Nemesio Villa–Ruano¹, Martha G. Betancourt–Jiménez¹ and Edmundo Lozoya–Gloria¹*

¹ Departamento de Ingeniería Genética, Centro de Investigación y de Estudios Avanzados del IPN, Unidad Irapuato. Km. 9.6 Libramiento Norte Carretera Irapuato–León, P.O. Box 629, C.P. 36821 Irapuato, Guanajuato, México. *Tel. +52 462 6239659, Fax. +52 462 6245849, E–mail: HYPERLINK elozoya@ira.cinvestav.mx, elozoya@ira.cinvestav.mx

Received January 2010.
Accepted July 2010.

ABSTRACT

Keywords: ent–kaurene oxidase, ent–kaurenoic acid, glandular trichomes, grandiflorenic acid, Montanoa tomentosa.

RESUMEN

El ácido ent–kaurenoico (KA) es el precursor de las giberelinas en todas las plantas. Previamente propusimos la conversión biosintética del KA en ácido grandiflorénico (GF) en el "zoapatle" (Montanoa tomentosa), que es el diterpeno bioactivo más importante de esta planta medicinal Mexicana. Se sabe que el KA es el producto de la enzima ent–kaureno oxidasa (KO) considerada como una enzima clave para todas las plantas. Aquí reportamos el aislamiento de un ADNc completo de la ent–kaureno oxidasa de Montanoa tomentosa (MtKO–cDNA). El análisis de la expresión del gen correspondiente se comparo con los niveles endógenos de KA en hojas de diferentes edades. Los datos obtenidos sugieren que el KA es sintetizado principalmente en el mesófilo de las hojas jóvenes y acumulado posteriormente en hojas viejas y tricomas glandulares. Sin embargo, la expresión del gen MtKO fue clara en tejidos jóvenes y escasa o nula en las hojas viejas así como en los tricomas. La detección de bajos niveles del transcrito de la MtKO en los tricomas glandulares, sugiere que estas estructuras podrían estar involucradas en la biosíntesis del KA. La presencia de altas concentraciones de KA en la hoja entera sugiere un posible mecanismo de defensa basado en la producción y la acumulación de este diterpeno. La presente investigación es una contribución a la caracterización de la vía metabólica de los diterpenos farmacológicos de M. tomentosa.

INTRODUCTION

Montanoa tomentosa (zoapatle) is a Mexican medicinal plant that belongs to the Com–positae family, used for common disorders in women's health. The pharmaceutical bioactive compounds are KA ([4α]–kaur–6–en–18–oic acid) and GF ([4α]–kaura–9 [11]–16–dien–18–oic acid). In roots besides KA and GF, monoginoic acid (MO) (13–methyl–[4 α]–norkaur–15–en–18–oic acid) is the most abundant but less studied related diterpene (Enriquez et al., 1997). GF and KA have been associated with uterotonic activities in female rats (Campos–Bedolla et al. , 1997) and the aqueous crude extract of zoapatle was proposed to have aphrodisiac effects in male rats (Carro–Juarez et al., 2004). Recently, the biosynthetic relationship among these diterpenes was studied in the plant itself (Villa–Ruano et al., 2009), opening the possibility for future biotech–nological manipulation.

It is known that KA is the precursor of all gibberellins that are diterpene plant hormones biosynthesized by complex pathways controlling growth and development (Yamaguchi, 2008). Recently, gibberellins and abscisic acid (ABA) where involved in the phytochrome–mediated germination response (Seo et al., 2009). KA has been found in glandular trichomes of M. tomentosa leaves (Robles–Zepeda et al., 2009), and this as well as other diterpenes and hormones such as gibberellic acid (GA) among others (Bari & Jones, 2009), may be related to ecological roles as plant defense substances specifically against bacteria (Zgoda–Pols et al, 2002), protozoos (Vieira et al., 2005), fungi (Cotoras et al, 2004), insects (Topcu and Gören, 2007) and viruses (Zhu et al., 2005).

The KO, a P450 enzyme, catalyzes the transformation of ent–kaurene into KA in three oxidation steps (Helliwell et al., 1999), and due to its central role in the biosynthesis of gibberellins and other diterpenes with relevant ecological and pharmacological roles; it is considered as a key enzyme in plants. In the present work we report the identification and isolation of a full–length cDNA of KO from Montanoa tomentosa (MtKO–cDNA). MtKO gene expression was studied by quantifying MtKO–mRNA transcript abundance in young shoots, meso–phyll and glandular trichomes at different leaf ages. KA content in different leaf ages was also determined to compare it with MtKO gene expression.

MATERIALS AND METHODS

Plant material

New, young, mature, and old leaves of Montanoa tomentosa including the apex, as well as young shoots were taken from plants grown at 23–27 °C and 16 h/8 h light/dark photoperiod for two years in an experimental greenhouse at Cinvestav–IPN Unidad Irapuato in México. Dr. Jerzy Rzedowszki from the Instituto de Ecología UNAM, Michoacán México, previously certified these plants.

Nucleic acid extraction

Total RNA extraction was carried out as described in the Trizol protocol (Invitrogen ^TM), starting from 100 mg of fresh tissue previously grounded in a mortar in the presence of liquid nitrogen. A phenol: chloroform: isopropanol (25:24:1, v/v/v) extraction was done and the RNA integrity was confirmed by agarose 1% gel electrophoresis after staining with ethidium bromide. RNA from glandular trichomes was obtained according with Yerguer et al (1992). Briefly, trichomes from frozen plant tissue were specifically broken by strong vortexing with powdered dry ice, and sieved from larger tissue fragments for collecting glandular heads. This method preserves the integrity of active enzymes and nucleic acids from glandular trichomes avoiding contamination with mesophyll cells material. The non–sieved remaining tissue was confirmed as naked mesophyll without trichomes by microscopy, and grounded in the presence of liquid N₂ for RNA extraction as it is described above.

Isolation and molecular cloning of full length MtKO–cDNA by RT–PCR

All the retro transcription reactions were made from 10 μg of total RNA using the reverse transcriptase enzyme SuperScript II (Invitrogen ^TM). Degenerated primers 5'–GGGAATYTRYTGCARTTGAAGGAGAAG– 3 ' and 5'–CCCTCTTYCCNSCTCCRAACGC–CAT–3' were used to amplify a 1200 bp internal fragment of a putative MtKO–cDNA from total RNA. These oligonucleotides were designed according to conserved domains of putative P450 plant enzymes available in the NCBI Gen Bank such as Stevia rebaudiana (AAY42951), Arabidopsis thaliana (AAC39507), Pisum sativum (AAP69988), Cucurbita maxima (AAG41776), and Fragaria grandiflora (AAG41776). PCR running conditions to obtain this amplicon were as follows: 4 min at 94 °C of initial dena–turation, 30 cycles at 94 °C for 30 sec, 57 °C for 30 sec, and 72 °C for 1 min 20 sec polymerization, finishing with 5 min at 72 °C. Full–length MtKO–cDNA was obtained by completing the 5' and 3'– ends according with the manual of the Gen RACER Kit (Invitrogen ^TM). Specific oligonucleotides to get the 5'–end were 5'–GGCGTTTGACGGTCTT– GTGATAATC–3' and 5'–GGTTTTATCAGCT–GTGAGGACC–3', and for the 3'–end were 5'–GGGACATCCAAAGTGTGTGTGGG–3' and 5'–GGGAGCCTATTATCGAATCATCAG–3'. In both cases, the used conditions were 5 cycles at 94 °C for 30 sec, 63 °C for 30 sec, and 72 °C for 1 min; followed by 25 cycles at 94 °C for 30 sec, 57 °C for 30 sec and 72 °C for 1 min, finishing with an extension of 72 °C for 4 min. All PCR products were individually ligated to the TOPO TA cloning vector (Invitrogen ^TM). Finally, the complete cDNA was amplified from the cloned one using 5'–ATGGATACCCTCACCGGATTC–3' as forward primer and 5'–TCAATTTCT–GGGCTTTATTAAGGC–3' as reverse primer in a PCR reaction consisting of 4 min at 94 °C of initial denaturation, 35 cycles at 94 °C for 30 sec, 57 °C for 30 sec, and 72 °C for 1 min 40 sec, finishing with 5 min at 72 °C. Resulted PCR products were sequenced by triplicate on ABI PRISM 3700 instruments (ABI, Foster City, CA). The identity of these sequences was edited and compared with available sequences in the Gen Bank using the Blast X program.

MtKO gene expression analysis

Gene expression was analyzed by semi–quantitative RT–PCR using the protocol of SuperScript II (Invitrogen ^TM) for synthesizing the cDNA pools. Specific oligo–nucleotides to perform the PCR reactions were as described above. The β–actin gene expression was assayed as a constitutive and positive control in the transcription analysis of MtKO gene. Oligonucleotides used to amplify β–actin transcripts were 5'–GCAGACGGTGAGGATATCC–3' as forward primer and 5' CAGCAAGATCCAAACGAAG–3' as reverse primer, and oligonucleotides for MtKO transcript amplification were those used to amplify the full length MtKO–cDNA in the same PCR conditions as described above. PCR products were analyzed by agarose 1% gel electrophoresis after staining with ethidium bromide.

KA was extracted, identified, and quantified by GC–MS according to Villa–Ruano et al., 2009. Identity of this diterpene was confirmed by their respective retention time and spectra as follows: KA: m/z 374 (M+ 86% rel. int.), 359 (97), 331 (66), 257 (100), 241 (68), 143 (29), 91 (30), 73 (81). Abietic acid was used as internal standard; all the assays were performed in triplicate.

RESULTS AND DISCUSSION

MtKO–cDNA nucleotide sequence and comparison to other sequences

Full–length MtKO–cDNA was successfully completed at both 5' and 3' ends having 1542 bp coding for 514 aa. Total amino acid sequence was analyzed and translated with ExPASY software (http : ca. expasy. org/ tools/ dna.html). When compared specifically to the Stevia reabaudiana KO (AAY42951) aa sequence, a high amino acid (87%) homology was shown. Important and conserved catalytic domains of P450 enzyme regions were found in the MtKO sequence (Davidson et al., 2004) (Figure 1). Amino acid sequence comparison of all reported plant KOs was carried out with Protein BLAST software (http://blast.ncbi.nlm.nih.gov/Blast.cgi). ClustalW software from EMBL–EBI was used to search for similarities and the resulted dendogram is shown in Figure 2 indicating that MtKO is quite similar to S. rebaudiana and Lactuca sativa enzymes. The high homology of this cDNA with corresponding sequences of Arabidopsis thaliana and Stevia reabaudia–na predicts the same oxidation function to produce KA from ent–kaurene (Richman et al., 1999). This MtKO–cDNA, is the second one isolated from an Asteraceae.

MtKO gene expression

Expression analysis of MtKO gene was performed by semi–quantitative RT–PCR assays in different tissues and at several leaf stages. MtKO gene expression was observed in mesophyll and shoots (Figure 3A) and in new, young, mature and even in old mesophyll tissues (Figure 3B). In trichomes low expression levels were detected, mainly in new and young tissues, but apparently it was no expression in mature and old tissues (Figure 3A and 3B). Interestingly, an inverse relationship among MtKO gene expression and KA concentration was found in new, young, mature and old leaves (Figure 3B and 3C). High levels of MtKO transcript but low KA concentration in new and young leaves, may suggest a quick exchange of this precursor into other tetracyclic diterpenes as gibberellins, which could be required to leaf expansion and stem elongation (Olszewski et al., 2002). So, KA may be used to produce GF, which is actively bio–synthesized in these tissues (Villa–Ruano et al., 2009) and accumulation of these diterpenes in mature and old tissues could be related to a defense mechanism. It is not yet clear if these results may be due to an active transport of KA from young to old tissues, or to a continuous accumulation of KA in the same tissue. Inactivation or posttranslational modification of the MtKO protein may also be involved. Further experiments are necessary to check these possibilities. Despite the existence of two KO sequences from Asteraceae plants (Richman et al,. 1999; Sawada et al,. 2008), there is not any information about their compartment expression and in vitro activities as reported here.

Initial detection of KA in glandular trichomes (Robles–Zepeda et al, 2009), suggested that this diterpene could be partially biosynthesized in these structures. In our work, most of the MtKO–mRNA was observed in the mesophyll, but it was also found in the trichomes. Although a very specific trichome purification procedure was used and we afforded high purity preparations, which decreases mesophyll contamination; we cannot discard that the trichome signal could be due to contamination with mesophyll cells. The efficiency of this trichome purification method was demonstrated in geranium when «5 fatty acids were found exclusively in trichomes and not in the trichome–free supporting tissue, indicating that the most likely site of «5 biosynthesis was the trichome (Yerger et al., 1992). However, although the amplification power of PCR procedure is far beyond the finest metabolite analysis, it is not discarded an actively KA transport from mesophyll cells to trichomes.

The present work contributes to the knowledge of pharmacological diterpenes metabolism from M. tomentosa, specifically of KA. The proposal of a microsomal KA–C9 (11) desaturase enzyme (Villa–Ruano et al., 2009) and the gene expression of KO in M. tomentosa as shown here to produce some of the most bioactive diterpenes in pharmacology and ecology like GF and KA respectively, suggests that these compounds play an important function in the plant physiology.

CONCLUSIONS

This work reports the isolation of a full–length cDNA from Montanoa tomentosa that encodes a putative ent–kaurene oxidase (MtKO) enzyme involved in kaurenoic acid biosynthesis.

The MtKO gene expression pattern studied in green tissues including shoots showed that this gene is mainly expressed in young tissues.

Higher levels of KA were observed in old leaves than in young leaves showing an inverse relationship with MtKO gene expression, suggesting that accumulation of this compound in old leaves might be based in its transport from young to old tissues or from accumulation throughout leaf development. Accumulation of KA and the decreased amount of MtKO–mRNA in old tissue seems to be the result of the overall diterpenes metabolism in zoapatle plants.

ACKNOWLEDGEMENTS

We thank to Yesenia Pacheco Hernández from Instituto Tecnológico de Sonora, and Nestor Hernández Silva from Universidad Politécnica de Puebla for their generous participation in this work. We thank to CONACYT México for the postdoctoral fellowship to NVR.

REFERENCES

Bari, R., Jones, J. D. G. (2009) Role of plant hormones in plant defense responses. Plant Molecular Biology. 69: 473–488         [ Links ]

Campos–Bedolla, P., Campos, G.M., Valencia–Sánchez, A., Ponce–Monter, H. (1997) Effect of kauranes from Montanoa spp. on rat uterus. Phytotherapy Research 11 : 11–16         [ Links ]

Carro–Juárez, M., Cervantes, E., Cervantes–Mendez, M., Rodriguez–Manzo, G. (2004) Aphrodisiac properties of Montanoa tomentosa aqueous crude extract in male rats. Pharmacology Biochemistry and Behavior 78: 129–134         [ Links ]

Cotoras, T., Folch, C., Mendoza, L.S. (2004) Characterization of the antifungal activity on Botrytis cinerea of the natural diterpenoids kaurenoic acid and 3 beta–hydroxy–kaurenoic acid. Journal of Agricultural and Food Chemistry 52: 2821–2826         [ Links ]

Davidson, S.E., Smith, J.J., Helliwell, C.A., Poole, A.T., Reid, J.B. (2004) The pea gene LH encodes ent–kaurene oxidase . Plant Physiology 134: 1123–1134         [ Links ]

Enriquez, R.G., Barajas, J., Ortiz, B., Lough, A.J., Reynolds, W.F., Yu, M., León, I., Gnecco, D. (1997) Comparison of crystal and solution structures and ¹H and ¹³C chemical shifts for grandiflorenic acid, kaurenoic acid and monoginoic acid. Canadian Journal of Chemistry 75: 342–347        [ Links ]

Helliwell, C.A., Poole, A., Peacock, W.J., Dennis, E.S. (1999) Arabidopsis ent–kaurene oxidase catalyzes three steps of gibberellin biosynthesis. Plant Physiology 119: 507–510        [ Links ]

Olszewski, N., Sun, T.P., Gubler, F. (2002) Gibberellin signaling: biosynthesis, catabolism, and response pathways. Plant Cell. Suppl: S61–S80         [ Links ]

Richman, A.S., Gigzen, M., Starrat, A.N., Yang, Z., Brandle, E. (1999) Diterpene synthesis in Stevia rebaudiana: recruitment and up–regulation of key enzymes from the gibberellin biosynthetic pathway. The Plant Journal 19: 411–421         [ Links ]

Robles–Zepeda, R.E., Lozoya–Gloria, E., López, M.G., Villarreal, M.L., Ramírez–Chávez, E., Molina–Torres, J. (2009) Montanoa tomentosa glandular trichomes containing kaurenoic acids chemical profile and distribution. Fitoterapia 80: 12–17         [ Links ]

Sawada, Y., Katsumata, T., Kitamura, J., Kawaide, H., Nakajima, M., Asami, T., Nakaminami, K., Kurahashi, T., Mitsuhashi, W., Inoue, Y., Toyomasu, T. (2008) Germination of photoblastic lettuce seeds is regulated via the control of endogenous physiologically active gibberellin content, rather than of gibberellin responsiveness. Journal of Experimental Botany 59: 3383–3393        [ Links ]

Seo, M., Nambara, E., Choi, G., Yamaguchi, S. (2009) Interaction of light and hormone signals in germinating seeds. Plant Molecular Biology 69: 463–472         [ Links ]

Topcu, G., Gören, A.C. (2007) Biological activity of diterpenoids isolated from Anatolian Lamiaceae plants. Records of Natural Products 1 : 1–16         [ Links ]

Vieira, H.S., Takahashi, J.A., Pimenta, L.P.S., Boaventura, D.M.A. (2005) Effects of kaurane diterpene derivatives on germination and growth of Lactuca sativa seedlings. Zeitschrift für Naturforschung 60: 72–78         [ Links ]

Villa–Ruano, N., Betancourt–Jiménez, M.G., Lozoya–Gloria, E. (2009) Biosynthesis of uterotonic diterpenes from Montanoa tomentosa (zoapatle). Journal of Plant Physiology 166: 1961–1967        [ Links ]

Yamaguchi, S. (2008) Gibberellin metabolism and its regulation. Annual Review of Plant Biology. 59: 225–251        [ Links ]

Yerguer, E.H., Grazzini, R.A., Hesk, D., Cox–Foster, D.L., Craig, R., Mumma, R.O. (1992) A rapid method for isolating glandular trichomes. Plant Physiology 99: 1–7        [ Links ]

Zgoda–Pols, J.R., Freyer, A.J., Killmer, L.B., Porter, J.R. (2002) Antimicrobial diterpenes from the stem bark of Mitrephora celebica. Fitoterapia 73: 434–438        [ Links ]

Zhu, S., Gao, F., Cao, X., Chjen, M., Ye, G., Wei, Ch., Li, Y. (2005) The rice dwarf virus P2 protein interacts with ent–kaurene oxidases in vivo, leading to reduced biosynthesis of gibberellins and rice dwarf symptoms. Plant Physiology 139: 1935–1945        [ Links ] ]]> 2009 69 473-488 1997 11 11-16 2004 78 129-134 2004 52 2821-2826 2004 134 1123-1134 1997 75 342-347 1999 119 507-510 2002 S61-S80 1999 19 411-421 2009 80 12-17 2008 59 3383-3393 2009 69 463-472 2007 1 1-16 2005 60 72-78 2009 166 1961-1967 2008 59 225-251 1992 99 1-7 2002 73 434-438 2005 139 1935-1945