Introduction
The chemical control of agricultural pests has been the foremost used method in the last 70 years. During this time, enough evidence has been accumulated on the risks posed by the use of chemical pesticides, both on the environment and human health, and they also compromise the sustainability of agricultural systems. This situation has generated global concern, and has increased claims that the use of chemical pesticides should be reduced in favor of an integrated pest management (IPM) (Bueno et al., 2017). The alternative to chemical control is the application of biological control. This constitutes an environmentally safe method and it is proposed as a component of the IPM. This approach has gained momentum as a strategy to replace the chemical pesticides. In recent years, an increased interest has emerged to use entomopathogenic fungi as biological control, having reached a significant advance in the development and manufacture of these agents (Swiergiel et al., 2016).
Several entomopathogenic fungi species, especially Beauveria bassiana (Bals.-Criv.) Vuill., have a wide host range, such as Coleoptera, Lepidoptera and Diptera. According to Humber (2012), this fungal species is filamentous, has chitinized cells, belongs to the class Ascomycetes, and like other entomopathogenic fungi, it is heterotrophic. B. bassiana parasites insects of great economic importance, due to its physical (action of pressure on the contact surface) and chemical (action of enzymes: proteases, lipases and chitinases) mechanisms of infection (Humber, 2012; Dhawan and Joshi, 2017). The usefulness of this microorganism in the biological control of insects has prompted its inclusion in several IPM programs.
Beauveria bassiana, like many other entomopathogenic fungi, shows a wide intraspecific variability. This feature allows its manipulation to obtain environmentally safe strains, characterization and their use to produce biopreparations. Basic taxonomy, ecology, behavior, population dynamics, population genetics and modelling research studies are needed to improve the procedures used in biological control agent exploration (Barrat et al., 2018).
At present, little is known about the molecular characterization of B. bassiana and most of the studies are based on molecular markers (Dhar et al., 2019; Vargas-Martinez et al., 2019). Studies on the molecular features of this entomopathogenic species may help to determine its taxonomic, phylogenetic and biological properties.
Taking together all the above-mentioned elements, the aim of this research was to characterize by morphological, enzymatic, pathogenic and molecular means, an autochthonous Beauveria sp. Cuban isolate and compare it to the LBB-1 commercial Cuban strain.
Materials and methods
The Beauveria sp. isolate was collected in the province of Mayabeque, Cuba, from Atta insularis (Güerin) (Hymenoptera: Formicidae) and adults of the coffee borer (Hypotenemus hampei (Ferrari)) (Coleoptera: Scolytidae). The Beauveria sp. isolate and the LBB-1 strain were cultivated in the Sabouraud Dextrose Agar medium enriched with 1% of yeast extract (SDAY). The LBB-1 strain was provided by the Entomophagous and Entomopathogenic Reproduction Center, and it is conserved in the Phytopathology Laboratory of the Agronomy Faculty at the Agrarian University of Havana “Fructuoso Rodríguez Pérez”.
Morphological characterization
The macroscopic characterization of the entomopathogenic fungi was done with 5 mm discs from the periphery of pure colonies cultivated in Petri dishes (90 mm) with SDAY medium. Cultures were incubated in the dark at 25 ºC. After ٧٢ hours, appearance and colony color before and during sporulation, and characteristics of the reverse side of the colony were evaluated visually. Daily growth rate and production of conidia were determined (Martins et al., 2015).
The microscopic characterization was carried out from microcultures on slides covered with a thin layer of water Agar (WA), and incubated in a humid chamber for 72 hours in a Boxum incubator at 25 ºC in the dark. Subsequently, the morphology and disposition of the conidiogenic cells and the shape of the conidia were determined per isolate with an NLCD-307 (40X) microscope with Software-NMS designed for the Windows CE5.0 system. The macroscopic and microscopic characteristics obtained from the studied isolate were compared to those of the LBB-1 strain of B. bassiana, using the same procedure.
Spores were counted using a Neubauer’s chamber in a NLCD-307 (40X) microscope with Software-NMS designed for Windows CE5.0 system, expressing the results in conidia mL-1. The original data were transformed to their logarithms and then processed using a simple classification variance analysis, comparing the means through the Tukey test (p<0.05) (SAS Institute, 2016).
Enzymatic characterization
Enzyme activities were determined using 5 mm discs from the periphery of pure colonies obtained in Petri dishes (90 mm) with SDAY medium; the discs were cultivated in specific culture medium for the activity of each enzyme. The medium used for proteases determination was 0.5% peptone, 0.5% NaCl, 0.25% casein, and 0.05% CaCl2 hydrated. In this medium, the hydrolysis halo formed by the degradation of the protein was measured. For the determination of lipase activity, a SDAY culture medium enriched with 5.0% butter was used and the opacity halo around the colony was measured. The determinations of lipase enzyme activity were done at 2, 4 and 6 days and protease at 3, 5 and 7 days. In the determination of the enzymatic activities of the fungi, a completely randomized design (three repetitions/treatment) was used. The data were transformed to √(x+1) and were processed through variance bifactorial analysis (isolates x time), comparing the means through the Tukey test (p<0.05) (SAS Institute, 2016).
Pathogenic characterization
The biological effectiveness of the Beauveria sp. isolate and strain LBB-1 of B. bassiana on Cylas formicarius Fabricius was evaluated under laboratory conditions. Adult insects were collected in sweet potato fields (Ipomoea batatas (L.) Lam.) without biological or chemical treatments. They were immersed for one minute into a conidial suspension with Tween 80 (0.01%) at 107 conidia mL-1 from each isolate, and then transferred into jars with a diet based on 10 g of fresh sweet potato roots (Hua et al., 2021). After day 3 or 4 post-inoculation, the dead insects were collected daily until the growth of the fungus appeared on the body surface. The mortality data was obtained at seven days through direct observation method.
The experimental design was completely randomized; 30 insects were used for each isolate and 30 as a control (not immersed into the conidial suspension) distributed in three replicates with 10 insects each. The data were transformed to arcsen(p)½ and then processed by simple classification analysis of variance, comparing the means through the Tukey test (p<0.05) (SAS Institute, 2016).
Molecular characterization
DNA extraction was done using the mycelium of each fungus, according to the method proposed by Polanco et al. (2019). The obtained DNA was visualized in a 1% agarose gel stained with ethidium bromide and stored at -20ºC for further use. Amplification of the internal transcribed spacer region (700-1050 bp) was performed using the ITS-1 (GGAAGTAAAAGTCGTAACAAGG) / ITS-4 (TCCTCCGCTTATTGATATGC) primer pair (White et al., 1990). Polymerase chain reaction (PCR) was performed in a thermocycler (BioRad, CA, USA) and the amplification program comprised one cycle at 95 ºC, ٤ min, ٣٠ cycles at ٩٥ ºC, ١ min, ٦٠ ºC, 1 min and 72 °C by ٢ min, with a final extension cycle at 72 °C for ٥ min. The amplified fragments were visualized by 1% agarose gel electrophoresis. The PCR product was purified with a Wizard SV Gel Kit and PCR Clean-Up System (Promega) and sequenced at the Chemistry DNA laboratory in CINVESTAV-IPN Unit Irapuato using a kit Dye Terminator Cycle Sequencing, Ready Reaction, in an ABI PRISM 377 PERKIN-ELMER (Cetus, Norwalk, CT) sequencer. Forward and reverse sequences were examined and aligned in BioEdit (Hall, 1999) and ClustalW (Thompson et al., 1994) respectively, in order to obtain a consensus sequence for further analyses.
The ITS sequence obtained and submitted to GenBank (MK246940) was compared with selected sequences of B. bassiana from different locations worldwide available at GenBank® database (Benson et al., 2013). Metharhizium rileyi (Farlow) Kepler, (MG637450) and Pochonia sp. (DQ516081) were used as outgroup. Sequences were aligned with ClustalW (Thompson et al., 1994) and BioEdit 7.0.9 (Hall, 1999) and the final matrix containing 560 nucleotide positions was used for a phylogenetic analysis through Bayesian inference performed in MrBayes 3.2.6 (Ronquist et al., 2012). The analysis was carried out with two independent runs of four Metropolis-coupled Markov chain Monte Carlo (MC)3 (Altekar et al., 2004) for a total of 3×106 generations, sampling one every 100 trees and discarding the first 25% of the trees as burn-in. Posterior probabilities were assessed from the 50% majority rule consensus and the tree was edited in FigTree 1.4.3 (Rambaut, 2016).
Results and discussion
Morphological characteristics
The Beauveria sp. isolate and LBB-1 strain macroscopic characteristics are shown in figures 1 and 2. The observed characteristics are very similar to those reported by Samson et al. (1988) and Humber (2012).

Figure 1 Colonies of the Beauveria sp. isolate and the commercial strain after
15 days of inoculation in culture medium. A:
Beauveria sp. isolate; B: LBB-1 strain (Photo:
NLCD-307 microscope (40X) with Software-NMS designed for the Windows
CE5.0 system).
Figura 1. Colonias del aislado de
Beauveria sp. y de la cepa comercial después de
15 días de su inoculación en medio de cultivo. A: Aislado de
Beauveria sp.; Cepa LBB-1 (Foto: Microscopio
NSZ-808 con Software-NMS diseñado para el sistema Windows
CE5.0).

Figure 2 Colony images. A-1: Synnemata in Beauveria sp. isolate; A-2 and A-3:
Stretch marks in Beauveria sp. isolate; B-1:
Synnemata in LBB-1 strain; B-2: Stretch marks in LBB-1 strain; B-3:
Color and stretch marks in the reverse of LBB-1 strain colonies
(Photo: NLCD-307 microscope (40X) with Software-NMS designed for the
Windows CE5.0 system).
Figura 2. Imagen de las colonias. A-1: Sinemas en el
aislado de Beauveria sp.; A-2 y A-3: Estrías en el
aislado de Beauveria sp.; B-1: Sinemas en la cepa
LBB-1; B-2: Estrías en la cepa LBB-1; B-3: Coloración y estrías del
reverso de la colonia de la cepa LBB-1 (Foto: Microscopio NSZ-808
con Software-NMS diseñado para el sistema Windows CE5.0).
The colonies of Beauveria sp. isolate have regular edges, with white color, velvety, they form striate that do not cover the whole colony, they are elevated (synnemata formation). At the beginning of sporulation, colonies acquire a yellowish coloration, on the reverse side they are red but there comes a time when the medium is broken and the mycelium grows below (Figure 2A-1 to A-3).
The LBB-1 strain used in the Entomophagous and Entomopathogenic Reproduction Centers of Mayabeque Cuban province for the production of biological media, showed the following characteristics: white colonies with powdery appearance, regular edges, elevated in the center (synnemata formation), although this strain rarely forms them, striated, and they acquire a creamy coloration at the beginning of sporulation; on the reverse they are red, and stretch marks do not cover the entire colony (Figure 2B-1 to B-3).
This Beauveria sp. Cuban isolate showed a slow growth (Afifah and Saputro, 2020). Other observed morphological characteristics of the isolate are very similar to those reported by Samson et al. (1988) and Humber (2012), thus confirming that the isolate belongs to B. bassiana. Gebremariam et al. (2021) found that all of B. bassiana isolates showed disseminated growth patterns, with white to yellowish-white colony color, smooth powdery to cottony texture, raise to flat elevation, and round shape, some of these characteristics are different to those reported in the isolate from the present study.
The colonies daily growth under a temperature of 25 ºC showed a uniform rate (Figure 3). The olonies of the Beauveria sp. isolate grew well at the experimental conditions. The temperature conditions can be considered favorable for mycelial growth within the range of 20 to 30 ºC. According to Gebremariam et al. (2021), Qiu et al. (2019) and Chen et al. (2018), the optimal temperature ranges for the development of pathogenic effect and survival of B. bassiana and other entomopathogenic fungi fluctuates around 25 ºC. According to Yu et al. (2020) for a better practical application of fungi in agriculture a higher thermotolerance of entomopathogenic fungus is essential.

Figure 3 Growth rate of Beauveria sp. isolate and B.
bassiana LBB-1 strain at 25 °C
after ١٥ days (mm day-1). Means with different letters are
significantly different according to Tukey (p ≤ 0.05).
Figura 3. Tasa de crecimiento del aislado de
Beauveria sp. y la cepa LBB-1 de B.
bassiana a 25 °C después de ١٥
días (mm día-1). Medias con letras diferentes son significativamente
diferentes según Tukey (p ≤ 0.05).
The production of conidia by the Beauveria sp. isolate and the LBB-1 commercial strain is shown in Table 1. The Beauveria sp. autochthonous isolate produced more conidia that the commercial LBB-1 strain, which means that the infection of this isolate will be greater since conidia represents infectious units necessary for the production of a biopesticide.
Table 1 Conidia production by Beauveria sp. isolate and the B.
bassiana LBB-1 strain at 25 °C.
Tabla 1. Producción de conidios por el aislado de
Beauveria sp. y la cepa LBB-1 de B.
bassiana a 25 °C.
| Isolates | Conidia production (conidia mL-1) | |
| X orig. | X transf. | |
| Beauveria sp. | 2.95x108 | 8.4593a |
| LBB-1 | 2.78x108 | 8.3843a |
| C.V (%) | 2.34. | |
| ESx | 0.10NS | |
Means with the same letters do not differ significantly, according to Tukey (p≤0.05).
The conidia production by Beauveria sp. isolate (2.95x108 conidia. mL-1) is higher than those observed by Dhar et al. (2016) (2.66×10⁷conidia mL-1) and Jordan et al. (2021) (2.8 × 107 conidia adult−1) showing that sporulation depends, among other factors, on the isolate. The size of the conidia is also a feature that may influence its utility as control agent.
The microscopic observations revealed that Beauveria sp. isolate microcultures had branches of mycelium and conidiophores forming clusters (Figure 4), and showed an irregular (zigzag) shape. The designated features were similar for the isolate under study and the LBB-1 strain. The conidia of the studied isolates are hyaline, round to ovoid, born individually from a single cell (Figure 5). The average size of the conidia varies from 2.9 ± 0.40 μm and 2.3 ± 0.4 to 2.4 ± 0.30 μm long and wide respectively (Table 2).

Figure 4 Morphology and outlook of the conidiogenic cells of the Beauveria sp.
isolate and the B. bassiana LBB-1
strain. A: Beauveria sp. isolate; B: LBB-1 strain
(Photo: NLCD-307 microscope (40X) with Software-NMS designed for the
Windows CE5.0 system).
Figura 4. Morfología y panorama de las células
conidiógenas del aislado de Beauveria sp. y la cepa
LBB-1 de B. bassiana. A: aislado
de Beauveria sp.; B: cepa LBB-1 (Foto: Microscopio
NSZ-808 con Software-NMS diseñado para el sistema Windows
CE5.0).

Figure 5 Conidia shape. A: Beauveria sp. isolate; B: B.
bassiana LBB-1 strain (Photo:
NLCD-307 microscope (40X) with Software-NMS designed for the Windows
CE5.0 system).
Figura 5. Forma de conidios. A: aislado de
Beauveria sp; B: cepa LBB-1 de B.
bassiana (Foto: Microscopio
NSZ-808 con Software-NMS diseñado para el sistema Windows
CE5.0).
Table 2 Conidia size of the Beauveria sp. isolate and B.
bassiana strain LBB-1 (μm) (n=
50).
Tabla 2. Tamaño de los conidios del
aislado Beauveria sp. y cepa LBB-1 de B.
bassiana (μm) (n = 50).
| Conidia size (µm) | ||
| Length | Width | |
| B. bassiana isolates | 2.9 ± 0.4 | 2.4 ± 0.3 |
| Strain LBB-1 | 2.7 ± 0.2 | 2.4 ± 0.3 |
Means with the same letters do not differ significantly, according to Tukey (p≤0.05).
According to Kirubhadharsini et al. (2017), the microscopic observations of the conidia showed that they were single cells, round to oval in shape with 2-3 μm length, with hyaline hyphae and zigzag rachis in all the isolates. These characteristics were present in the Beauveria sp. isolate from Cuba. The conidia characteristics (hyaline, round) of the Beauveria sp. isolate are also similar to those reported by Chen et al. (2018) for B. majiangensis, who also described that the conidiophores of this species form clusters. This isolate also overlaps with the features and keys described by Samson et al. (1988) for B. bassiana.
The Cuban isolate showed conidia of slightly larger size to that of the commercial LBB-1 strain (Table 2). In terms of the biological product dosage for application in the field, larger conidia mean a lower number of conidia per volume.
Enzymatic characteristics
No differences were observed when the protease enzyme activity was evaluated (Table 3). The isolate and the commercial strain produced a great hydrolysis halo in the three evaluated moments. From such result, it was inferred that both fungi had large enzymatic synthesis, which indicates a good mechanism of infection. On the other hand, lipase enzyme activity showed significant differences between the two fungi (Table 4). In the second observation, both the autochthonous isolate and LBB-1 strain produced similar large hydrolysis halos. However, in the third evaluation (7 days), the autochthonous isolate produced a larger halo of hydrolysis, being statistically different from the commercial strain.
Table 3 Protease enzyme activity (halo in mm).
Tabla 3. Actividad de la enzima proteasa (halo en
mm).
| Isolates | Time (days) | |||||
| 2 | 4 | 6 | ||||
| X orig. | X transf. | X orig. | X transf. | X orig. | X transf. | |
| Beauveria sp. isolate | 2.666 | 1.908a | 5.633 | 2.576a | 4.550 | 2.354a |
| LBB-1 | 1.666 | 1.728a | 3.333 | 2.081a | 3.250 | 2.061a |
| C.V. (%) | 4.79 | |||||
| ESx | 0.065NS | |||||
Means with the same letters do not differ significantly, according to Tukey (p≤0.05).
Table 4 Lipase enzyme activity (halo in mm).
. Actividad de la enzima lipasa (halo en mm).
| Isolates | Time (days) | |||||
| 3 | 5 | 7 | ||||
| X orig. | X transf. | X orig. | X transf. | X orig. | X transf. | |
| Beauveria sp. isolate | 6.666 | 2.769a | 9.500 | 3.230a | 13.333 | 3.786a |
| LBB-1 | 5.833 | 2.444b | 6.833 | 2.801a | 9.333 | 3.163b |
| C.V. (%) | 8.75 | |||||
| ESx | 0.120NS | |||||
Means with the same letters do not differ significantly, according to Tukey (p≤0.05).
The analyses done on protease enzyme activity showed no significant differences between the isolate and the commercial strain. Regarding the lipase enzyme activity at day seven, significant differences were found between the fungi, with the Cuban isolate having higher activity. The proteolytic and lipolytic activities were shown to be essential factors in the pathogenic activity of B. bassiana (Borgi et al., 2016). Pelizza et al. (2020) correlated the proteolytic activity of one of the studied isolates of B. bassiana (LPSc 1227) with the highest mortality of Schistocerca cancellata, also, Khosravi et al. (2015) and Dhawan and Joshi (2017) reported that fungal isolates which produced the maximum values of proteolytic and chitinolytic activity were those that produced higher mortality on the rose sawfly, Arge rosae and the caterpillar Pieres brassicae, respectively.
Regarding to lipase activity, Seyed-talebi et al. (2020) found a positive correlation between virulence of several B. bassiana isolates (TV, OZ, UN, DV and DE) with Eurygaster integriceps cuticle. Kaur and Padmaja (2009) and Robledo-Monterrubio et al. (2009) reported similar results against Helicoverpa armigera, Sphenarium purpurascens, Acheta domesticus, and Tenebrio molitor larvae. Palem and Padmaja (2013) showed that virulence of B. bassiana isolates against Helicoverpa armigera and Spodoptera litura was not correlated with lipase activity.
The results obtained in this investigation related to enzymatic activity are in agreement with all the mentioned research, since the proteolytic and lipolytic activities of the new isolate are related directly to C. formicarius mortality.
The production of extracellular enzymes by entomopathogenic fungi, according to Gomes et al. (2012), reveals their physiological and biological apparatus, showing their specialization in the degradation of numerous substances found in different hosts or environments. This knowledge of the enzymatic characteristics not only gives the idea of the pathogenic capabilities, but also indicates that substrates rich in lipids and proteins can be used for their reproduction.
Pathogenic characteristics
The results of C. formicarius mortality caused by the autochthonous isolate and the commercial strain (LBB-1) of B. bassiana under laboratory conditions, showed no significant differences between them (Table 5).
Table 5 C. formicarius Mortality caused by B.
bassiana isolate and the
B. bassiana LBB-1 strain (%).
Tabla 5. Mortalidad de C. formicarius
causada por el aislado de Beauveria sp. y la cepa
LBB-1 de B. bassiana (%).
| Isolates | X orig. | X transf. |
| LBB-1 | 48.3 | 0.63a |
| Beauveria sp. isolate | 50.0 | 0.63a |
| CV (%) | 13.73 | |
| ESx | 1.73NS |
Means with the same letters do not differ significantly, according to Tukey (p≤0.05) test.
The results of the mortality experiments showed no intraspecific variability in the biological effectiveness of the Beauveria sp. isolate and the LBB-1 strain on C. formicarius. Usually, different isolates of the same entomopathogenic microorganism show differences in their virulence on the same insect host (Sung, 2008), but in the present study, differences between the two isolates were not significant. Similar results were reported by Seyed-talebi et al. (2020) in the control of Hedypathes betulinus (Klug) (Coleoptera: Cerambycidae). Bagus et al. (2019) found that B. bassiana effectively eliminate the pest (C. formicarius) with a mortality rate of 91.67%. In a similar experiment, Hlerema et al. (2017) described promising results with the use of B. bassiana in the control of C. formicarius with significantly reduction in the percentage of insect damaged roots (5.31%). In the present research, the C. formicarius mortality induced by the Cuban isolate and the commercial strain was similar but the Cuban isolate showed the potential to become an agent for biological control.
Molecular characteristics
The PCR amplification of the autochthonous isolate with primers ITS-1 and ITS-4 is shown in Figure 6.

Figure 6 ITS amplification of the isolate by PCR. (1): negative control; (1 kb): marker; (2)
positive control and (3): isolated fragment.
Figura 6. Amplificación ITS del aislado por PCR. (1):
control negativo; (1 kb): marcador; (2) control positivo y (3):
fragmento aislado.
The PCR fragment amplified of the Beauveria sp. isolate using the ITS1-ITS4 primers was of 600 bp. This fragment size is similar to that found in four strains of B. bassiana (BBPTG1, BBPTG2, BBPTG4, BBPTG6), where the amplification of the ITS regions revealed bands of around 600 bp (López, 2015). Gebremariam et al. (2021) identified seven B. bassiana isolates using the same primers and a single product of 545 bp fragment size was obtained. Some other results showed fragments size between 500-560 bp for eight B. bassiana isolates (Mora et al., 2016; Belay et al., 2017). As a conclusion isolates fragments sizes of Beauveria sp. using the ITS1-ITS4 primers are between 500 and 600 bp.
A consensus sequence was obtained by alignment of the forward and reverse sequences of this region and deposited in GenBank with the accession number MK246940.
From the phylogenetic analysis, this isolate was identified as B. bassiana, as it constitutes a monophyletic group with other B. bassiana's accessions retrieved from GenBank. The analysis was done using sequences from different parts of the world, giving identities between 96 and 99% (Figure 7).

Figure 7 Phylogenetic analysis of the Beauveria genus, including different
B. bassiana isolates from
different regions. The autochthonous isolate is indicated by an
arrow and (T) indicates Beauveria species’ type
materials (Numbers above branches indicate posterior probabilities).
Figura 7. Análisis filogenético del género
Beauveria incluyendo diferentes aislados de
B. bassiana de diferentes
regiones. El aislado autóctono se indica con una flecha y (T) indica
los materiales tipo de la especie Beauveria. (Los
números sobres los ramos indican probabilidades
posteriores).4
Using the ITS sequence information, four clades have been identified, and the polytomous topology suggests a high genetic similarity among Beauveria isolates (clade 1). However, other studies pointed out a high genetic differentiation among Beauveria lineages with intercontinental distribution (González-Mas et al., 2019; Kazartsev and Lednev, 2021). Moreover, Ramos et al. (2017) identified five putative lineages of B. bassiana occurring naturally in Cuban fields, and the phylogenetic results of the present study are in agreement with their finding.
Recently, some researches have investigated the efficiency of B. bassiana isolates in the control of several insects (Toledo et al., 2017; Yuan et al., 2017); however, this is the first report with a molecular characterization of an autochthonous isolate of B. bassiana in Cuba.
Conclusions
The results of this investigation demonstrate that under the natural conditions of Mayabeque province, it is possible to obtain autochthonous entomopathogenic fungi isolates from several pest hosts, such as A. insularis and adults of the coffee borer (H. hampei). The morphological characteristics described for the entomopathogenic fungus are consistent with the morphology of B. bassiana. The molecular characterization of the Beauveria sp. Cuban isolate showed a band of 600 bp and through the phylogenetic study, four clades were identified and the polytomic topography recovered for clade 1 indicates a high genetic similarity (99-96%) with B. bassiana from several countries. Morphological, pathogenic and molecular characterization allowed the exact species of the new isolate to be identified as Beauveria bassiana (Bals.-Criv.) Vuill.










nova página do texto(beta)


