<?xml version="1.0" encoding="ISO-8859-1"?><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id>1405-3195</journal-id>
<journal-title><![CDATA[Agrociencia]]></journal-title>
<abbrev-journal-title><![CDATA[Agrociencia]]></abbrev-journal-title>
<issn>1405-3195</issn>
<publisher>
<publisher-name><![CDATA[Colegio de Postgraduados]]></publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id>S1405-31952015000100005</article-id>
<title-group>
<article-title xml:lang="en"><![CDATA[Expression of hydroxymethylglutaryl-coa reductase 2 (HMG2) gene in chilli (Capsicum annuum L.) CM334 infected by Nacobbus aberrans and Phytophthora capsici]]></article-title>
<article-title xml:lang="es"><![CDATA[Expresión del gen HMG2 (hidroximetilglutaril-coa reductasa 2) en chile (Capsicum annuum L.) CM334 infectado por Nacobbus aberrans y Phytophthora capsici]]></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Villar-Luna]]></surname>
<given-names><![CDATA[Edgar]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Rojas-Martínez]]></surname>
<given-names><![CDATA[Reyna I.]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Reyes-Trejo]]></surname>
<given-names><![CDATA[Benito]]></given-names>
</name>
<xref ref-type="aff" rid="A02"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Rocha-Sosa]]></surname>
<given-names><![CDATA[Mario]]></given-names>
</name>
<xref ref-type="aff" rid="A03"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Zavaleta-Mejía]]></surname>
<given-names><![CDATA[Emma]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
</contrib-group>
<aff id="A01">
<institution><![CDATA[,Colegio de Postgraduados Fitopatología ]]></institution>
<addr-line><![CDATA[Montecillo Estado de México]]></addr-line>
<country>México</country>
</aff>
<aff id="A02">
<institution><![CDATA[,Universidad Autónoma Chapingo Área de Química Laboratorio de Productos Naturales]]></institution>
<addr-line><![CDATA[Chapingo Estado de México]]></addr-line>
<country>México</country>
</aff>
<aff id="A03">
<institution><![CDATA[,Universidad Nacional Autónoma de México Instituto de Biotecnología Departamento de Biología Molecular de Plantas]]></institution>
<addr-line><![CDATA[Cuernavaca Morelos]]></addr-line>
<country>México</country>
</aff>
<pub-date pub-type="pub">
<day>00</day>
<month>02</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="epub">
<day>00</day>
<month>02</month>
<year>2015</year>
</pub-date>
<volume>49</volume>
<numero>1</numero>
<fpage>69</fpage>
<lpage>75</lpage>
<copyright-statement/>
<copyright-year/>
<self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S1405-31952015000100005&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_abstract&amp;pid=S1405-31952015000100005&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_pdf&amp;pid=S1405-31952015000100005&amp;lng=en&amp;nrm=iso"></self-uri><abstract abstract-type="short" xml:lang="en"><p><![CDATA[Plants of chilli Capsicum annuum L. CM334 show a high level of resistance to Phytophthora capsici, but are susceptible to Nacobbus aberrans; such resistance has been associated with capsidiol accumulation, a sesquiterpene phytoalexin. In the present study the expression of hydroxymethylglutaryl-CoA reductase 2 gene (HMG2, associated with sesquiterpene phytoalexins biosynthesis) in CM334 chilli roots inoculated with N. aberrans and in combination with P. capsici, was determined by qRT-PCR. The levels of HMG2 transcripts were significantly reduced (p&#8804;0.05) from -1.57 to -1.28-fold in the interaction CM334/N. aberrans; whereas in roots inoculated only with the oomycete, the accumulation of transcripts occurred earlier and at higher levels (1.52 to 3.54-fold). In plants inoculated with both pathogens, the expression was higher compared with those inoculated with the nematode only (p&#8804;0.05), but generally lower than the expression observed in roots of plants inoculated with the oomycete alone. The expression of the HMG2 gene associated with defense was reduced in CM334 chilli plants infected by N. aberrans.]]></p></abstract>
<abstract abstract-type="short" xml:lang="es"><p><![CDATA[Plantas de chile Capsicum annuum L. CM334 exhiben un alto grado de resistencia a Phytophthora capsici, pero son susceptibles a Nacobbus aberrans; tal resistencia se ha asociado con la acumulación de capsidiol, una fitoalexina sesquiterpé-nica. En el presente estudio se determinó mediante qRT-PCR los niveles de expresión del gen HMG2 (hidroximetilglutaril-CoA reductasa 2, asociado con la biosíntesis de fitoalexinas sesquiterpénicas) en raíces de chile CM334 inoculadas con N. aberrans y en combinación con P. capsici. Los niveles de transcritos de HMG2 fueron significativamente reducidos (p&#8804;0.05) de -1.57 a -1.28 veces en la interacción CM334/N. aberrans; mientras que en raíces inoculadas sólo con el oomiceto la acumulación de transcritos fue temprana e intensa (1.52 a 3.54 veces). En plantas inoculadas con ambos patógenos, la expresión fue alta comparada con aquellas inoculadas sólo con el nematodo (p&#8804;0.05), pero generalmente menor que la expresión observada en raíces inoculadas sólo con el oomiceto. La expresión del gen HMG2 (asociado con defensa) fue reducida en raíces de chile CM334 infectadas por N. aberrans.]]></p></abstract>
<kwd-group>
<kwd lng="en"><![CDATA[Capsicum annuum]]></kwd>
<kwd lng="en"><![CDATA[capsidiol]]></kwd>
<kwd lng="en"><![CDATA[real-time PCR]]></kwd>
<kwd lng="en"><![CDATA[root-knot nematodes]]></kwd>
<kwd lng="es"><![CDATA[Capsicum annuum]]></kwd>
<kwd lng="es"><![CDATA[capsidiol]]></kwd>
<kwd lng="es"><![CDATA[PCR en tiempo real]]></kwd>
<kwd lng="es"><![CDATA[nematodos agalladores]]></kwd>
</kwd-group>
</article-meta>
</front><body><![CDATA[  	    <p align="justify"><font face="verdana" size="4">Protecci&oacute;n vegetal</font></p>  	    <p>&nbsp;</p>  	    <p align="center"><font face="verdana" size="4"><b>Expression of hydroxymethylglutaryl&#45;coa reductase 2 (<i>HMG2</i>) gene in chilli <i>(Capsicum annuum</i> L.) CM334 infected by <i>Nacobbus aberrans</i> and <i>Phytophthora capsici</i></b></font></p>  	    <p>&nbsp;</p>  	    <p align="center"><font face="verdana" size="3"><b>Expresi&oacute;n del gen <i>HMG2</i> (hidroximetilglutaril&#45;coa reductasa 2) en chile <i>(Capsicum annuum</i> L.) CM334 infectado por <i>Nacobbus aberrans</i> y <i>Phytophthora capsici</i></b></font></p>  	    <p>&nbsp;</p>  	    <p align="center"><font face="verdana" size="2"><b>Edgar Villar&#45;Luna<sup>1</sup>, Reyna I. Rojas&#45;Mart&iacute;nez<sup>1</sup>, Benito Reyes&#45;Trejo<sup>2</sup>, Mario Rocha&#45;Sosa<sup>3</sup>, Emma Zavaleta&#45;Mej&iacute;a<sup>1*</sup></b></font></p>  	    <p>&nbsp;</p>  	    <p align="justify"><font face="verdana" size="2"><sup><i>1</i></sup> <i>Fitopatolog&iacute;a. Campus Montecillo. Colegio de Postgraduados. 56230. Montecillo, Estado de M&eacute;xico * Author for correspondence</i> (<a href="mailto:zavaleta@colpos.mx">zavaleta@colpos.mx</a>).</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><sup><i>2</i></sup> <i>Laboratorio de Productos Naturales. &Aacute;rea de Qu&iacute;mica. Universidad Aut&oacute;noma Chapingo. 56230. Chapingo, Estado de M&eacute;xico.</i></font></p>  	    <p align="justify"><font face="verdana" size="2"><i><sup>3</sup> Departamento de Biolog&iacute;a Molecular de Plantas. Instituto de Biotecnolog&iacute;a. Universidad Nacional Aut&oacute;noma de M&eacute;xico. Avenida Universidad 2001, Apartado Postal 510&#45;3. 62210. Cuernavaca, Morelos.</i></font></p>  	    <p>&nbsp;</p>  	    <p align="justify"><font face="verdana" size="2">Recibido: abril, 2014.    <br> 	Aprobado: diciembre, 2014.</font></p>  	    <p>&nbsp;</p>  	    <p align="justify"><font face="verdana" size="2"><b>Abstract</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Plants of chilli <i>Capsicum annuum</i> L. CM334 show a high level of resistance to <i>Phytophthora capsici,</i> but are susceptible to <i>Nacobbus aberrans;</i> such resistance has been associated with capsidiol accumulation, a sesquiterpene phytoalexin. In the present study the expression of hydroxymethylglutaryl&#45;CoA reductase 2 gene <i>(HMG2,</i> associated with sesquiterpene phytoalexins biosynthesis) in CM334 chilli roots inoculated with <i>N. aberrans</i> and in combination with <i>P. capsici,</i> was determined by qRT&#45;PCR. The levels of HMG2 transcripts were significantly reduced (p&le;0.05) from &#45;1.57 to &#45;1.28&#45;fold in the interaction CM334<i>/N</i>. <i>aberrans</i>; whereas in roots inoculated only with the oomycete, the accumulation of transcripts occurred earlier and at higher levels (1.52 to 3.54&#45;fold). In plants inoculated with both pathogens, the expression was higher compared with those inoculated with the nematode only (p&le;0.05), but generally lower than the expression observed in roots of plants inoculated with the oomycete alone. The expression of the HMG2 gene associated with defense was reduced in CM334 chilli plants infected by <i>N. aberrans.</i></font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Key words:</b> <i>Capsicum annuum,</i> capsidiol, real&#45;time PCR, root&#45;knot nematodes.</font></p>  	    <p>&nbsp;</p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>Resumen</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Plantas de chile <i>Capsicum annuum</i> L. CM334 exhiben un alto grado de resistencia a <i>Phytophthora capsici,</i> pero son susceptibles a <i>Nacobbus aberrans;</i> tal resistencia se ha asociado con la acumulaci&oacute;n de capsidiol, una fitoalexina sesquiterp&eacute;&#45;nica. En el presente estudio se determin&oacute; mediante qRT&#45;PCR los niveles de expresi&oacute;n del gen <i>HMG2</i> (hidroximetilglutaril&#45;CoA reductasa 2, asociado con la bios&iacute;ntesis de fitoalexinas sesquiterp&eacute;nicas) en ra&iacute;ces de chile CM334 inoculadas con <i>N. aberrans</i> y en combinaci&oacute;n con <i>P. capsici.</i> Los niveles de transcritos de <i>HMG2</i> fueron significativamente reducidos (p&le;0.05) de &#45;1.57 a &#45;1.28 veces en la interacci&oacute;n CM334/<i>N. aberrans;</i> mientras que en ra&iacute;ces inoculadas s&oacute;lo con el oomiceto la acumulaci&oacute;n de transcritos fue temprana e intensa (1.52 a 3.54 veces). En plantas inoculadas con ambos pat&oacute;genos, la expresi&oacute;n fue alta comparada con aquellas inoculadas s&oacute;lo con el nematodo (p&le;0.05), pero generalmente menor que la expresi&oacute;n observada en ra&iacute;ces inoculadas s&oacute;lo con el oomiceto. La expresi&oacute;n del gen <i>HMG2</i> (asociado con defensa) fue reducida en ra&iacute;ces de chile CM334 infectadas por <i>N. aberrans.</i></font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Palabras clave:</b> <i>Capsicum annuum,</i> capsidiol, PCR en tiempo real, nematodos agalladores.</font></p>  	    <p>&nbsp;</p>  	    <p align="justify"><font face="verdana" size="2"><b>INTRODUCTION</b></font></p>  	    <p align="justify"><font face="verdana" size="2">The oomycete <i>Phytophthora capsici</i> Leonian limits the production of chilli pepper <i>(Capsicum annuum</i> L.) worldwide (Erwin and Ribeiro, 1996) in the field and greenhouse. The use of genotypes resistant to the oomycete is an economic and environmentally friendly strategy for disease management. The landrace Criollo de Morelos 334 (CM334) displays a high level of resistance to multiple isolates of <i>P. capsici,</i> which is expressed as a hypersensitive response in root, stem and foliage (Candela <i>etal.,</i> 2000; Ueeda <i>et al.,</i> 2006).</font></p>  	    <p align="justify"><font face="verdana" size="2">Plant defense mechanisms commonly involve the transcriptional activation of several defense&#45;related genes; such activation leads to the <i>de novo</i> synthesis of a variety of proteins and antimicrobial compounds. In chilli plants, defense&#45;related genes <i>HMG2</i> (hydroxymethylglutaryl&#45;CoA reductase), <i>SC</i> (sesquiterpene cyclase) and <i>EAS</i> (5&#45;epiaristolochene synthase), which are involved in the biosynthesis of sesquiterpenic phytoalexins such as capsidiol, are over&#45;expressed in response to attack by <i>P. capsici</i> (Ha <i>et al.,</i> 2003; Silvar <i>et al.,</i> 2008; Fern&aacute;ndez&#45;Herrera <i>et al.,</i> 2012).</font></p>  	    <p align="justify"><font face="verdana" size="2">The hydroxymethylglutaryl&#45;CoA reductase (HMGR) catalyzes the mevalonate synthesis, is encoded by a multigene family that in <i>C. annuum</i> includes <i>HMG1, HMG2,</i> and <i>HMG3</i> (Ha <i>et al.,</i> 2003). In plants, these genes are differentially regulated and lead to the biosynthesis of different types of isoprenoids; thus, in <i>Arabidopsis thaliana,</i> the expression of <i>HMG1</i> and <i>HMG2</i> is associated with sterols and triterpenes biosynthesis (Ohyama <i>et al.,</i> 2007). Also, in <i>Solanum tuberosum HMG1</i> is associated with sterol biosynthesis, whereas <i>HMG2</i> and <i>HMG3</i> are involved in sesquiterpene phytoalexins biosynthesis in response to attacks by pathogens (Choi <i>et al.,</i> 1992).</font></p>  	    <p align="justify"><font face="verdana" size="2">Even though CM334 is highly resistant to the oomycete, the plants show susceptibility when they were previously infected by the nematode <i>Nacobbus aberrans</i> Thorne and Allen, 1944 (Trujillo&#45;Viramontes <i>et al.,</i> 2005). This phenomenon is associated with transcriptional and metabolic changes induced by the nematode in the root, including those pathways involved in defense (L&oacute;pez&#45;Mart&iacute;nez <i>et al.,</i> 2011; Fern&aacute;ndez&#45;Herrera <i>et al.,</i> 2012). In susceptible hosts, root&#45;knot nematodes induce the formation of specialized feeding sites (SFS), a process that involves the down&#45;regulation and up&#45;regulation of genes. For instance, in the interaction <i>Meloidogyne incognita/A. thaliana,</i> genes involved in jasmonic acid/ethylene&#45;dependent defense pathways and those involved in the synthesis of compounds with antimicrobial potential were down&#45;regulated locally; in contrast, those related to the differentiation and maintenance of the SFS were up&#45;regulated (Jammes <i>et al.,</i> 2005). In CM334 chilli roots infected by <i>N. aberrans</i> and inoculated with <i>P. capsici,</i> there was a delay in <i>EAS</i> transcripts accumulation in comparison to those inoculated only with the oomycete; this event was related to a reduced accumulation of capsidiol (Fern&aacute;ndez&#45;Herrera <i>et al.,</i> 2012). Based on this background, it is feasible to speculate that a reduction in the expression of defense&#45;related genes could facilitate the establishment and successful reproduction of <i>N. aberrans</i> in CM334 plants, conditions that could be favorable for the infection by <i>P. capsici.</i> To contribute to the knowledge about the transcriptional changes induced during the complex interactions between the sedentary plant parasitic nematodes and their host plants, the aim of the present study was to determine the transcripts accumulation of the <i>HMG2</i> gene in CM334 plants roots inoculated with <i>N. aberrans</i> alone and in combination with <i>P. capsici.</i></font></p>  	    <p>&nbsp;</p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>MATERIALS AND METHODS</b></font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Chilli plants and inoculation with <i>N. aberrans</i> and <i>P. capsici</i></b></font></p>  	    <p align="justify"><font face="verdana" size="2">CM334 chilli plants were grown singly into pots containing 25 cm<sup>3</sup> of sterile sand. The inoculum preparation, inoculation and time of inoculation were according to Fernandez&#45;Herrera <i>et al.</i> (2012).</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Assay establishment</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Treatments were: 1) non&#45;inoculated CM334 plants (control); 2) CM334 plants inoculated with <i>P. capsici (Pc,</i> 300 000 zoospores per plant); 3) CM334 plants inoculated with <i>N. aberrans (N,</i> 2000 second&#45;stage juveniles, J<sub>2</sub>); 4) CM334 plants inoculated with both pathogens (<i>NPc</i>); each treatment had 45 plants. At 6, 12 and 24 h after inoculation with the oomycete (haio), for each treatment and time the roots of 15 plants were frozen with liquid nitrogen and stored at &#45;80 &deg;C. The experiment was repeated once.</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>RNA extraction, cDNA synthesis and real&#45;time PCR</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Total RNA was extracted from frozen root tissues using the RNeasy<sup>TM</sup> Plant mini kit and including a DNase treatment (Qiagen) following the manufacturer's instructions. The purity and integrity of RNA was verified by spectrophotometry (ND&#45;1000, Nanodrop Technologies) (Thermo Scientific, USA) and by 1.2 % denaturing agarose gel electrophoresis, respectively. First&#45;strand cDNA was synthesized from 2 &micro;g of total RNA using the oligo(dT<sub>15</sub> primer (Promega) and M&#45;MLV reverse transcriptase (Promega) according to manufacturer's instructions.</font></p>  	    <p align="justify"><font face="verdana" size="2">The expression levels of <i>HMG2</i> gene (AF110383) were determined by real&#45;time PCR in the ABI7500<sup>TM</sup> system (Applied Biosystems) using the following primers: 5'&#45;ATTACCTTCAGAATGAATACGCT&#45;3' (forward) y 5'&#45;CTCTCTATGTTTTGTGCTGGGT&#45;3' (reverse). The reaction mixture consisted of buffer 10X, 1.5 mM MgCl<sub>2</sub>, 0.4 <i>&micro;</i>M of each primer, 0.2 mM dNTPs, amplificase (Biotecmol), SYBR<sup>TM</sup> Green I (1: 75000) (Molecular Probes, Eugene, OR) as the reporter fluorophore, 10 nM fluorescein as passive reference, 2 <i>&micro;</i>L cDNA, and nuclease&#45;free water were added to a final volume of 25 <i>&micro;</i>L. Amplification conditions consisted of an initial denaturation at 95 &deg;C for 3 min, followed by 30 cycles at 95 &deg;C for 15 s, annealing at 60 &deg;C for 35 s, and extension at 72 &deg;C for 35 s; the data were collected during the extension step. Dissociation curve analysis was performed to rule out amplification of non&#45;specific products. Six technical replicates were performed for each treatment and each time. Glyceraldehyde&#45;3&#45;phosphate dehydrogenase gene (AJ246011) &#91;5'&#45;GGCCTTATGACTACAGTTCACTCC&#45;3' (forward) y 5'&#45;GATCAACCACAGAGACATCCACAG&#45;3' (reverse)&#93; was used as internal reference to normalize expression level, and control plants to calibrate expression levels of <i>HMG2</i> gene, which was expressed as fold&#45;change due to treatment in relation to the transcript basal levels in control plants (1x). Relative expression was calculated using the 2<sup>&#45;&#916;&#916;Ct</sup> method (Schmittgen and Livak, 2008). PCR products were purified with QIAquick<sup>TM</sup> PCR purification Kit (Qiagen) according to the manufacturer's instructions and sequenced to confirm their identity.</font></p>  	    <p align="justify"><font face="verdana" size="2">An ANOVA was performed with the data (fold&#45;change), the experimental design was completely randomized, and when significant differences were detected, the means of treatments were compared using Tukey's test (p&le;0.05). These procedures were performed in SAS version 9.0 (SAS Institute Inc., 2002).</font></p>  	    <p>&nbsp;</p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>RESULTS AND DISCUSSION</b></font></p>  	    <p align="justify"><font face="verdana" size="2">At all times, the <i>HMG2</i> transcript levels were significantly reduced (p&le;0.05) from &#45;1.57 to &#45;1.28&#45;fold, in CM334 plant roots infected by <i>N. aberrans</i> alone <i>(N</i> treatment) and they were below the basal expression in control plants (<a href="#f1">Figure 1</a>). In contrast, plant roots inoculated with <i>P. capsic</i>i only <i>(Pc</i> treatment) showed the highest levels of expression (1.52 to 3.54&#45;fold) (p&le;0.05); in this incompatible interaction (CM334&#45;P <i>capsici),</i> the maximum expression of the gene was observed at 6 haio (3.54&#45;fold) and then decreased.</font></p>  	    <p align="center"><font face="verdana" size="2"><a name="f1"></a></font></p>  	    <p align="center"><font face="verdana" size="2"><img src="/img/revistas/agro/v49n1/a5f1.jpg"></font></p>  	    <p align="justify"><font face="verdana" size="2">At 6 and 12 haio the transcript levels were reduced by 1.30 to 2.44&#45;fold (p&le;0.05) in plants inoculated with both pathogens (<i>NPc</i> treatment) as compared to those in plants of the <i>Pc</i> treatment (1.52 to 3.54&#45;fold), but at 24 haio the reduction was not significant in comparison to the plants inoculated with the oomycete alone. In plants of the <i>NPc</i> treatment there was a delay in the expression of the gene, as the maximum expression of <i>HMG2</i> was observed until the 12 haio (2.44&#45;fold) and decreased at 24 haio (<a href="#f1">Figure 1</a>).</font></p>  	    <p align="justify"><font face="verdana" size="2">The hydroxymethylglutaryl&#45;CoA reductase (HMGR) catalyzes the first committed step of the mevalonate pathway for phytosterol and sesquiterpene biosynthesis; in plants, it is encoded by <i>HMG</i> genes, a multigene family that in <i>C. annuum</i> L. includes <i>HMGI, HMG2,</i> and <i>HMG3</i> (Ha <i>et al.,</i> 2003). These genes are differentially expressed during plant development and in response to pathogens or other stresses, for this particularity, HMGR is critical in the metabolic channeling of pathway intermediates towards specific end products, such as phytosterol and sesquiterpene metabolites, these last with antimicrobial properties (Weissenborn <i>et al.,</i> 1995). In the present study, CM334 chilli plants of the <i>Pc</i> treatment, generally exhibited high levels of <i>HMG2</i> transcripts. This result is consistent with that reported by Ha <i>et al.</i> (2003), who also found that increased expression of <i>HMG2</i> was related with a strong expression of <i>SC</i> gene (sesquiterpene cyclase) in <i>C. annuum</i> cv. NocKwang inoculated with <i>P. capsici;</i> these researchers suggest that the coordinated regulation of both genes could be related with sesquiterpene phytoalexin accumulation in response to the infection. At 6 haio was evident that plants of the <i>NPc</i> treatment, had lower accumulation of <i>HMG2</i> transcripts compared to <i>Pc</i> treatment, whereas in plants infected by the nematode alone, the levels recorded were lowest. This behavior was expected, since <i>N. aberrans</i> establishes a compatible interaction with chilli CM334. In several genotypes of chilli pepper, including CM334, the sesquiterpene phytoalexin capsidiol is associated with resistance to <i>P. capsici</i> (Candela <i>et al.,</i> 2000), and capsidiol is also toxic to <i>N. aberrans</i> (God&iacute;nez&#45;Vidal <i>et al.,</i> 2010). These reports indicate that changes in gene&#45;expression patterns of <i>HMG2</i> might consequently result in a reduced accumulation of sesquiterpene phytoalexins such as capsidiol, which in turn could promote the establishment and successful reproduction of <i>N. aberrans</i> and <i>P. capsici</i> in chilli CM334.</font></p>  	    <p align="justify"><font face="verdana" size="2">Like <i>Meloidogyne, Heterodera,</i> and <i>Globodera</i> species, <i>N. aberrans</i> induces the formation of specialized feeding sites (SFS) to obtain essential nutrients for its development and reproduction (Manzanilla&#45;L&oacute;pez <i>et al.,</i> 2002). Morphological changes in host root cells during the differentiation of these sites (giant cells or syncytia) are accompanied by drastic alteration in gene&#45;expression patterns, inducing profound modifications in normal metabolism (Jammes <i>et al.,</i> 2005). Down&#45;regulation of genes involved in jasmonic acid/ethylene&#45;dependent defense pathways, and also those involved in the synthesis of antimicrobial compounds, was reported in compatible plant&#45;nematode interactions; in contrast, those related to the differentiation and maintenance of the SFS are up&#45;regulated (Jammes <i>et al.,</i> 2005). For instance, <i>Heterodera glycines</i> reduced the expression of <i>OPR1</i> and <i>OPR2</i> genes related to the jasmonic acid biosynthesis in a susceptible cultivar of <i>Glycine max</i> (Ithal <i>et al,</i> 2007). The down&#45;regulation of defense genes that encode for pathogenesis&#45;related proteins (PRs) and for WRKY transcription factors was reported by Jammes <i>et al.</i> (2005) in other compatible interactions, such as <i>A. thaliana&#45;M. incognita.</i></font></p>  	    <p>&nbsp;</p>  	    <p align="justify"><font face="verdana" size="2"><b>CONCLUSIONS</b></font></p>  	    <p align="justify"><font face="verdana" size="2"><i>Nacobbus aberrans</i> reduced the expression of <i>HMG2</i> gene and such reduction was of greater magnitude when CM334 plants were infected only with the nematode in comparison to those inoculated with the two pathogens, <i>N. aberrans</i> and <i>P. capsici</i> or <i>P. capsici.</i></font></p>  	    ]]></body>
<body><![CDATA[<p>&nbsp;</p>  	    <p align="justify"><font face="verdana" size="2"><b>ACKNOWLEDGMENTS</b></font></p>  	    <p align="justify"><font face="verdana" size="2">We thank the National Council on Science and Technology (CONACYT) for the scholarship granted to the first author and the financial support for the development of this investigation (Project 46331 Z&#45;CONACYT) and Dr. Rosa Luisa Santill&aacute;n&#45;Baca for reviewing the manuscript.</font></p>  	    <p>&nbsp;</p>  	    <p align="justify"><font face="verdana" size="2"><b>LITERATURE CITED</b></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Candela, M. E., C. Egea, M. D. Garc&iacute;a&#45;P&eacute;rez, J. Costa, and M. Candela. 2000. Breeding papryka type peppers resistant to <i>Phytophthora capsici.</i> Acta Hortic. 522: 79&#45;86.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596665&pid=S1405-3195201500010000500001&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Choi, D., B. L. Ward, and R. M. Bostock. 1992. Differential induction and suppression of potato 3&#45;Hydroxy&#45;3&#45;Methylglutaryl coenzime A reductase genes in response to <i>Phytophthora infestans</i> and to its elicitor arachidonic acid. Plant Cell 4: 1333&#45;1344.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596667&pid=S1405-3195201500010000500002&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Erwin, D. C., and O. K. Ribeiro. 1996. Phytophthora Diseases Worldwide. The American Phytopathological Society St. Paul, Minnesota. 562 p.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596669&pid=S1405-3195201500010000500003&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Fern&aacute;ndez&#45;Herrera, E., R. I. Rojas&#45;Mart&iacute;nez, L. Guevara&#45;Olvera, M. E. Rivas&#45;D&aacute;vila, E. Valadez&#45;Moctezuma, y E. Zavaleta&#45;Mej&iacute;a. 2012. Defensa en chile CM&#45;334 inoculado con <i>Phytophthora capsici</i> e infectado por <i>Nacobbus aberrans.</i> Nematropica 42: 96&#45;107.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596671&pid=S1405-3195201500010000500004&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">God&iacute;nez&#45;Vidal, D., M. Soto&#45;Hern&aacute;ndez, M. Rocha&#45;Sosa, E. Lozoya&#45;Gloria, R. I. Rojas&#45;Mart&iacute;nez, L. Guevara&#45;Olvera, y E. Zavaleta&#45;Mej&iacute;a. 2010. Contenido de capsidiol en ra&iacute;ces de chile CM&#45;334 infectadas por <i>Nacobbus aberrans</i> y su efecto en juveniles del segundo estadio. Nematropica 40: 227&#45;237.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596673&pid=S1405-3195201500010000500005&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Ha, S. H., J. B. Kim, Y. S. Hwang, and S. W. Lee. 2003. Molecular characterization of three 3&#45;hydroxy&#45;3&#45;methylglutaryl&#45;CoA reductase genes including pathogen&#45;induced <i>Hmg2</i> from pepper <i>(Capsicum annuum).</i> Biochim. Biophys. Acta 1625: 253&#45;260.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596675&pid=S1405-3195201500010000500006&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Ithal, N., J. Recknor, D. Nettleton, T. Maier, T. J. Baum, and M. G. Mitchum. 2007. Developmental transcript profiling of cyst nematode feeding cells in soybean roots. Mol. Plant&#45;Microbe Interact. 20: 510&#45;525.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596677&pid=S1405-3195201500010000500007&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Jammes, F., P. Lecomte, J. A. Engler, F. Bitton, M. L. Martin&#45;Magniette, J. P. Renou, P. Abad, and B. Favery. 2005. Genome&#45;wide expression profiling of the host response to root&#45;knot nematode infection in Arabidopsis. Plant J. 44: 447&#45;458.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596679&pid=S1405-3195201500010000500008&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">L&oacute;pez&#45;Mart&iacute;nez, N., M. T. Colinas&#45;Le&oacute;n, C. B. Pe&ntilde;a&#45;Valdivia, Y. Salinas&#45;Moreno, P. Fuentes&#45;Montiel, M. Biesaga, and E. Zavaleta&#45;Mej&iacute;a. 2011. Alterations in peroxidase activity and phenylpropanoid metabolism induced by <i>Nacobbus aberrans</i> Thorne and Allen, 1944 in chilli <i>(Capsicum annuum</i> L.) CM&#45;334 resistant to <i>Phytophthora capsici</i> Leo. Plant Soil 338: 399&#45;409.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596681&pid=S1405-3195201500010000500009&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Manzanilla&#45;L&oacute;pez, R. H., M. A. Costilla, M. Doucet, J. Franco, R. N. Inserra, P. S. Lehman, I. Cid del Prado&#45;Vera, R. M. Souza, and K. Evans. 2002. The genus <i>Nacobbus</i> Thorne &amp; Allen, 1944 (Nematoda: Pratylenchidae): Systematics, distribution, biology and management. Nematropica 32: 150&#45;227.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596683&pid=S1405-3195201500010000500010&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Ohyama, K., M. Suzuki, K. Masuda, S. Yoshida, and T. Muranaka. 2007. Chemical phenotypes of the <i>hmg1</i> and <i>hmg2</i> mutants of <i>Arabidopsis</i> demonstrate the <i>In&#45;planta</i> role of HMG&#45;CoA reductase in triterpene biosynthesis. Chem. Pharm. Bull. 55: 1518&#45;1521.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596685&pid=S1405-3195201500010000500011&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">SAS Institute Inc. 2002. SAS Procedures Guide, Version 9.0 (Computer program). SAS Institute Inc, Cary, NC.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596687&pid=S1405-3195201500010000500012&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Schmittgen, T. D., and K. J. Livak. 2008. Analyzing real&#45;time PCR data by the comparative CT method. Nat. Protoc. 3: 1101&#45;1108.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596689&pid=S1405-3195201500010000500013&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Silvar, C., F. Merino, and J. D&iacute;az. 2008. Differential activation of defense&#45;related genes in susceptible and resistant pepper cultivars infected with <i>Phytophthora capsici.</i> J. Plant Physiol. 165: 1120&#45;1124.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596691&pid=S1405-3195201500010000500014&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Trujillo&#45;Viramontes, F., E. Zavaleta&#45;Mej&iacute;a, R. I. Rojas&#45;Mart&iacute;nez, y J. R. Lara. 2005. Tiempo de inoculaci&oacute;n y nivel de in&oacute;culo, factores determinantes para el rompimiento de resistencia a <i>Phytophthora capsici</i> inducido por <i>Nacobbus aberrans</i> en chile. Nematropica 35: 37&#45;44.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596693&pid=S1405-3195201500010000500015&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Ueeda, M., M. Kubota, and K. Nishi. 2006. Contribution of jasmonic acid to resistance against Phytopthora blight in <i>Capsicum annuum</i> cv. SCM334. Physiol. Mol. Plant Pathol. 67: 149&#45;154.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596695&pid=S1405-3195201500010000500016&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Weissenborn, D. L., C. J. Denbow, M. Laine, S. S. Lang, Z. Yang, X. Yu, and C. L. Cramer. 1995. HMG&#45;CoA reductase and terpenoid phytoalexins: Molecular specialization within a complex pathway. Physiol. Plant. 93: 393&#45;400.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=596697&pid=S1405-3195201500010000500017&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>      ]]></body><back>
<ref-list>
<ref id="B1">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Candela]]></surname>
<given-names><![CDATA[M. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Egea]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[García-Pérez]]></surname>
<given-names><![CDATA[M. D.]]></given-names>
</name>
<name>
<surname><![CDATA[Costa]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Candela]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Breeding papryka type peppers resistant to Phytophthora capsici]]></article-title>
<source><![CDATA[Acta Hortic.]]></source>
<year>2000</year>
<volume>522</volume>
<page-range>79-86</page-range></nlm-citation>
</ref>
<ref id="B2">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Choi]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[Ward]]></surname>
<given-names><![CDATA[B. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Bostock]]></surname>
<given-names><![CDATA[R. M.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Differential induction and suppression of potato 3-Hydroxy-3-Methylglutaryl coenzime A reductase genes in response to Phytophthora infestans and to its elicitor arachidonic acid]]></article-title>
<source><![CDATA[Plant Cell]]></source>
<year>1992</year>
<volume>4</volume>
<page-range>1333-1344</page-range></nlm-citation>
</ref>
<ref id="B3">
<nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Erwin]]></surname>
<given-names><![CDATA[D. C.]]></given-names>
</name>
<name>
<surname><![CDATA[Ribeiro]]></surname>
<given-names><![CDATA[O. K.]]></given-names>
</name>
</person-group>
<source><![CDATA[Phytophthora Diseases Worldwide]]></source>
<year>1996</year>
<page-range>562</page-range><publisher-loc><![CDATA[St. Paul^eMinnesota Minnesota]]></publisher-loc>
<publisher-name><![CDATA[The American Phytopathological Society]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B4">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Fernández-Herrera]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Rojas-Martínez]]></surname>
<given-names><![CDATA[R. I.]]></given-names>
</name>
<name>
<surname><![CDATA[Guevara-Olvera]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[Rivas-Dávila]]></surname>
<given-names><![CDATA[M. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Valadez-Moctezuma]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Zavaleta-Mejía]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Defensa en chile CM-334 inoculado con Phytophthora capsici e infectado por Nacobbus aberrans]]></article-title>
<source><![CDATA[Nematropica]]></source>
<year>2012</year>
<volume>42</volume>
<page-range>96-107</page-range></nlm-citation>
</ref>
<ref id="B5">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Godínez-Vidal]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[Soto-Hernández]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Rocha-Sosa]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Lozoya-Gloria]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Rojas-Martínez]]></surname>
<given-names><![CDATA[R. I.]]></given-names>
</name>
<name>
<surname><![CDATA[Guevara-Olvera]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[Zavaleta-Mejía]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Contenido de capsidiol en raíces de chile CM-334 infectadas por Nacobbus aberrans y su efecto en juveniles del segundo estadio]]></article-title>
<source><![CDATA[Nematropica]]></source>
<year>2010</year>
<volume>40</volume>
<page-range>227-237</page-range></nlm-citation>
</ref>
<ref id="B6">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ha]]></surname>
<given-names><![CDATA[S. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Kim]]></surname>
<given-names><![CDATA[J. B.]]></given-names>
</name>
<name>
<surname><![CDATA[Hwang]]></surname>
<given-names><![CDATA[Y. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[S. W.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Molecular characterization of three 3-hydroxy-3-methylglutaryl-CoA reductase genes including pathogen-induced Hmg2 from pepper (Capsicum annuum)]]></article-title>
<source><![CDATA[Biochim. Biophys. Acta]]></source>
<year>2003</year>
<volume>1625</volume>
<page-range>253-260</page-range></nlm-citation>
</ref>
<ref id="B7">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ithal]]></surname>
<given-names><![CDATA[N.]]></given-names>
</name>
<name>
<surname><![CDATA[Recknor]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Nettleton]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[Maier]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
<name>
<surname><![CDATA[Baum]]></surname>
<given-names><![CDATA[T. J.]]></given-names>
</name>
<name>
<surname><![CDATA[Mitchum]]></surname>
<given-names><![CDATA[M. G.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Developmental transcript profiling of cyst nematode feeding cells in soybean roots]]></article-title>
<source><![CDATA[Mol. Plant-Microbe Interact.]]></source>
<year>2007</year>
<volume>20</volume>
<page-range>510-525</page-range></nlm-citation>
</ref>
<ref id="B8">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Jammes]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[Lecomte]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Engler]]></surname>
<given-names><![CDATA[J. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Bitton]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[Martin-Magniette]]></surname>
<given-names><![CDATA[M. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Renou]]></surname>
<given-names><![CDATA[J. P.]]></given-names>
</name>
<name>
<surname><![CDATA[Abad]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Favery]]></surname>
<given-names><![CDATA[B.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Genome-wide expression profiling of the host response to root-knot nematode infection in Arabidopsis]]></article-title>
<source><![CDATA[Plant J.]]></source>
<year>2005</year>
<volume>44</volume>
<page-range>447-458</page-range></nlm-citation>
</ref>
<ref id="B9">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[López-Martínez]]></surname>
<given-names><![CDATA[N.]]></given-names>
</name>
<name>
<surname><![CDATA[Colinas-León]]></surname>
<given-names><![CDATA[M. T.]]></given-names>
</name>
<name>
<surname><![CDATA[Peña-Valdivia]]></surname>
<given-names><![CDATA[C. B.]]></given-names>
</name>
<name>
<surname><![CDATA[Salinas-Moreno]]></surname>
<given-names><![CDATA[Y.]]></given-names>
</name>
<name>
<surname><![CDATA[Fuentes-Montiel]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Biesaga]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Zavaleta-Mejía]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Alterations in peroxidase activity and phenylpropanoid metabolism induced by Nacobbus aberrans Thorne and Allen, 1944 in chilli (Capsicum annuum L.) CM-334 resistant to Phytophthora capsici Leo]]></article-title>
<source><![CDATA[Plant Soil]]></source>
<year>2011</year>
<volume>338</volume>
<page-range>399-409</page-range></nlm-citation>
</ref>
<ref id="B10">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Manzanilla-López]]></surname>
<given-names><![CDATA[R. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Costilla]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Doucet]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Franco]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Inserra]]></surname>
<given-names><![CDATA[R. N.]]></given-names>
</name>
<name>
<surname><![CDATA[Lehman]]></surname>
<given-names><![CDATA[P. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Cid del Prado-Vera]]></surname>
<given-names><![CDATA[I.]]></given-names>
</name>
<name>
<surname><![CDATA[Souza]]></surname>
<given-names><![CDATA[R. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Evans]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The genus Nacobbus Thorne & Allen, 1944 (Nematoda: Pratylenchidae): Systematics, distribution, biology and management]]></article-title>
<source><![CDATA[Nematropica]]></source>
<year>2002</year>
<volume>32</volume>
<page-range>150-227</page-range></nlm-citation>
</ref>
<ref id="B11">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ohyama]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[Suzuki]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Masuda]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[Yoshida]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[Muranaka]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Chemical phenotypes of the hmg1 and hmg2 mutants of Arabidopsis demonstrate the In-planta role of HMG-CoA reductase in triterpene biosynthesis]]></article-title>
<source><![CDATA[Chem. Pharm. Bull.]]></source>
<year>2007</year>
<volume>55</volume>
<page-range>1518-1521</page-range></nlm-citation>
</ref>
<ref id="B12">
<nlm-citation citation-type="book">
<collab>SAS Institute Inc.</collab>
<source><![CDATA[SAS Procedures Guide, Version 9.0 (Computer program)]]></source>
<year>2002</year>
<publisher-loc><![CDATA[Cary^eNC NC]]></publisher-loc>
<publisher-name><![CDATA[SAS Institute Inc]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B13">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Schmittgen]]></surname>
<given-names><![CDATA[T. D.]]></given-names>
</name>
<name>
<surname><![CDATA[Livak]]></surname>
<given-names><![CDATA[K. J.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Analyzing real-time PCR data by the comparative CT method]]></article-title>
<source><![CDATA[Nat. Protoc.]]></source>
<year>2008</year>
<volume>3</volume>
<page-range>1101-1108</page-range></nlm-citation>
</ref>
<ref id="B14">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Silvar]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Merino]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[Díaz]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Differential activation of defense-related genes in susceptible and resistant pepper cultivars infected with Phytophthora capsici]]></article-title>
<source><![CDATA[J. Plant Physiol.]]></source>
<year>2008</year>
<volume>165</volume>
<page-range>1120-1124</page-range></nlm-citation>
</ref>
<ref id="B15">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Trujillo-Viramontes]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[Zavaleta-Mejía]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Rojas-Martínez]]></surname>
<given-names><![CDATA[R. I.]]></given-names>
</name>
<name>
<surname><![CDATA[Lara]]></surname>
<given-names><![CDATA[J. R.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Tiempo de inoculación y nivel de inóculo, factores determinantes para el rompimiento de resistencia a Phytophthora capsici inducido por Nacobbus aberrans en chile]]></article-title>
<source><![CDATA[Nematropica]]></source>
<year>2005</year>
<volume>35</volume>
<page-range>37-44</page-range></nlm-citation>
</ref>
<ref id="B16">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ueeda]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Kubota]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Nishi]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Contribution of jasmonic acid to resistance against Phytopthora blight in Capsicum annuum cv. SCM334.]]></article-title>
<source><![CDATA[Physiol. Mol. Plant Pathol.]]></source>
<year>2006</year>
<volume>67</volume>
<page-range>149-154</page-range></nlm-citation>
</ref>
<ref id="B17">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Weissenborn]]></surname>
<given-names><![CDATA[D. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Denbow]]></surname>
<given-names><![CDATA[C. J.]]></given-names>
</name>
<name>
<surname><![CDATA[Laine]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Lang]]></surname>
<given-names><![CDATA[S. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Yang]]></surname>
<given-names><![CDATA[Z.]]></given-names>
</name>
<name>
<surname><![CDATA[Yu]]></surname>
<given-names><![CDATA[X.]]></given-names>
</name>
<name>
<surname><![CDATA[Cramer]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[HMG-CoA reductase and terpenoid phytoalexins: Molecular specialization within a complex pathway]]></article-title>
<source><![CDATA[Physiol. Plant.]]></source>
<year>1995</year>
<volume>93</volume>
<page-range>393-400</page-range></nlm-citation>
</ref>
</ref-list>
</back>
</article>
