Quality assessment of Trichogramma parasitoids (Trichogramma spp.) from six mexican insectaries

Evaluación de calidad del parasitoide tricograma (Trichogramma spp.) proveniente de seis insectarios mexicanos

Jaime González-Cabrera¹, Hugo C. Arredondo-Bernal^1*, Richard Stouthamer²

¹ Centro Nacional de Referencia de Control Biológico. Km 1.5 Carretera Tecomán-Estación FFCC. Colonia Tepeyac. 28110. Tecomán, Colima, México. *Author for correspondence (jgonz017@student.ucr.edu) (hugo.arredondo@senasica.gob.mx).

Received: September, 2013.
Approved: February, 2014.

Abstract

Quality of mass-reared biological control agents is vital. There are reports that Trichogramma spp. failed to control the target pest, and poor quality may explain these failures. The first goal of this study was to determine which way of reproduction was practiced by Trichogramma spp. colonies from Mexican insectaries, either sexual or asexual, and the second goal was to determine whether those Trichogramma spp. colonies meet the quality standards suggested by the International Organization for Biological Control/ European Community (IOBC/EC). In March 2010, a letter was sent to 27 Trichogramma spp. producers. Six insectaries agreed to participate and sent dead samples of its colonies, a total of 10 colonies. For statistical analysis these colonies were grouped by species, either Trichogramma pretiosum or T. fuentesi. None of the Trichogramma spp. colonies were infected by parthenogenetic-inducing Wolbachia, i.e., all colonies reproduced sexually. Therefore, quality standards for sexual species were used: sex ratio (proportion females) ≥0.5, embryonic mortality ≤20 %, and total fecundity ≥40 eggs. Among the 10 Trichogramma spp. colonies there was great uniformity in sex ratio, embryonic mortality and total fecundity, i.e., per species there were not statistical differences among colonies. In sex ratio (0.552±0.038) and embryonic mortality (21± 4.48 %) the nine colonies of T. pretiosum barely fulfilled the minimum standards suggested by the IOBC/EC. Using hind tibia length as a proxy of total fecundity, the fecundity (37.85 eggs) of nine colonies of T. pretiosum and two colonies of T. fuentesi fell slightly below the standard suggested by the IOBC/EC. In México only sexual species of Trichogramma are mass-reared, but at low host densities asexual species (compared with sexual species) are more effective controlling the target pest. So, Mexican insectary personnel should also rear asexual species, and release one or the other depending of host density.

Key words: Trichogramma pretiosum, Trichogramma fuentesi, quality control, mass rearing, PI-Wolbachia.

La calidad de los agentes de control biológico producidos masivamente es vital. Existen reportes de que Trichogramma spp. no controla la plaga objetivo y su mala calidad puede explicar este fracaso. El primer objetivo de este estudio fue determinar qué forma de reproducción, ya sea sexual o asexual, se practicó en las colonias de Trichogramma spp. de insectarios mexicanos, y el segundo objetivo fue determinar si esas colonias de Trichogramma spp. cumplen con los estándares de calidad sugeridos por la Organización Internacional para el Control Biológico/Comunidad Europea (IOBC/EC, por sus siglas en inglés). En marzo de 2010, se envió una carta a 27 productores de Trichogramma spp. Seis insectarios aceptaron participar y enviaron muestras muertas de sus colonias, un total de 10 colonias. Para el análisis estadístico estas colonias se agruparon por especies, Trichogramma pretiosum o fuentesi. Ninguna de las colonias de Trichogramma spp. estaba infectada de Wolbachia, que induce la partenogénesis, es decir, todas las colonias se reprodujeron sexualmente. Por ende, se usaron los estándares de calidad para especies sexuales: proporción sexual (proporción de hembras) ≥0.5, mortalidad embrionaria ≤20 % y fecundidad total ≥40 huevos. Entre las 10 colonias de Trichogramma spp. hubo gran uniformidad en la proporción sexual, la mortalidad embrionaria y la fecundidad total, es decir, no hubo diferencias estadísticas entre las colonias por especie. En la proporción sexual (0.552 ±0.038) y la mortalidad embrionaria (21± 4.48 %), nueve colonias de T. pretiosum apenas cumplieron con los estándares mínimos sugeridos por la IOBC/EC. Con la longitud de la tibia posterior como proxy para fecundidad total, la fecundidad (37.85 huevos) de nueve colonias de T. pretiosum y dos colonias de T. fuentesi se ubicó ligeramente debajo del estándar sugerido por la IOBC/EC. En México se producen sólo especies sexuales de Trichogramma, pero con densidades bajas del huésped las especies asexuales (comparadas con las especies sexuales) son más efectivas para controlar la plaga objetivo. Pot lo tanto, el personal de los insectarios mexicanos debería también reproducir especies asexuales y liberar una o la otra dependiendo de la densidad del huésped.

Palabras clave: Trichogramma pretiosum, Trichogramma fuentesi, control de calidad, producción masiva, Wolbachia-IP.

INTRODUCTION

Trichogramma spp. parasitoids (Hymenoptera, Trichogrammatidae) are used for biological control of lepidopteran pests worldwide. The efficacy of these hymenopterous parasitoids is known; yet, mass-reared Trichogramma spp., compared with wild wasps, have a low field performance with respect to survival (Mansfield and Mills, 2002), parasitism rate (Ashley et al., 1973) and host acceptance (Bergeijk et al., 1989). Inadequate field performance of these wasps is caused by cold temperatures, heavy rain, residues of toxic agrochemicals, high parasitoid dispersion or low quality of the reared insects (Keller and Lewis, 1985; Collier and van-Steenwyk, 2004). Most of these causes are beyond the control of insectary personnel, with the exception of monitoring the quality of the reared parasitoids. Low quality of the reared parasitoids is caused by crowding conditions, spoiled and overparasitization of the host eggs (Salt, 1936) or genetic diseases (Antolin, 1999).

Supposedly low quality of mass-reared Trichogramma spp. is compensated with massive release of individuals (Bourchier et al., 1993); however, high numbers of low quality individuals do not control the target pests (Dutton et al., 1996). To avoid releasing low quality individuals, quality assessment of mass-reared Trichogramma spp. should be done as frequently as possible, i.e. every month (Laing and Bigler, 1991; García-González et al., 2005).

Trichogramma spp. populations when infected by parthenogenetic-inducing (PI) bacteria of the genus Wolbachia are asexual; PI-Wolbachia cause unfertilized eggs to develop into diploid females through gamete duplication (Stouthamer, 1997). Both types of populations, sexual and asexual, are used in biological control projects (Stouthamer, 2003), but in México only sexual species are mass-reared (García-González et al., 2005). For quality control of Trichogramma spp. sexual species the International Organization for Biological Control/ European Community (IOBC/EC) suggested to measure standards, i.e. biological traits, correlated with field performance: sex ratio (proportion females), embryonic mortality and total fecundity (Bigler et al., 1991; van-Lenteren, 2003). Female proportion is important because it is the only sex that kills the pest; embryonic mortality indicates the real number of wasps released into the field; and total fecundity is related to the number of lepidopteran dead eggs. In dead Trichogramma spp. samples as a proxy of total fecundity, it is recommended to measure female hind tibia length since it is directly related to its field performance, as larger females (compared with small females) live longer, oviposit a larger number of eggs and find host eggs easier (Kazmer and Luck, 1991; Bai et al., 1992; Bennett and Hoffmann, 1998).

In México, Trichogramma spp. parasitoids are the most mass-reared beneficial insects (Williams et al., 2013). These parasitoids are released to protect crops such as apples, sugarcane or tobacco, in approximately 1.5 million ha (Domínguez, 1996). Because of the importance of Trichogramma spp. parasitoids as biological control agents, the first goal of this study was to determine which way of reproduction was practiced by 10 Trichogramma spp. colonies from six Mexican insectaries, either sexual or asexual; and the second goal was to determine whether the Mexican Trichogramma spp. meets the quality control standards (previously mentioned), of the IOBC/EC; such standards are observed by bio-producers of North America and Europe (Bigler et al., 1991; van-Lenteren, 2003). If, at the end of the study low quality is detected, production process tests should be performed; and later on, after detecting the problem, corrective actions could be implemented.

In March 2010, an e-mail letter stating the objectives of this study was sent to 27 Trichogramma spp. producers that were listed in "Directorio de laboratorios reproductores y comercializadores de agentes de control biológico, 2010. Dirección General de Sanidad Vegetal y del Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria/Centro Nacional de Referencia de Control Biológico". Initially, eight producers agreed to participate, but at the end of 2010, just six insectaries sent three samples of each Trichogramma colony, a total of 10 independent colonies. The Trichogramma samples from these insectaries were obtained as follows. On site, personnel of each insectary put live host egg cards on enclosed containers and let the wasp to emerge. Upon the natural death of the emerged adults these containers were sent to San Luis Rio Colorado, Sonora México. One week after the arrival of each sample, these containers were brought for analysis to the Entomology Department of University of California, Riverside, California, USA. To maintain anonymity of these collaborating insectaries, in this study only their geographical location is registered.

To determine whether the populations from the 10 colonies of the six Mexican insectaries were sexual or asexual, PI-Wolbachia was searched as follows: per sample, DNA was extracted from 20 wasps. Each wasp was ground in 60 µm 5 % Chelex-100 (Bio-Rad laboratories, Hercules, California, USA) and 2 µm proteinase K (20 mg mL^-1); the mixture was incubated for 60 min at 55 °C, followed by 10 min at 99 °C (Walsh et al., 1991). Evidence of Wolbachia infection was sought using Wolbachia-specific PCR primers. The primers W-Specf (AGCTTCGAGTGAAACCAATTC) and W-Specr (CATACCTATTCGAAGGGATAG) were used to amplify a 438 bp fragment of Wolbachia 16S rDNA (Werren and Windsor, 2000). PCR was performed in 25 µL reactions containing 2 µL DNA template, 1X PCR-buffer (NEB), 0.2 µmol L^-1 each dATP, dCTP, dGTP, 0.4 ,µmol L^-1 dUTP, 0.4 ,µmol L^-1 BSA, 0.2 µmol L ¹ forward and reverse W-spec PCR primers, 1 U Taq polymerase enzyme, and 12.3 ,iiL sterile distilled water. PCR was performed using a thermocycler Ep gradient S (Eppendorf AG, Hamburg, Germany). The cycling program was 2 min at 94 °C, 45 cycles of 0.5 min at 94 °C, 45 s at 55 °C and 1.5 min at 72 °C, followed by 10 min at 72 °C after the last cycle. To determine that Wolbachia-DNA amplified successfully, in each PCR reaction a Trichogramma pretiosum-DNA known to be infected by Wolbachia was included. PCR products were separated on a 1 % agarose gel and stained with ethidium bromide; size ladders were run along with the samples for reference. PCR products and ladders were photographed with a Carestream Molecular Imaging V.5.0.2.3.0 (Carestream Health, Inc., Rochester, New York, USA).

Along with the detection of PI-Wolbachia, the Trichogramma spp. samples from the 10 colonies were analyzed for their sex ratio, embryonic mortality and female hind tibia length, as follows: Sex ratio, or number of females divided by the total number of adults in the sample, was determined from 100 adults. Male or female detection was based in the shape of the antennae (Pinto and Stouthamer, 1994). Embryonic mortality of the Trichogramma spp. samples was estimated checking 100 black eggs for the presence of an unemerged wasp or an emergence hole. Parasitized host eggs turn black once parasitoid larvae reach its prepupal stage. The measurements of sex ratio and embryonic mortality were taken using a V8 Zeiss® stereo microscope. To estimate female hind tibia length, per Trichogramma spp. sample, the length of the hind tibia of 30 females was measured as described by Bennett and Hoffmann (1998), but instead of Hoyer's mounting medium, water was used. These measurements were taken with an optical micrometer mounted in the 40X-ocular of a phase contrast microscope Axioskop 40 Zeiss^®.

The taxonomic identity of the three samples from the 10 Trichogramma spp. colonies was previously determined (publication in progress). So, to perform statistical analysis, the samples were grouped by species: eight colonies of Trichogramma pretiosum and two colonies of Trichogramma fuentesi in the first sample, and nine colonies of T. pretiosum and one colony of T. fuentesi in the last two samples. Differences by species in sex ratio and embryonic mortality were calculated using one-way ANOVA, in which the samples were taken as repetitions; and statistical differences in female hind tibia length were calculated through a two-way ANOVA (sample and colony). These statistical tests were performed using SAS (SAS Institute Inc. 2011), with Tukey correction (p<0.05). All experimental data, including sex ratio, conformed to the ANOVA assumptions: random selection of individuals, equality of variances and normality of the residuals.

RESULTS AND DISCUSSION

None of the samples from the 10 colonies of the six Mexican insectaries were infected by PI-Wolbachia; then, based in the work of Stouthamer (1997) it was concluded that these Trichogramma spp. populations, either T. pretiosum or T. fuentesi, were sexual populations. This result is similar to other studies of Mexican insectaries, in which only sexual species of Trichogramma spp. were found (García-González et al., 2005). In other countries, besides the rearing of sexual species of Trichogramma spp., they reared and field released asexual species too. Sexual wasps are released at high host densities; and later on, when the pest density is reduced, asexual wasps are release (Stouthamer, 2003). Consequently, Mexican insectary personnel should also rear asexual species, and release one or the other depending of host density. Mexico has asexual populations of Trichogramma spp. (Stouthamer and Luck, 1993; Stouthamer and Werren, 1993); so it should be no problem to get the initial rearing stock. The main concern to release asexual Trichogramma spp. is that they will extinct the sexual types; yet in the field both types of populations often coexist (Stouthamer and Luck, 1993; Stouthamer et al., 2001), and the percentage of asexual populations is smaller than 11 % (Pinto et al., 1997; Stouthamer et. al., 2001).

In sex ratio and embryonic mortality (Table 1) of T. pretiosum there were not statistical differences (p>0.05) among colonies. In average, the nine colonies of the six Mexican insectaries that produced T. pretiosum had a sex ratio (proportion females) of 0.552 ±0.038 and an embryonic mortality of 21 ±4.48 %. In both variables, these colonies of T. pretiosum barely fulfilled the minimum standards suggested by the IOBC/EC, which are a sex ratio (proportion females) ≥0.5 and an embryonic mortality ≤20. Colonies of T. pretiosum from USA have a higher sex ratio (≥0.87) and a lower embryonic mortality (10± 4.8) than the Mexican colonies of T. pretiosum, but these USA-colonies are asexual populations, i.e., they reproduce by parthenogenesis (Heimpel and Lundgren, 2000; Lundgren and Heimpel, 2003). A literature search did not show studies about biological parameters of mass reared sexual Trichogramma spp.; then, no comparison with others sexual colonies were made in sex ratio, embryonic mortality or hind tibia length.

Between T. pretiosum and T. fuentesi there were not statistical differences (p>0.05) among colonies in hind tibia length (Table 1). The IOBC/EC does not have quality standards for this morphological trait or any other measurement of body length. However, female hind tibia length and fecundity are highly correlated (Kazmer and Luck, 1991; Bai et al., 1992; Bennett and Hoffmann, 1998); so, this morphological trait was used as a proxy of total fecundity. The T. pretiosum and T. fuentesi colonies, considered as whole, had a hind tibia length of 0.140±0.001 and 0.139±0.001 mm, respectively; based on the work of Bai et al. (1992), females with hind tibia length of this size will lay a total of 37.85 eggs. Since the IOBC/EC suggests a total fecundity ≥40 eggs in quality control tests of Trichogramma spp. parasitoids, the fecundity of these T. pretiosum and T. fuentesi females (the ones here studied) fell slightly below the standard suggested by this international organism.

To measure the quality of Trichogramma spp. parasitoids, other tests different than the ones here performed, were suggested; for example walking speed or flight length; but such tests do not correlate with Trichogramma spp. field performance (van-Lenteren et al., 2003). Thus, currently, the tests here performed are the best choice to measure the quality of mass reared Trichogramma spp.

CONCLUSIONS

The 10 Trichogramma spp. colonies from the six Mexican insectaries, either T. pretiosum or T. fuentesi, were sexual populations. In sex ratio and embryonic mortality, the nine colonies of T. pretiosum barely met the minimum quality standards suggested by the International Organization for Biological Control/ European Community (IOBC/EC). Similarly, using female hind tibia length as a proxy of total fecundity, the fecundity of nine colonies of T. pretiosum and two colonies of T. fuentesi fell slightly below the quality standards suggested by the IOBC/EC. Among the 10 Trichogramma spp. colonies, there was great uniformity in sex ratio, embryonic mortality, total fecundity and lack of PI-Wolbachia infection.

ACKNOWLEGEMENTS

Thanks to Paul Rugman-Jones for his guidance in the molecular analysis and for proof reading the article; to Anabel Valencia Villalobos and Marco Antonio Mellin Rosas for their coordination on the delivery of Trichogramma samples; and special thanks to the personnel of the collaborating insectaries. This research was supported in whole or in part by UC MEXUS— CONACYT agreement in higher education and research, Robert and Peggy van den Bosch Memorial Scholarship, and the University of California, campus Riverside, Entomology Department.

LITERATURE CITED

Antolin, M. F. 1999. A genetic perspective on mating systems and sex ratios of parasitoid wasps. Res. Popul. Ecol. 41(1): 29-37.         [ Links ]

Ashley, T. R., D. González, and T. F. Leigh. 1973. Reduction in effectiveness of laboratory-reared Trichogramma. Environ. Entomol. 2(6): 1069-1073.         [ Links ]

Bai, B. R., R. F. Luck, L. Forster, B. Stephens, and J. A. M. Janssen. 1992. The effect of host size on quality attributes of the egg parasitoid, Trichogramma pretiosum. Entomol. Exp. Appl. 64(1): 37-48.         [ Links ]

Bennett, D. M., and A. A. Hoffmann. 1998. Effects of size and fluctuating asymmetry on field fitness of the parasitoid Trichogramma carverae (Hymenoptera: Trichogrammatidae). J. Anim. Ecol. 67(4): 580-591.         [ Links ]

Bergeijk, K. E. V., F. Bigler, N. K. Kaashoek, and G. A. Pak. 1989. Changes in host acceptance and host suitability as an effect of rearing Trichogramma maidis on a factitious host. Entomol. Exp. Appl. 52(3): 229-238.         [ Links ]

Bigler, F., F. Cerutti, and J. Laing. 1991. First draft of criteria for quality control (product control) of Trichogramma. In: Bigler F. (ed). Proceedings of the fifth workshop of the IOBC global working group 'quality control of mass reared arthropods'. Wageningen, Netherland. pp: 200-201.         [ Links ]

Bourchier, R. S., S. M. Smith, and S. J. Song. 1993. Host acceptance and parasitoid size as predictors of parasitoid quality for mass-reared Trichogramma minutum. Biol. Control. 3(2): 135-139.         [ Links ]

Collier, T., and R. van-Steenwyk. 2004. A critical evaluation of augmentative biological control. Biol. Control. 31(2): 245256.         [ Links ]

Domínguez, E. R. 1996. Control biológico de plagas agrícolas en México. In: Zapatero, M. C. (ed). El Control Biológico en América Latina. IOBC. Buenos Aires, Argentina. pp: 55-62.         [ Links ]

Dutton, A., F. Cerutti, and F. Bigler. 1996. Quality and environmental factors affecting Trichogramma brassicae efficiency under field conditions. Entomol. Exp. Appl. 81(1): 71-79.         [ Links ]

España-Luna, M. P., A. González-Hernández, O. G. Alvarado-Gómez, y J. Lozano-Gutiérrez. 2008. Identificación molecular de especies cripticas de Trichogramma Westwood (Hymenoptera: Trichogrammatidae) de importancia agrícola en México. Acta Zool. Mex. 24(1): 1-14.         [ Links ]

García-González, F., A. González-Hernández, y M. P. España-Luna. 2005. Especies de Trichogramma Westwood (Hymenoptera: Trichogrammatidae) presentes en centros reproductores de México. Acta Zool. Mex. 21(3): 125-135.         [ Links ]

Heimpel, G. E., and J. G. Lundgren. 2000. Sex ratios of commercially reared biological control agents. Biol. Control. 19(1): 77-93.         [ Links ]

Kazmer, D. J., and R. F. Luck. 1991. Female body size, fitness and biological control quality: field experiments with Trichogramma pretiosum. In: Wajnberg, E., and S. B. Vinson (eds). Trichogramma and Other Egg Parasitoids. 3rd Int. Symp. INRA. Paris, France. pp: 37-40.         [ Links ]

Keller, M. A., and W. J. Lewis. 1985. Movements by Trichogramma pretiosum (Hymenoptera, Trichogrammatidae) released into cotton. Southwest Entomol. 8(1): 99-109.         [ Links ]

Laing, J. E., and F. Bigler. 1991. Quality control of mass-produced Trichogramma species. In: Bigler, F. (ed). Proceedings of the fifth workshop of the IOBC global working group 'quality control of mass reared arthropods'. Wageningen, Netherland. pp: 111-118.         [ Links ]

Lundgren, J. G., and G. E. Heimpel. 2003. Quality assessment of three species of commercially produced Trichogramma and the first report of thelytoky in commercially produced Trichogramma. Biol. Control. 26(1): 68-73.         [ Links ]

Mansfield, S., and N. J. Mills. 2002. Direct estimation of the survival time of commercially produced adult Trichogramma platneri Nagarkatti (Hymenoptera: Trichogrammatidae) under field conditions. Biol. Control. 25(1): 41-48.         [ Links ]

Pinto, J. D., and R. Stouthamer. 1994. Systematics of the Trichogrammatidae with emphasis on Trichogramma. In: Wajnberg, E., and S. A. Hassan (eds). Biological Control with Egg Parasitoids. CAB International. Wallingford, UK. pp: 1-36.         [ Links ]

Pinto, J. D., R. Stouthamer, and G. R. Platner. 1997. A new cryptic species of Trichogramma from the Mojave desert of California as determined by morphological, reproductive and molecular data. P. Entomol. Soc. Wash. 99(2): 238-247.         [ Links ]

Salt, G. 1936. Experimental studies in insect parasitism IV. The effect of superparasitism on populations of Trichogramma evanescens. J. Exp. Biol. 13(3): 363-375.         [ Links ]

SAS Institute Inc. 2011. SAS/STAT® 9.2. User's guide. Cary, NC.         [ Links ]

Stouthamer, R. 1997. Wolbachia-induced parthenogenesis. In: O'Neill, S. L., A. A. Hoffman, and J. H. Werren (eds). Influential Passengers: Inherited Microorganisms and Arthropod Reproduction. Oxford University Press. New York, USA. pp: 102-124.         [ Links ]

Stouthamer, R. 2003. The use of unisexual wasps in biological control. In: van-Lenteren, J. C. (ed). Quality Control and Production of Biological Control Agents. Theory and Testing Procedures. CABI Publishing. Wallingford, UK. pp: 73-87.         [ Links ]

Stouthamer, R., and J. H. Werren. 1993. Microbes associated with parthenogenesis in wasps of the genus Trichogramma. J. Invertebr. Pathol. 61(1): 6-9.         [ Links ]

Stouthamer, R., and R. F. Luck. 1993. Influence of microbe-associated parthenogenesis on the fecundity of Trichogramma deion and Trichogramma pretiosum. Entomol. Exp. Appl. 67(2): 183-192.         [ Links ]

Stouthamer, R., M. van-Tilborg, J. H. de-Jong, L. Nunney, and R. F. Luck. 2001. Selfish element maintains sex in natural populations of a parasitoid wasp. Proc. Royal Soc. London B Biol. 268(1467): 617-622.         [ Links ]

van-Lenteren, J. C. 2003. Preface. In: van-Lenteren, J. C. (ed). Quality Control and Production of Biological Control Agents. Theory and Testing Procedures. CABI Publishing. Wallingford, UK. pp: IX-X.         [ Links ]

van-Lenteren, J. C., A. Hale, J. N. Klapwijk, J. V. Schelt, and S. Steinberg. 2003. Guidelines for quality control of commercially produced natural enemies. In: van-Lenteren, J. C. (ed). Quality Control and Production of Biological Control Agents. Theory and Testing Procedures. CABI Publishing. Wallingford, UK. pp: 265-303.         [ Links ]

Walsh, P. S., D. Metzger, and R. Higuchi. 1991. Chelex-100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10: 506-513.         [ Links ]

Werren, J. H., and D. M. Windsor. 2000. Wolbachia infection frequencies in insects: evidence of a global equilibrium? P. Roy. Soc. Lond. B Biol. 267(1450): 1277-1285.         [ Links ]

Williams, T., H. C. Arredondo-Bernal, and L. A. Rodríguez-del-Bosque. 2013. Biological pest control in México. Annu. Rev. Entomol. 2013(58): 119-40.         [ Links ]