<?xml version="1.0" encoding="ISO-8859-1"?><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id>1870-3453</journal-id>
<journal-title><![CDATA[Revista mexicana de biodiversidad]]></journal-title>
<abbrev-journal-title><![CDATA[Rev. Mex. Biodiv.]]></abbrev-journal-title>
<issn>1870-3453</issn>
<publisher>
<publisher-name><![CDATA[Instituto de Biología]]></publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id>S1870-34532013000400035</article-id>
<article-id pub-id-type="doi">10.7550/rmb.32705</article-id>
<title-group>
<article-title xml:lang="en"><![CDATA[Cross amplification of microsatellite loci developed for Atractosteus spatula in Atractosteus tropicus]]></article-title>
<article-title xml:lang="es"><![CDATA[Amplificación de microsatélites desarrollados para Atractosteus spatula en Atractosteus tropicus]]></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Bohn]]></surname>
<given-names><![CDATA[Sandra]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Barraza]]></surname>
<given-names><![CDATA[Enrique]]></given-names>
</name>
<xref ref-type="aff" rid="A02"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[McMahan]]></surname>
<given-names><![CDATA[Caleb]]></given-names>
</name>
<xref ref-type="aff" rid="A03"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Matamoros]]></surname>
<given-names><![CDATA[Wilfredo]]></given-names>
</name>
<xref ref-type="aff" rid="A03"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Kreiser]]></surname>
<given-names><![CDATA[Brian]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
</contrib-group>
<aff id="A01">
<institution><![CDATA[,The University of Southern Mississippi Department of Biological Sciences ]]></institution>
<addr-line><![CDATA[Hattiesburg MS]]></addr-line>
<country>USA</country>
</aff>
<aff id="A02">
<institution><![CDATA[,Ministerio de Medio Ambiente y Recursos Naturales Unidad de Humedales ]]></institution>
<addr-line><![CDATA[San Salvador ]]></addr-line>
<country>El Salvador</country>
</aff>
<aff id="A03">
<institution><![CDATA[,Louisiana State University Department of Biological Sciences LSU Museum of Natural Science (Ichthyology)]]></institution>
<addr-line><![CDATA[ ]]></addr-line>
</aff>
<pub-date pub-type="pub">
<day>00</day>
<month>12</month>
<year>2013</year>
</pub-date>
<pub-date pub-type="epub">
<day>00</day>
<month>12</month>
<year>2013</year>
</pub-date>
<volume>84</volume>
<numero>4</numero>
<fpage>1349</fpage>
<lpage>1351</lpage>
<copyright-statement/>
<copyright-year/>
<self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S1870-34532013000400035&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_abstract&amp;pid=S1870-34532013000400035&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_pdf&amp;pid=S1870-34532013000400035&amp;lng=en&amp;nrm=iso"></self-uri><abstract abstract-type="short" xml:lang="en"><p><![CDATA[Due to recent population declines in tropical gar (Atractosteus tropicus), a greater understanding of its population structure is needed. A key step in gaining this understanding is the development of microsatellite loci for use in this species. For this purpose, 33 microsatellite loci from alligator gar (A. spatula) were screened in 52 individuals from a population in Zanjón del Chino, El Salvador. Twenty-five of these loci successfully amplified in this species, and 9 of those loci were polymorphic in this population. These loci should provide a useful tool for genotyping A. tropicus, both in studying existing wild populations and in monitoring genetic diversity in aquaculture.]]></p></abstract>
<abstract abstract-type="short" xml:lang="es"><p><![CDATA[Debido al reciente declive en las poblaciones del pejelagarto (Atractosteus tropicus), es necesario un mayor conocimiento de la estructura de sus poblaciones. En este sentido, el desarrollo de microsatélites para esta especie sería un paso fundamental. Con este propósito, se examinaron 33 microsatélites de A. spatula en 52 individuos de A. tropicus provenientes de una población del Zanjón del Chino, El Salvador. Veinticinco de estos loci amplificaron exitosamente y 9 de ellos fueron polimórficos. Estos loci pueden convertirse en una herramienta útil en el reconocimiento del genotipo de poblaciones naturales de A. tropicus, así como también para el monitoreo de la diversidad genética en proyectos de acuicultura.]]></p></abstract>
<kwd-group>
<kwd lng="en"><![CDATA[aquaculture]]></kwd>
<kwd lng="en"><![CDATA[conservation genetics]]></kwd>
<kwd lng="en"><![CDATA[Lepisosteidae]]></kwd>
<kwd lng="es"><![CDATA[acuacultura]]></kwd>
<kwd lng="es"><![CDATA[genética de la conservación]]></kwd>
<kwd lng="es"><![CDATA[Lepisosteidae]]></kwd>
</kwd-group>
</article-meta>
</front><body><![CDATA[  	    <p align="justify"><font face="verdana" size="4">Nota cient&iacute;fica</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="center"><font face="verdana" size="4"><b>Cross amplification of microsatellite loci developed for <i>Atractosteus spatula</i> in <i>Atractosteus tropicus</i></b></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="center"><font face="verdana" size="3"><b>Amplificaci&oacute;n de microsat&eacute;lites desarrollados para <i>Atractosteus spatula</i> en <i>Atractosteus tropicus</i></b></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="center"><font face="verdana" size="2"><b>Sandra Bohn<sup>1</sup>*, Enrique Barraza<sup>2</sup>, Caleb McMahan<sup>3</sup>, Wilfredo Matamoros<sup>3</sup> and Brian Kreiser<sup>1</sup></b></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><sup><i>1</i></sup> <i>Department of Biological Sciences, The University of Southern Mississippi, 118 College Dr. 5018, Hattiesburg, MS, 39406, USA.</i> *<a href="mailto:sandra.bohn@eagles.usm.edu">sandra.bohn@eagles.usm.edu</a></font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><i><sup>2</sup> Unidad de Humedales, Ministerio de Medio Ambiente y Recursos Naturales, Col. y Calle Las Mercedes, San Salvador, El Salvador.</i></font></p>  	    <p align="justify"><font face="verdana" size="2"><i><sup>3</sup> LSU Museum of Natural Science (Ichthyology), Department of Biological Sciences, Louisiana State University, 119 Foster Hall, Baton Rouge, LA, 70803, USA.</i></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2">Recibido: 14 agosto 2012    <br> 	Aceptado: 06 mayo 2013</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Abstract</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Due to recent population declines in tropical gar <i>(Atractosteus tropicus),</i> a greater understanding of its population structure is needed. A key step in gaining this understanding is the development of microsatellite loci for use in this species. For this purpose, 33 microsatellite loci from alligator gar (A. <i>spatula)</i> were screened in 52 individuals from a population in Zanj&oacute;n del Chino, El Salvador. Twenty&#45;five of these loci successfully amplified in this species, and 9 of those loci were polymorphic in this population. These loci should provide a useful tool for genotyping <i>A. tropicus,</i> both in studying existing wild populations and in monitoring genetic diversity in aquaculture.</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Key words:</b> aquaculture, conservation genetics, Lepisosteidae.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>Resumen</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Debido al reciente declive en las poblaciones del pejelagarto <i>(Atractosteus tropicus),</i> es necesario un mayor conocimiento de la estructura de sus poblaciones. En este sentido, el desarrollo de microsat&eacute;lites para esta especie ser&iacute;a un paso fundamental. Con este prop&oacute;sito, se examinaron 33 microsat&eacute;lites de <i>A. spatula</i> en 52 individuos de <i>A. tropicus</i> provenientes de una poblaci&oacute;n del Zanj&oacute;n del Chino, El Salvador. Veinticinco de estos loci amplificaron exitosamente y 9 de ellos fueron polim&oacute;rficos. Estos loci pueden convertirse en una herramienta &uacute;til en el reconocimiento del genotipo de poblaciones naturales de <i>A. tropicus,</i> as&iacute; como tambi&eacute;n para el monitoreo de la diversidad gen&eacute;tica en proyectos de acuicultura.</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Palabras clave:</b> acuacultura, gen&eacute;tica de la conservaci&oacute;n, Lepisosteidae.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2">The tropical gar <i>(Atractosteus tropicus)</i> is a small, highly pigmented gar that reaches an average total length of about 60 cm (Mora&#45;Jamett et al., 1997). The current range extends from southern Mexico to Costa Rica (Barrientos&#45;Villalobos and Espinosa&#45;de los Monteros, 2008). However, its distribution is not contiguous and populations are often isolated in drainages separated by hundreds of kilometers. Reported to be relatively abundant in Mexico, they are often fished for food and are considered to be one of the top 5 resources for commercial fishing (Aguilera et al., 2002).</font></p>  	    <p align="justify"><font face="verdana" size="2">Since the 1990's, annual captures of <i>A. tropicus</i> have declined in Mexico (Aguilera et al., 2002). The species is also now legally protected in Costa Rica (Ley N&deg; 30102&#45;MINAE del 27 de noviembre, 2001), Nicaragua (Ley N&deg; 34, la Gaceta No. 92 del 16 mayo, 2008), and El Salvador (Acuerdo N<sup>o</sup> 36, 5 June 2009). Part of this decline has been attributed to destruction of spawning grounds due to dam building and other anthropogenic factors (Mendoza et al., 2002). Aquaculture has been a popular solution for enhancing depleted stocks (Aguilera et al., 2002) since gar are well suited to aquaculture given their tolerance to low dissolved oxygen, high ammonia, high nitrites, and many diseases (Alfaro et al., 2008). Analyses of mitochondrial DNA (mtDNA) in this species have shown highly structured populations across Mexico and Central America (Barrientos&#45;Villalobos and Espinosa&#45;de los Monteros, 2008). Although this work has provided insight into <i>A. tropicus</i> population structure, further study is still warranted. Identifying a set of microsatellite nuclear markers is an important step in effective management and hatchery planning.</font></p>  	    <p align="justify"><font face="verdana" size="2">Fortunately, although microsatellite development can be an expensive and time&#45;consuming process (Selkoe and Toonen, 2006), many studies have demonstrated that loci isolated for one species cross amplify in other species within the genus, or even within the same family (e.g., Holman et al., 2005). Moyer et al. (2009) developed a number of microsatellite loci for use with <i>A. spatula</i> (alligator gar) and determined that a subset of those loci successfully amplified microsatellite loci in 2 other species of gar, <i>Lepisosteus oculatus</i> and <i>L. osseus.</i> Here, we test these same loci and several loci not previously reported by Moyer et al. (2009) in <i>A. tropicus.</i></font></p>  	    <p align="justify"><font face="verdana" size="2">Fifty&#45;two <i>A. tropicus</i> were collected from within a 5 km area of the Zanj&oacute;n del Chino drainage in Ahuachapan, El Salvador (13&deg;45'10.0" N, 90&deg;03'23.9" W). Fin clips were preserved in 95% ethanol. Tissue was digested with SDS and Proteinase K, and DNA was extracted through ethanol precipitation (Miller et al., 1988). DNA was amplified using PCR mix A and PCR conditions from Moyer et al. (2009). All loci were initially screened at an annealing temperature of 56&deg; C, but other annealing temperatures were tested if the amplification conditions for a locus required further optimization. We screened a total of 33 loci. Twenty of these loci are the ones described in Moyer et al. (2009), and we also tested an additional 13 undescribed loci from that project (GenBank accesion numbers: EU625551, EU625555, EU625558, EU625561&#45;EU625563, and JX183078&#45;JX183084). A LICOR 4300 DNA analyzer was used to visualize the PCR product with a 50&#45;350 bp size standard (LI&#45;COR). Alleles were scored using GeneProfiler 4.05 (Scanalytics Inc.). All loci were first tested using 25 samples. Polymorphic loci were then tested on the remaining 27 samples to determine the size range for each locus and the extent of genetic diversity.</font></p>  	    <p align="justify"><font face="verdana" size="2">Each microsatellite locus was checked for null alleles in MicroChecker 1.0 (VanOosterhout et al., 2004) and in Cervus 3.0 (Kalinowski et al., 2007). Observed (H<sub>O</sub>) and expected (HE) heterozygosities and the polymorphism information content (PIC) for each locus were calculated in Cervus 3.0. Each locus was also checked for Hardy&#45;Weinberg equilibrium and linkage disequilibrium in Genepop 4.0.10 (Raymond and Rousset, 1995) with statistical significance adjusted using a sequential Bonferroni correction (Rice, 1989).</font></p>  	    <p align="justify"><font face="verdana" size="2">Nine microsatellite loci were polymorphic in this population of <i>A. tropicus</i> (<a href="/img/revistas/rmbiodiv/v84n4/a35t1.jpg" target="_blank">Table 1</a>) after excluding those loci that showed stutter too severe for accurate genotyping. The number of alleles ranged from 2&#45;4 per locus (average= 3), the observed heterozygosity ranged from 0.043&#45;0.686 (average= 0.303), the expected heterozygosity ranged from 0.042&#45;0.649 (average= 0.343), and the PIC ranged from 0.041&#45;0.587 (average= 0.305). While these loci were not highly polymorphic, these genetic diversity measures fall within the range reported for the loci found to be polymorphic in <i>A. spatula.</i> Locus Asp021 deviated from Hardy&#45;Weinberg equilibrium (p&lt; 0.001) and showed a greater than expected number of homozygotes, which suggests the possibility of null alleles that were estimated to occur at a frequency of 0.3846. Although the preponderance of homozygotes may be an artifact of this particular population, the possibility of null alleles should be considered when using this locus. All other loci were at Hardy&#45;Weinberg equilibrium and showed no evidence of null alleles or linkage.</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">The 3 polymorphic loci not previously described in Moyer et al. (2009) were Asp053 (F: 5'&#45;TGGTGGGTTGTTCAGCCTAT&#45;3', R: 5'&#45;TCCTTAGCAGGATCAATGTGC&#45;3'), Asp072 (F: 5'&#45;TGTATATTGGTGCCCCGTTT&#45;3', R: 5'&#45;AACTGGTCGCTCAGAGGAAA&#45;3'), and Asp168 (F: 5'&#45;TGCCATTACAGAAAGCCAGA&#45;3', R: 5'&#45;AACGCAGCTTTTGCCATATC&#45;3'). Sixteen of the Moyer et al. loci were monomorphic in this sample, but they may yet be useful in other populations of <i>A. tropicus.</i> These loci were Asp010, Asp012, Asp016, Asp029, <i>Asp035,</i> Asp040, Asp046, Asp046b, Asp054, Asp057, Asp096, Asp108, Asp109, Asp116, Asp122, and Asp324. The loci that did not successfully amplify in <i>A. tropicus</i> were Asp004, Asp019, Asp023, Asp031, Asp058, Asp302, <i>Asp</i>339, and <i>Asp</i>341.</font></p>  	    <p align="justify"><font face="verdana" size="2">In total, 25 microsatellite loci were successfully amplified in <i>A. tropicus.</i> Nine of these loci are known to be polymorphic, and the remaining 16 also have the potential to be useful molecular markers across a wider range of <i>A. tropicus</i> populations. Hopefully, these tools will enable a greater understanding of <i>A. tropicus</i> population structure and be useful in broodstock management.</font></p>  	    <p align="justify"><font face="verdana" size="2">Some of the equipment used in this study was partially funded by MSINBRE P20RR016476. We thank Kevin Feldheim who performed the original isolation of the microsatellite loci. That work was carried out in the Field Museum's Pritzker Laboratory for Molecular Systematics and Evolution operated with support from the Pritzker Foundation. We thank the Ministerio de Medio Ambiente y Recursos Naturales from El Salvador for issuing collecting permits (to W.M. and C.M.). The Salvadoran forest guards Jos&eacute; Antonio Villedas, Juan Francisco Garc&iacute;a, Jos&eacute; Alejo L&oacute;pez and Juan Alberto P&eacute;rez provided support in the field. We would also like to thank the editor and 2 anonymous reviewers for their assistance.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Literature cited</b></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Aguilera, C., R. Mendoza, G. Rodr&iacute;guez and G. M&aacute;rquez. 2002. Morphological description of alligator gar and tropical gar larvae, with an emphasis on growth indicators. Transactions of the American Fisheries Society 131:899&#45;909.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602789&pid=S1870-3453201300040003500001&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Alfaro, R. M., C. A. Gonz&aacute;lez and A. M. Ferrara. 2008. Gar biology and culture: status and prospects. Aquaculture Research 39:748&#45;763.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602791&pid=S1870-3453201300040003500002&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Barrientos&#45;Villalobos, J. and A. Espinosa&#45;de los Monteros. 2008. Genetic variation and recent population history of the tropical gar <i>Atractosteus tropicus</i> Gill (Pisces: Lepisosteidae). Journal of Fish Biology 73:1919&#45;1936.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602793&pid=S1870-3453201300040003500003&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Holman, J., L. A.V&#248;llestad, K. S. Jakobsen and C. R. Primmer. 2005. Cross&#45;species amplification of zebrafish and central stoneroller microsatellite loci in six other cyprinids. Journal of Fish Biology 66:851&#45;859.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602795&pid=S1870-3453201300040003500004&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Kalinowski, S. T., M. L. Taper and T. C. Marshall. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16:1099&#45;1006.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602797&pid=S1870-3453201300040003500005&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Mendoza, R., C. Aguilera, J. Montemayor, A. Revol and J. Holt. 2002. Studies on the physiology of <i>Atractosteus spatula</i> larval development and its applications to early weaning onto artificial diets. <i>In</i> Avances en nutrici&oacute;n acu&iacute;cola VI. Memorias del VI Simposium Internacional de Nutrici&oacute;n Acu&iacute;cola. 3 al 6 de Septiembre del 2002. L. E. Cruz&#45;Su&aacute;rez, D. Ricque&#45;Marie, M. Tapia&#45;Salazar, M. G. Gaxiola&#45;Cort&eacute;s and N. Simoes. (eds.). Canc&uacute;n, Quintana Roo, M&eacute;xico. p. 197&#45;226.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602799&pid=S1870-3453201300040003500006&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Miller, S. A., D. D. Dykes and H. F. Polesky. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research 16:1215.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602801&pid=S1870-3453201300040003500007&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Mora&#45;Jamett, M., J. Cabrera&#45;Pe&ntilde;a and G. Galeano. 1997. Reproducci&oacute;n y alimentaci&oacute;n del gaspar <i>Atractosteus tropicus</i> (Pisces: Lepisosteidae) en el Refugio Nacional de Vida Silvestre Ca&ntilde;o Negro, Costa Rica. Revista de Biolog&iacute;a Tropical 45:861&#45;866.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602803&pid=S1870-3453201300040003500008&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Moyer, G. R., B. L. Sloss, B. R. Kreiser and K. A. Feldheim. 2009. Isolation and characterization of microsatellite loci for alligator gar <i>(Atractosteus spatula)</i> and their variability in two other species <i>(Lepisosteusoculatus</i> and <i>L. osseus)</i> of Lepisosteidae. Molecular Ecology Research 9:963&#45;966.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602805&pid=S1870-3453201300040003500009&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Raymond, M. and F. Rousset. 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86:248&#45;249.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602807&pid=S1870-3453201300040003500010&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Rice, W. R. 1989. Analyzing tables of statistical tests. Evolution 43:223&#45;225.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602809&pid=S1870-3453201300040003500011&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Selkoe, K. A. and R. J. Toonen. 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecology Letters 9:615&#45;629.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602811&pid=S1870-3453201300040003500012&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills and P. Shipley. 2004. Micro&#45;checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4:535&#45;538.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=7602813&pid=S1870-3453201300040003500013&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>      ]]></body><back>
<ref-list>
<ref id="B1">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Aguilera]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Mendoza]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[Rodríguez]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
<name>
<surname><![CDATA[Márquez]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Morphological description of alligator gar and tropical gar larvae, with an emphasis on growth indicators]]></article-title>
<source><![CDATA[Transactions of the American Fisheries Society]]></source>
<year>2002</year>
<volume>131</volume>
<page-range>899-909</page-range></nlm-citation>
</ref>
<ref id="B2">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Alfaro]]></surname>
<given-names><![CDATA[R. M.]]></given-names>
</name>
<name>
<surname><![CDATA[González]]></surname>
<given-names><![CDATA[C. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Ferrara]]></surname>
<given-names><![CDATA[A. M.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Gar biology and culture: status and prospects]]></article-title>
<source><![CDATA[Aquaculture Research]]></source>
<year>2008</year>
<volume>39</volume>
<page-range>748-763</page-range></nlm-citation>
</ref>
<ref id="B3">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Barrientos-Villalobos]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Espinosa-de los Monteros]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Genetic variation and recent population history of the tropical gar Atractosteus tropicus Gill (Pisces: Lepisosteidae)]]></article-title>
<source><![CDATA[Journal of Fish Biology]]></source>
<year>2008</year>
<volume>73</volume>
<page-range>1919-1936</page-range></nlm-citation>
</ref>
<ref id="B4">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Holman]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Vøllestad]]></surname>
<given-names><![CDATA[L. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Jakobsen]]></surname>
<given-names><![CDATA[K. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Primmer]]></surname>
<given-names><![CDATA[C. R.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Cross-species amplification of zebrafish and central stoneroller microsatellite loci in six other cyprinids]]></article-title>
<source><![CDATA[Journal of Fish Biology]]></source>
<year>2005</year>
<volume>66</volume>
<page-range>851-859</page-range></nlm-citation>
</ref>
<ref id="B5">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Kalinowski]]></surname>
<given-names><![CDATA[S. T.]]></given-names>
</name>
<name>
<surname><![CDATA[Taper]]></surname>
<given-names><![CDATA[M. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Marshall]]></surname>
<given-names><![CDATA[T. C.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment]]></article-title>
<source><![CDATA[Molecular Ecology]]></source>
<year>2007</year>
<volume>16</volume>
<page-range>1099-1006</page-range></nlm-citation>
</ref>
<ref id="B6">
<nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Mendoza]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[Aguilera]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Montemayor]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Revol]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[Holt]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Studies on the physiology of Atractosteus spatula larval development and its applications to early weaning onto artificial diets]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Cruz-Suárez]]></surname>
<given-names><![CDATA[L. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Ricque-Marie]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[Tapia-Salazar]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Gaxiola-Cortés]]></surname>
<given-names><![CDATA[M. G.]]></given-names>
</name>
<name>
<surname><![CDATA[Simoes.]]></surname>
<given-names><![CDATA[N.]]></given-names>
</name>
</person-group>
<source><![CDATA[Avances en nutrición acuícola VI]]></source>
<year>2002</year>
<page-range>197-226</page-range><publisher-loc><![CDATA[Cancún^eQuintana Roo Quintana Roo]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B7">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Miller]]></surname>
<given-names><![CDATA[S. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Dykes]]></surname>
<given-names><![CDATA[D. D.]]></given-names>
</name>
<name>
<surname><![CDATA[Polesky]]></surname>
<given-names><![CDATA[H. F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A simple salting out procedure for extracting DNA from human nucleated cells]]></article-title>
<source><![CDATA[Nucleic Acids Research]]></source>
<year>1988</year>
<volume>16</volume>
<page-range>1215</page-range></nlm-citation>
</ref>
<ref id="B8">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Mora-Jamett]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Cabrera-Peña]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Galeano]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Reproducción y alimentación del gaspar Atractosteus tropicus (Pisces: Lepisosteidae) en el Refugio Nacional de Vida Silvestre Caño Negro, Costa Rica]]></article-title>
<source><![CDATA[Revista de Biología Tropical]]></source>
<year>1997</year>
<volume>45</volume>
<page-range>861-866</page-range></nlm-citation>
</ref>
<ref id="B9">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Moyer]]></surname>
<given-names><![CDATA[G. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Sloss]]></surname>
<given-names><![CDATA[B. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Kreiser]]></surname>
<given-names><![CDATA[B. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Feldheim]]></surname>
<given-names><![CDATA[K. A.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Isolation and characterization of microsatellite loci for alligator gar (Atractosteus spatula) and their variability in two other species (Lepisosteusoculatus and L. osseus) of Lepisosteidae]]></article-title>
<source><![CDATA[Molecular Ecology Research]]></source>
<year>2009</year>
<volume>9</volume>
<page-range>963-966</page-range></nlm-citation>
</ref>
<ref id="B10">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Raymond]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Rousset]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism]]></article-title>
<source><![CDATA[Journal of Heredity]]></source>
<year>1995</year>
<volume>86</volume>
<page-range>248-249</page-range></nlm-citation>
</ref>
<ref id="B11">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Rice]]></surname>
<given-names><![CDATA[W. R]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Analyzing tables of statistical tests]]></article-title>
<source><![CDATA[Evolution]]></source>
<year>1989</year>
<volume>43</volume>
<page-range>223-225</page-range></nlm-citation>
</ref>
<ref id="B12">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Selkoe]]></surname>
<given-names><![CDATA[K. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Toonen]]></surname>
<given-names><![CDATA[R. J.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers]]></article-title>
<source><![CDATA[Ecology Letters]]></source>
<year>2006</year>
<volume>9</volume>
<page-range>615-629</page-range></nlm-citation>
</ref>
<ref id="B13">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Van Oosterhout]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Hutchinson]]></surname>
<given-names><![CDATA[W. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Wills]]></surname>
<given-names><![CDATA[D. P. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Shipley]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Micro-checker: software for identifying and correcting genotyping errors in microsatellite data]]></article-title>
<source><![CDATA[Molecular Ecology Notes]]></source>
<year>2004</year>
<volume>4</volume>
<page-range>535-538</page-range></nlm-citation>
</ref>
</ref-list>
</back>
</article>
