2014. Links
  • Schaad NW and Wilson EE. 1971. The ecology of Erwinia rubrifaciens and the development of phloem canker of Persian walnut. Annals of Applied Biology, 69(2), 125-136. Links
  • Scortichini M. 2008. Bacterial diseases of nuts and stone fruits. http://www.cost873.ch/_uploads/_files/m_Scortichini_CSL_1.pdf. Links
  • SENASICA. 2013. Cancro profundo de la corteza del nogal (Brenneria rubrifaciens). Dirección General de Sanidad Vegetal. Sistema Nacional de Vigilancia Epidemiológica Fitosanitaria. México. D.F. Ficha técnica No. 9. 15p. Links
  • SIAP. 2013. Anuario estadístico de la producción Agrícola 2011. Servicio de Información Agroalimentaria y Pesquera Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación (SAGARPA). México. http://www.siap.gob.mx/ventana.php?id-Liga=1148&tipo=1. Links
  • SIAP. 2014. Anuario estadístico de la producción Agrícola 2011. Servicio de Información Agroalimentaria y Pesquera Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación (SAGARPA). México. http://www.siap.gob.mx/cierre-de-la-produccion-agricola-por-cultivo/ consultada 24 de Marzo de 2016. Links
  • Thapa SP, Lim CK, Kim SK, Cho JM, Hur JH and Park D.H. 2010. Direct detection of Brenneria rubrifaciens by PCRbased assay using rubrifacine synthetic gene. African Journal of Microbiology Research, 4(16), 1754-1757. Links
  • UC. IPM. 2012. Walnut Deep Bark Canker. Consultado en línea el 13 de marzo del 2016 en: http://www.ipm.ucdavis.edu/PMG/r881100511.htm-1#SYMPTOMS Links
  • Végh A, Tóth A, Zámbó Á, Borsos G and Palkovics L. 2014. First Report of Bacterial Bark Canker of Walnut Caused by Brenneria nigrifluens in Hungary.Plant Disease, 98(7), 988-988. DOI: 10.1094/PDIS-09-13-0949-PDN Links
  • Wilson EE, Starr MP and Berger JA. 1957. Bark canker, a bacterial disease of the Persian walnut tree. Phytopathology 47, 669-673. Links
  • Yousefi KF, Taghavi M and Banihashemi Z. 2007. Occurrence of shallow bark canker of walnut (Juglans regia) in southern provinces of Iran. Pakistan Journal of Biological Sciences, 10(9), 1507-1512. Links
Review of diagnosis techniques for Brenneria spp in walnut ( Juglans regia )
  • Rev. mex. fitopatol  vol. 34n. 2Review of diagnosis techniques for Brenneria spp in walnut ( Juglans regia ) Anguiano Cabello Julia 1 Arredondo Valdés Roberto 1 Cerna Chávez Ernesto 1 Beltran Beache Mariana 1 Delgado Ortiz Juan Carlos 1 Ochoa Fuentes Yisa María 1 * Author affiliationPermissions