<?xml version="1.0" encoding="ISO-8859-1"?><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id>1405-3195</journal-id>
<journal-title><![CDATA[Agrociencia]]></journal-title>
<abbrev-journal-title><![CDATA[Agrociencia]]></abbrev-journal-title>
<issn>1405-3195</issn>
<publisher>
<publisher-name><![CDATA[Colegio de Postgraduados]]></publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id>S1405-31952010000400005</article-id>
<title-group>
<article-title xml:lang="en"><![CDATA[Serological and molecular tools for strain discrimination of Citrus tristeza virus isolates from Nuevo Leon, Mexico]]></article-title>
<article-title xml:lang="es"><![CDATA[Herramientas serológicas y moleculares para la discriminación de aislamientos del virus tristeza de los cítricos del Estado de Nuevo León, México]]></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Iracheta-Cárdenas]]></surname>
<given-names><![CDATA[María M.]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Almeyda-León]]></surname>
<given-names><![CDATA[Isidro H.]]></given-names>
</name>
<xref ref-type="aff" rid="A02"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Cevik]]></surname>
<given-names><![CDATA[Bayarm]]></given-names>
</name>
<xref ref-type="aff" rid="A03"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[Charles L.]]></given-names>
</name>
<xref ref-type="aff" rid="A04"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[Richard F.]]></given-names>
</name>
<xref ref-type="aff" rid="A05"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[Mario A.]]></given-names>
</name>
<xref ref-type="aff" rid="A05"/>
</contrib>
</contrib-group>
<aff id="A01">
<institution><![CDATA[,Universidad Autónoma de Nuevo León Instituto de Biotecnología Facultad de Ciencias Biológicas]]></institution>
<addr-line><![CDATA[San Nicolás de los Garza Nuevo León]]></addr-line>
</aff>
<aff id="A02">
<institution><![CDATA[,Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarías Unidad de Investigación en Biología Celular y Molecular Universidad Autónoma de Nuevo León]]></institution>
<addr-line><![CDATA[San Nicolás de los Garza Nuevo León]]></addr-line>
<country>México</country>
</aff>
<aff id="A03">
<institution><![CDATA[,Süleyman Demirel University Faculty of Agriculture Department of Plant Protection]]></institution>
<addr-line><![CDATA[Isparta ]]></addr-line>
<country>Turkey</country>
</aff>
<aff id="A04">
<institution><![CDATA[,University of Florida Horticultural Sciences Department ]]></institution>
<addr-line><![CDATA[Gainesville FL]]></addr-line>
<country>USA</country>
</aff>
<aff id="A05">
<institution><![CDATA[,U.S. Department of Agriculture Agricultural Research Service National Clonal Germplasm Repository for Citrus and Dates]]></institution>
<addr-line><![CDATA[Riverside California]]></addr-line>
<country>USA</country>
</aff>
<pub-date pub-type="pub">
<day>00</day>
<month>06</month>
<year>2010</year>
</pub-date>
<pub-date pub-type="epub">
<day>00</day>
<month>06</month>
<year>2010</year>
</pub-date>
<volume>44</volume>
<numero>4</numero>
<fpage>449</fpage>
<lpage>460</lpage>
<copyright-statement/>
<copyright-year/>
<self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S1405-31952010000400005&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_abstract&amp;pid=S1405-31952010000400005&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_pdf&amp;pid=S1405-31952010000400005&amp;lng=en&amp;nrm=iso"></self-uri><abstract abstract-type="short" xml:lang="en"><p><![CDATA[Citrus tristeza virus (CTV) is an important issue to the Mexican citrus industry. CTV infected plants have been reported in 20 citrus producing states of the country as symptomless virus infections, even on plants grafted on the sensitive sour orange rootstock. The detection of severe CTV isolates is mandatory to reinforce the operation of the CTV campaign nationwide. In this study, 13 CTV isolates from Nuevo León and one from Tamaulipas states were characterized for activity against the strain discriminatory MCA13 monoclonal antibody, bi-directional (BD) PCR, and hybridization with specific DNA probes, with RT-PCR amplicons, of the p25 coat protein gene. Ten out of 13 CTV isolates from Nuevo León and the Tamaulipas isolate gave a positive reaction to the MCA13 monoclonal antibody. BD-PCR tests yielded a cDNA fragment of 300 bp characteristic of decline-inducing CTV strains with eight of 13 isolates from Nuevo León and the Tamaulipas isolate. Hybridization with strain group specific DNA probes showed reactivity of eight CTV isolates with Probe II associated with decline inducing CTV strains, and three CTV isolates with Probe VII, associated to mild CTV strains. As a conclusion, it was shown the usefulness of the MCA13 monoclonal antibodies, BD-PCR and the hybridization with strain group specific DNA probes (SGSP) for the discrimination of CTV isolates, and the discovering of severe CTV isolates in the state of Nuevo León. Both BD-PCR and hybridization with SGSP were more suitable for strain discrimination of CTV isolates, than the MCA13 monoclonal antibody. BD-PCR was able to detect mixtures of both mild and decline inducing CTV isolates in the sample; hybridization with SGSP was suitable for detecting either mild, decline inducing and stem pitting CTV isolates.]]></p></abstract>
<abstract abstract-type="short" xml:lang="es"><p><![CDATA[El virus de la tristeza (Citrus tristeza virus = CTV) es un problema de importancia para la industria citrícola mexicana. Se han reportado plantas infectadas por el CTV en 20 estados productores de cítricos del país, en forma de infecciones asintomáticas, incluso en plantas injertadas en el patrón hipersensible naranjo agrio. La detección de aislamientos severos de CTV es necesaria para reforzar la operación de la campaña de CTV en todo el país. En el presente estudio se caracterizaron 13 aislamientos del CTV del estado de Nuevo León y uno del estado de Tamaulipas por su actividad contra el anticuerpo monoclonal MCA13, PCR bi-direccional (BD) e hibridación con sondas específicas para el gen p25 de la proteína de cápside. Diez de 13 aislamientos del CTV de Nuevo León y el aislamiento de Tamaulipas dieron una reacción positiva al anticuerpo monoclonal MCA 13. Las pruebas BD-PCR dieron un fragmento de ADNc de 300 pares de bases característico de razas tipo decaimiento en ocho de los 13 aislamientos de Nuevo León y del aislamiento de Tamaulipas. En la hibridación con sondas ADN específicas, dieron reacción con ocho aislamientos (CTV) con la Sonda II asociada con linajes CTV del tipo decaimiento y tres aislamientos mostraron reactividad con la Sonda VII asociada con linajes de tipo débil. Como conclusión, se mostró la utilidad del anticuerpo monoclonal MCA13, del PCR bi-direccional y de la hibridación con sondas específicas de (SGSP) para la discriminación de aislamientos de CTV, así como el descubrimiento de aislamientos severos de CTV en el estado de Nuevo León. Tanto el PCR-BD y la hibridación con sondas específicas (SGSP) fueron más adecuados para la discriminación de la aislamientos de CTV, que el anticuerpo monoclonal MCA13. El PCR-BD pudo detectar mezclas de aislamientos débiles y del tipo decaimiento del CTV en una misma muestra; la hibridación con SGSP fue adecuada para detectar aislamientos CTV ya sea de tipo débil, tipo decaimiento y picado de tallo.]]></p></abstract>
<kwd-group>
<kwd lng="en"><![CDATA[bi-directional PCR]]></kwd>
<kwd lng="en"><![CDATA[DIBA]]></kwd>
<kwd lng="en"><![CDATA[hybridization]]></kwd>
<kwd lng="en"><![CDATA[MCA 13 monoclonal antibody]]></kwd>
<kwd lng="es"><![CDATA[PCR bi-direccional]]></kwd>
<kwd lng="es"><![CDATA[DIBA]]></kwd>
<kwd lng="es"><![CDATA[hibridación]]></kwd>
<kwd lng="es"><![CDATA[anticuerpo monoclonal MCA 13]]></kwd>
</kwd-group>
</article-meta>
</front><body><![CDATA[ <p align="justify"><font face="verdana" size="4">Biotecnolog&iacute;a</font></p>     <p align="justify"><font face="verdana" size="4">&nbsp;</font></p>     <p align="center"><font face="verdana" size="4"><b>Serological and molecular tools for strain discrimination of <i>Citrus tristeza virus </i>isolates from Nuevo Leon, Mexico</b></font></p>     <p align="center"><font face="verdana" size="2">&nbsp;</font></p>     <p align="center"><font face="verdana" size="3"><b>Herramientas serol&oacute;gicas y moleculares para la discriminaci&oacute;n de aislamientos del virus tristeza de los c&iacute;tricos del Estado de Nuevo Le&oacute;n, M&eacute;xico</b></font></p>     <p align="center"><font face="verdana" size="2">&nbsp;</font></p>     <p align="center"><font face="verdana" size="2"><b>Mar&iacute;a M. Iracheta&#150;C&aacute;rdenas<sup>1</sup>, Isidro H. Almeyda&#150;Le&oacute;n<sup>2</sup>, Bayarm Cevik<sup>3</sup>, Charles L. Niblett<sup>4</sup>, Richard F. Lee<sup>5</sup> and Mario A. Rocha&#150;Pe&ntilde;a<sup>2,*</sup></b></font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><i><sup>1</sup> Instituto de Biotecnolog&iacute;a. Facultad de Ciencias Biol&oacute;gicas. Universidad Aut&oacute;noma de Nuevo Le&oacute;n. Pedro de Alba s/n. Cd. Universitaria. San Nicol&aacute;s de los Garza, Nuevo Le&oacute;n.</i></font></p>     <p align="justify"><font face="verdana" size="2"><i><sup>2</sup> Unidad de Investigaci&oacute;n en Biolog&iacute;a Celular y Molecular, INIFAP/UANL. Apartado Postal 128&#150;F. 66450. Cd. Universitaria. 66450. San Nicol&aacute;s de los Garza, Nuevo Le&oacute;n, M&eacute;xico. *Autor for correspondence:</i> (<a href="mailto:mrocha@fcb.uanl.mx">mrocha@fcb.uanl.mx</a>). </font></p>     ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><i><sup>3</sup> Faculty of Agriculture. Department of Plant Protection. S&uuml;leyman Demirel University. 32260. Isparta, Turkey.</i></font></p>     <p align="justify"><font face="verdana" size="2"><i><sup>4</sup> Horticultural Sciences Department, University of Florida, P. O. Box 110780, Gainesville, FL 32611&#150;0780 USA.</i></font></p>     <p align="justify"><font face="verdana" size="2"><i><sup>5</sup> National Clonal Germplasm Repository for Citrus and Dates, USDA&#150;ARS.1060 Martin Luther King Blvd. Riverside, California 92507. USA.</i></font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2">Received: September, 2009.     <br>   Approved: April, 2010.</font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b>ABSTRACT</b></font></p>     <p align="justify"><font face="verdana" size="2"><i>Citrus tristeza virus </i>(CTV) is an important issue to the Mexican citrus industry. CTV infected plants have been reported in 20 citrus producing states of the country as symptomless virus infections, even on plants grafted on the sensitive sour orange rootstock. The detection of severe CTV isolates is mandatory to reinforce the operation of the CTV campaign nationwide. In this study, 13 CTV isolates from Nuevo Le&oacute;n and one from Tamaulipas states were characterized for activity against the strain discriminatory MCA13 monoclonal antibody, bi&#150;directional (BD) PCR, and hybridization with specific DNA probes, with RT&#150;PCR amplicons, of the p25 coat protein gene. Ten out of 13 CTV isolates from Nuevo Le&oacute;n and the Tamaulipas isolate gave a positive reaction to the MCA13 monoclonal antibody. BD&#150;PCR tests yielded a cDNA fragment of 300 bp characteristic of decline&#150;inducing CTV strains with eight of 13 isolates from Nuevo Le&oacute;n and the Tamaulipas isolate. Hybridization with strain group specific DNA probes showed reactivity of eight CTV isolates with Probe II associated with decline inducing CTV strains, and three CTV isolates with Probe VII, associated to mild CTV strains. As a conclusion, it was shown the usefulness of the MCA13 monoclonal antibodies, BD&#150;PCR and the hybridization with strain group specific DNA probes (SGSP) for the discrimination of CTV isolates, and the discovering of severe CTV isolates in the state of Nuevo Le&oacute;n. Both BD&#150;PCR and hybridization with SGSP were more suitable for strain discrimination of CTV isolates, than the MCA13 monoclonal antibody. BD&#150;PCR was able to detect mixtures of both mild and decline inducing CTV isolates in the sample; hybridization with SGSP was suitable for detecting either mild, decline inducing and stem pitting CTV isolates.</font></p>     <p align="justify"><font face="verdana" size="2"><b>Key words: </b>bi&#150;directional PCR, DIBA, hybridization, MCA 13 monoclonal antibody.</font></p>     ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b>RESUMEN</b></font></p>     <p align="justify"><font face="verdana" size="2">El virus de la tristeza <i>(Citrus tristeza virus = </i>CTV) es un problema de importancia para la industria citr&iacute;cola mexicana. Se han reportado plantas infectadas por el CTV en 20 estados productores de c&iacute;tricos del pa&iacute;s, en forma de infecciones asintom&aacute;ticas, incluso en plantas injertadas en el patr&oacute;n hipersensible naranjo agrio. La detecci&oacute;n de aislamientos severos de CTV es necesaria para reforzar la operaci&oacute;n de la campa&ntilde;a de CTV en todo el pa&iacute;s. En el presente estudio se caracterizaron 13 aislamientos del CTV del estado de Nuevo Le&oacute;n y uno del estado de Tamaulipas por su actividad contra el anticuerpo monoclonal MCA13, PCR bi&#150;direccional (BD) e hibridaci&oacute;n con sondas espec&iacute;ficas para el gen p25 de la prote&iacute;na de c&aacute;pside. Diez de 13 aislamientos del CTV de Nuevo Le&oacute;n y el aislamiento de Tamaulipas dieron una reacci&oacute;n positiva al anticuerpo monoclonal MCA 13. Las pruebas BD&#150;PCR dieron un fragmento de ADNc de 300 pares de bases caracter&iacute;stico de razas tipo decaimiento en ocho de los 13 aislamientos de Nuevo Le&oacute;n y del aislamiento de Tamaulipas. En la hibridaci&oacute;n con sondas ADN espec&iacute;ficas, dieron reacci&oacute;n con ocho aislamientos (CTV) con la Sonda II asociada con linajes CTV del tipo decaimiento y tres aislamientos mostraron reactividad con la Sonda VII asociada con linajes de tipo d&eacute;bil. Como conclusi&oacute;n, se mostr&oacute; la utilidad del anticuerpo monoclonal MCA13, del PCR bi&#150;direccional y de la hibridaci&oacute;n con sondas espec&iacute;ficas de (SGSP) para la discriminaci&oacute;n de aislamientos de CTV, as&iacute; como el descubrimiento de aislamientos severos de CTV en el estado de Nuevo Le&oacute;n. Tanto el PCR&#150;BD y la hibridaci&oacute;n con sondas espec&iacute;ficas (SGSP) fueron m&aacute;s adecuados para la discriminaci&oacute;n de la aislamientos de CTV, que el anticuerpo monoclonal MCA13. El PCR&#150;BD pudo detectar mezclas de aislamientos d&eacute;biles y del tipo decaimiento del CTV en una misma muestra; la hibridaci&oacute;n con SGSP fue adecuada para detectar aislamientos CTV ya sea de tipo d&eacute;bil, tipo decaimiento y picado de tallo.</font></p>     <p align="justify"><font face="verdana" size="2"><b>Palabras clave: </b>PCR bi&#150;direccional, DIBA, hibridaci&oacute;n, anticuerpo monoclonal MCA 13.</font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b>INTRODUCTION</b></font></p>     <p align="justify"><font face="verdana" size="2"><i>Citrus tristeza virus </i>(CTV) is distributed worldwide and it is the causal agent of the most economically important viral disease of citrus (Rocha&#150;Pe&ntilde;a <i>et al., </i>1995a). It has been documented (Garnsey <i>et al., </i>2005) that CTV occurs in the field as a mixture of strains or isolates which differ in biological properties, such as symptoms in the field (Rocha&#150;Pe&ntilde;a <i>et al., </i>1995a), reaction on indicator plants (Garnsey <i>et al., </i>2005) and aphid transmissibility (Rocha&#150;Pe&ntilde;a <i>et al., </i>1995b; Yokomi <i>et al., </i>1994). This phenomenon frequently leads to apparent latent infections of diverse CTV isolates for many years, even in plants grafted on the sensitive sour orange rootstock without any noticeable disease symptoms (Bar&#150;Joseph, 1978; Rocha&#150;Pe&ntilde;a <i>et al., </i>1998). Over the years, the occurrence of unexpected declining CTV infected trees in the field may result if no phytosanitary measures are accomplished against the virus on a timely basis (Rocha&#150;Pe&ntilde;a <i>et al., </i>1998).</font></p>     <p align="justify"><font face="verdana" size="2">Several serological and molecular approaches have been developed as an effort to differentiate CTV isolates (Niblett <i>et al., </i>2000). These approaches include the use of the strain discriminatory MCA 13 monoclonal antibody (Permar <i>et al., </i>1990), serological probes for orange stem pitting CTV isolates (Nikolaeva <i>et al., </i>1998) single strand conformation polymorphism (SSCP) addressed to several CTV genes (Niblett <i>et al., </i>2000), bidirectional PCR (Cevik <i>et al., </i>1996), several hybridization approaches with specific group DNA probes (Cevik, 1997<sup>&#91;<a href="#notas">6</a>&#93;</sup>; Narv&aacute;ez <i>et al., </i>2000), and several approaches using restriction analysis patterns with RT&#150;PCR amplicons (Marques <i>et al., </i>2006; Roy <i>et al., </i>2003), among others.</font></p>     <p align="justify"><font face="verdana" size="2">In M&eacute;xico, CTV occurs as symptomless virus infections, even in plants grafted on sour orange rootstock (Rocha&#150;Pe&ntilde;a <i>et al., </i>2005); however, the occurrence of severe CTV isolates was determined by Silva&#150;Vara <i>et al. </i>(2001). The citrus industry of M&eacute;xico is considered to be at immediate risk of CTV epidemics because sour orange is the predominant rootstock throughout the country and the presence of the most efficient vector, <i>Toxoptera citricida </i>(Kirkaldy), commonly called the brown citrus aphid (Rocha&#150;Pe&ntilde;a <i>et al., </i>2005; SAGARPA, 2006). The objectives of this study were to evaluate some of the molecular methods available and to determine whether some CTV isolates collected from Nuevo Le&oacute;n and Tamaulipas states, M&eacute;xico, are mild or severe.</font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>MATERIALS AND METHODS </b></font></p>     <p align="justify"><font face="verdana" size="2">Thirteen CTV isolates collected from orange trees in the state of Nuevo Le&oacute;n, (Silva&#150;Vara <i>et al., </i>2001) and one originally collected from the neighbouring state of Tamaulipas (Gonz&aacute;lez&#150;Garza, 1983<sup>&#91;<a href="#notas">7</a>&#93;</sup>) (<a href="#c1">Table 1</a>) were individually maintained <i>in planta </i>in at least two Mexican lime (c. <i>aurantifolid) </i>plants. Citrus samples were used either as fresh or dry tissue. Dry citrus tissue of type CTV isolates T36, T66 (declining, MCA+) and T55 (mild, MCA13&#150;) from Florida (Permar <i>et al., </i>1990; Rocha&#150;Pe&ntilde;a <i>et al., </i>1995b) were used as positive controls, for decline and mild isolates.</font></p>     <p align="center"><font face="verdana" size="2"><a name="c1"></a></font></p>     <p align="center"><font face="verdana" size="2"><img src="/img/revistas/agro/v44n4/a5c1.jpg"></font></p>     <p align="justify"><font face="verdana" size="2"><b>Serological strain discrimination</b></font></p>     <p align="justify"><font face="verdana" size="2">Serological reactivity of citrus extracts from plants infected with CTV isolates was evaluated against the strain discriminatory MCA13 monoclonal antibody in dot&#150;immunobinding assay (DIBA) (Rocha&#150;Pe&ntilde;a <i>et al., </i>1991). The MCA13 monoclonal antibody, from Nokomis Corp. (Florida, USA), was used at a 1:5000 (v/v) dilution and goat anti&#150;mouse IgG labeled with alkaline phosphatase (SIGMA A&#150;3688) at 1:30000 (v/v). A duplicate of the membranes containing the extracts of CTV infected and healthy citrus samples were run aside by using the CTV specific rabbit C3 antibodies (0.2 mg mL<sup>&#150;1</sup>) (Iracheta&#150;C&aacute;rdenas <i>et al., </i>2008); goat anti&#150;rabbit enzyme conjugate (Sigma A&#150;8025) was used at 1:30000 (v/v) dilution.</font></p>     <p align="justify"><font face="verdana" size="2"><b>Nucleic acid extraction</b></font></p>     <p align="justify"><font face="verdana" size="2">RNA extraction was performed according to the method of Pappu <i>et al. </i>(1993). Infected tissue (250 mg) was ground to powder with liquid nitrogen and homogenized with 500 <i>&#956;</i>L of TES buffer &#91;0.1 M Tris HCl, pH 8.0; 2 % SDS (w/v); 2 mMEDTA&#93;, 250 <i>&#956;</i>L phenol, 250 <i>&#956;</i>Lof a solution of chloroform&#150;isoamylic alcohol (24:1). Then it was heated at 70 &deg;C for 5 min, and centrifuged at 5000 rpm in a clinical centrifuge with a swinging bucket rotor (CCSBR), at 4 &deg;C during 5 min. The supernatant was then placed into a Sephadex G&#150;100&#150;50 column, the column was centrifuged again in a CCSBR at 1500 rpm during 4 min at 4 &deg;C, and the extract was recuperated in a microcentrifuge tube.</font></p>     <p align="justify"><font face="verdana" size="2"><b>Reverse transcription (RT) and polymerase chain reaction (PCR)</b></font></p>     <p align="justify"><font face="verdana" size="2">The RT&#150;PCR components were run in a final volume of 25 <i>&#956;</i>Las follows: 2.5 <i>&#956;</i>LPCR mix 10X, 0.75 <i>&#956;</i>LMgCl<sub>2</sub> (1.5 mM), 2.5 <i>&#956;</i>Lof dithiotreitol (0.1 M), 2.0 <i>&#956;</i>L(25 picomols) of each CN119 (5'&#150;AGATCTACCATGGACGACGAAAC AAAG&#150;3') /CN120 (5'&#150;GAATTCGCGGCCCGTCAAC GTGTGTTAAATTCC&#150;3') primers, 1.0 <i>&#956;</i>LAMLV reverse transcriptase (200 units), 0.5 <i>&#956;</i>LTaq DNA polymerase (2.5 units), 0.5 <i>&#956;</i>LRNasin, 5 <i>&#956;</i>Lof the viral RNA extract, 2.0 <i>&#956;</i>LdNTP's (200 <i>&#956;</i>M) and 6.25 <i>&#956;</i>Lof bidistilled water. The thermal programme was one cycle of 45 min at 42 &deg;C, followed by 35 cycles of 1 min at 94 &deg;C, 1 min at 55 &deg;C, 1 min at 72 &deg;C, and a final extension of 10 min at 72 &deg;C. The combination of CN119/CN120 primers yields a product size of approximate 700 bp.</font></p>     ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>Bidirectional polymerase chain reaction</b></font></p>     <p align="justify"><font face="verdana" size="2">Bidirectional PCR (BD&#150;PCR) was conducted according to Cevik <i>et al. </i>(1996). The protocol consists of one single two steps RT&#150;PCR runs with two external (CN118 and CN 119) and two internal &#91;CN218 (5'&#150;TTTGGACTGACGTCGTGTT&#150;3') and CN219 (5'&#150;TTCGTCGACGACGACAGGTA&#150;3')&#93; set of primers. BD&#150;PCR cocktail mixture and thermal program were conducted according to Cevik <i>et al. </i>(1996). The combination of CN218/CN120 and CN119/CN219 yield product sizes of approximate 300 and 400 bp, for decline inducing and mild CTV strains, (Cevik <i>et al., </i>1996).</font></p>     <p align="justify"><font face="verdana" size="2"><b>Hybridization with strain group specific DNA probes</b></font></p>     <p align="justify"><font face="verdana" size="2">Molecular   hybridization   was    conducted according to Cevik, 1997) and Halbert <i>et al. </i>(2003) with a set of specific DNA probes that have unique sequences for a strain discrimination of CTV isolates. The unique sequences of these strain specific probes are the subject of U.S. Patent # 6140046 (USP, 2000). Probe 0 contains a nucleotide sequence conserved in the CP gene of all known strains of CTV and hence it is a universal probe for CTV. Probe I hybridizes with decline&#150;inducing strains; Probes II, III, IV and V hybridize with different groups of stem&#150;pitting strains from various geographical origins throughout the world; Probes VI and VII hybridizes with mild strains from Florida and from Orient countries; Probe VIII hybridizes with all mild strains (Nibblet <i>et al., </i>2000). The cDNA from the well characterized T36 (decline on plants grafted on sour orange, seedling yellows), T30 (mild strains from Florida), B53, B185, B249 (decline on plants grafted on sour orange, seedling yellows, stem pitting on grapefruit or sweet orange or both), CTV isolates (Niblett <i>et al., </i>2000) was used as control. The amplified PCR products of the p25 gene of each CTV isolate was blotted on nylon membranes and assayed by hybridization using the CTV strain group specific probes labeled at the 5' end with biotin to react with a strepavidin conjugated alkaline phosphatase for detection of the hybridized amplicons by chemiluminescence (Cevik, 1997).</font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b>RESULTS AND DISCUSSION</b></font></p>     <p align="justify"><font face="verdana" size="2">The serological test performed with the C3 rabbit polyclonal antibodies gave a positive reaction with all the CTV isolates evaluated. CTV isolates T36 and T66 (decline) and T55 (mild) from Florida used as positive controls, gave positive reactions with the C3 rabbit polyclonal antibodies also (<a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Table 2</a>). The tests performed with the specific strain MCA13 monoclonal antibody gave a positive reaction with CTV isolates MX01 through MX07, MX11, MX13, MX14, and with the decline CTV isolates T36 and T66 CTV from Florida. The MCA 13 monoclonal antibody gave a negative reaction with CTV isolates MX08, MX09, MX10, and MX12 from M&eacute;xico and with the mild CTV isolate T55 from Florida. No positive reaction was obtained with healthy controls in either test (<a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Table 2</a>).</font></p>     <p align="justify"><font face="verdana" size="2">The RT&#150;PCR yielded an expected 700 bp cDNA fragment for all the CTV isolates from M&eacute;xico. The same 700 bp cDNA fragment was also obtained for the decline isolates T36, T66 and the mild isolate T55 CTV from Florida used as positive controls (data not shown). When the BD&#150;PCR (<a href="/img/revistas/agro/v44n4/a5f1.jpg" target="_blank">Figure 1</a>) was performed, a cDNA fragment of300 bp characteristic of decline of CTV isolates (MCA 13 + ) was obtained with isolates MX01 through MX08, MX13 and MX14, also, with Florida decline isolates T36 and T66 included as a control. A cDNA fragment of 400 bp cDNA characteristic of mild isolates of CTV (MCA 13&#151;) was obtained with samples MX08, MX09, and MX14 from M&eacute;xico and also with mild isolate T55 from Florida (<a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Table 2</a>).</font></p>     <p align="justify"><font face="verdana" size="2">The detection of both 400 and 300 bp amplicons in samples MX08 and MX14 can be interpreted as a mix&#150;infection of both mild and decline inducing CTV isolates in the same sample. The occurrence of mix&#150;infection of several CTV isolates is a common phenomenon in field samples (Brlansky <i>et al., </i>2003) and has been reported with the use of BD&#150;PCR (Cevik <i>et al., </i>1996; Huang <i>et al., </i>2004; Korkmaz <i>et al., </i>2008).</font></p>     <p align="justify"><font face="verdana" size="2">The BD&#150;PCR system for strain discrimination was developed on the basis of differences at position 371 of the p25 coat protein gene of MCA13 reacting ( + ) decline inducing or stem&#150;pitting severe and mild (MCA13 &#151;) CTV isolates (Cevik <i>et al., </i>1996). Severe CTV isolates yield a 300 bp amplicons, while mild CTV isolates produce 400 bp amplicons (Cevik <i>et al., </i>1996). The BD&#150;PCR has been used in some extent for strain discrimination purposes of CTV isolates (Huang <i>et al., </i>2004; Kormaz <i>et al., </i>2008; Nibblet <i>et al., </i>2000). There are some other RT&#150;PCR based systems for detection of CTV isolates (Hung <i>et al., </i>2000; Ruiz&#150;Ruiz <i>et al., </i>2009); however, the use of real&#150;time PCR reported for strain discrimination of CTV isolates (Ruiz&#150;Ruiz <i>et al., </i>2009) is relatively expensive and involves several different regions in the CTV genome, other than the p25 coat protein gene. Likewise, the use of RT&#150;PCR in a single step reported by Hung <i>et al. </i>(2000) do not discriminate between mild from severe isolates.</font></p>     ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">The tests conducted with strain group specific biotin&#150;labeled DNA probes are shown in <a href="#c3">Table 3</a>. All CTV isolates tested positive with the Probe 0 universal for all CTV isolates. Likewise, cDNA from T36, B53, B185, T3, B249, and T30, used as reference, reacted positively with their corresponding strain specific probes (<a href="#c3">Table 3</a>). The CTV isolates MX02 through MX07, and MX10 reacted with Probe II. The CTV isolates MX08, MX11 and MX12 reacted with Probe VIII and CTV isolate MX 13 reacted with both Probe VI and VIII. CTV isolate MX14 reacted with Probe V. The Probe VII specific to CTV isolates from Asiatic countries was not included in this study.</font></p>     <p align="center"><font face="verdana" size="2"><a name="c3"></a></font></p>     <p align="center"><font face="verdana" size="2"><img src="/img/revistas/agro/v44n4/a5c3.jpg"></font></p>     <p align="justify"><font face="verdana" size="2">According to these results, the reaction of samples MX02 through MX07, and MX10 from Nuevo Le&oacute;n with Probe II identified the presence of decline inducing CTV isolates in the samples analyzed. The reaction of sample MX14 with Probe V indicated the presence of a stem&#150;pitting isolate in the CTV sample originally collected in Tamaulipas.</font></p>     <p align="justify"><font face="verdana" size="2">The strain group specific biotin&#150;labeled DNA probes were designed on the basis of differences in the nucleotide sequences of the coat protein p25 gene of a number of CTV isolates with a range of different biological properties and from diverse geographical origins (Cevik, 1997; USP, 2000). These have been used for strain discrimination purposes of CTV isolates by several research groups (Gen&lt;j, 2004; Halbert <i>et al., </i>2004; Herron <i>et al., </i>2005). There has been another reported hybridization based system with cDNA specific probes for strain discrimination of CTV isolates (Narv&aacute;ez <i>et al., </i>2000); however, this system was not available for comparison in this study.</font></p>     <p align="justify"><font face="verdana" size="2">The information generated from this study showed the usefulness of the MCA13 monoclonal antibody, the BD&#150;PCR, and the biotin&#150;labeled strain group specific cDNA probes to discriminate CTV isolates from M&eacute;xico. These three methods were efficient to detect the presence of severe CTV isolates in Nuevo Le&oacute;n (<a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Table 2</a>, <a href="#c3">3</a> and <a href="/img/revistas/agro/v44n4/a5f1.jpg" target="_blank">Figure 1</a>).</font></p>     <p align="justify"><font face="verdana" size="2">Nevertheless, the three methods were not 100 % coincident in results for all the CTV isolates tested, particularly between the MCA13 monoclonal antibody and the other two molecular methods tested. The BD&#150;PCR yielded cDNA fragments of 300 and 400 bp for both MX08 and MX14 isolates (<a href="/img/revistas/agro/v44n4/a5f1.jpg" target="_blank">Figure 1</a>, <a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Table 2</a>). This indicates a possible mix&#150;infection in the original MX08 and MX14 samples with mild (MCA13&#151;) and decline (MCA13 + ) CTV isolates being present. The detection of the 300 bp fragment in BD&#150;PCR of the MX08 sample indicates that a severe isolate of CTV is also present. But, the lack of reactivity with the MCA13 can be attributed to a probable lower titer of this severe isolate, not detected by the serological assay. The higher sensitivity of BD&#150;PCR, as compared to serological assay has been reported for the detection of CTV field isolates (Huang <i>et al., </i>2004). This feature of potential failure to detect the presence of low titer severe decline inducing CTV isolates is a disadvantage of the MCA13 monoclonal antibody over the BD&#150;PCR. The amplification of the 400 bp product indicates that a mild isolate of CTV is also present in the same MX08 sample. Likewise, CTV isolate MX10 performed as a MCA13&#151; in the serological tests (<a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Table 2</a>), but reacted with Probe II (<a href="#c3">Table 3</a>) which is specific for severe decline inducing CTV isolates (Cevik, 1997; Nibblet <i>et al., </i>2000).</font></p>     <p align="justify"><font face="verdana" size="2">Both BD&#150;PCR and hybridization with specific DNA probes were almost a 100 % coincident with the results obtained (<a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Tables 2</a>, <a href="#c3">3</a>).</font></p>     <p align="justify"><font face="verdana" size="2">The lack of a 100 % coincidence mostly with the use of the MCA13 antibody over the molecular methods has been reported, and it can be attributed to the higher sensibility of the molecular methods (Huang <i>et al., </i>2004) and to the presence of mixed isolates of CTV in the original field sample after the passage through several citrus hosts (Nickel <i>et al., </i>1996).</font></p>     <p align="justify"><font face="verdana" size="2">The reactivity of the MCA13 monoclonal antibody, along with the amplification of 300 bp cDNA fragments in the BD&#150;PCR test (<a href="/img/revistas/agro/v44n4/a5f1.jpg" target="_blank">Figure 1</a>, <a href="/img/revistas/agro/v44n4/a5c2.jpg" target="_blank">Table 2</a>), and hybridization with Probe II with samples MX02 through MX08, MX11, MX13, and with Probe V by MX14 (<a href="#c3">Table 3</a>) provide evidence of the presence of severe CTV isolates in the samples collected from Nuevo Le&oacute;n and Tamaulipas. The detection of severe CTV isolates by molecular methods has also been documented for the states of Veracruz and Puebla by BD&#150;PCR (Almeyda&#150;Le&oacute;n <i>et al., </i>2007).</font></p>     ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">The finding of severe CTV isolates in the samples analyzed in this study, is of interest even in the absence of decline symptoms in field trees. The CTV has been a regulated pathogen in M&eacute;xico since 1997 and up to 2006, and 4468 symptomless CTV infected plants were detected in the 20 citrus producing states (SAGARPA, 2006). Although the original field CTV infected plants in Nuevo Le&oacute;n (Silva&#150;Vara <i>et al., </i>2001) and elsewhere in M&eacute;xico (SAGARPA, 2006) have been removed from the field, the occurrence of symptomless severe CTV isolates should not be ignored. These findings reinforce the need for continuing the CTV campaign nationwide. It has been documented that latent severe CTV isolates infections can be present in a citrus industry for many years, and even decades without any noticeable evidence of disease symptoms, until the unexpected decline due to CTV occurs when efficient aphid vectors either increase their populations or become established in new locations (Bar&#150;Joseph, 1978; Rocha&#150;Pe&ntilde;a <i>et al., </i>1995a, 1998). The brown citrus aphid <i>(Toxoptera citricida) </i>and the melon aphid <i>(Aphis gossypii) </i>are the most important aphid vectors of CTV (Rocha&#150;Pe&ntilde;a <i>et al., </i>1995a; Yokomi <i>et al., </i>1994), and both species are present in M&eacute;xico (Rocha&#150;Pe&ntilde;a <i>et al., </i>2005; SAGARPA, 2006; Silva&#150;Vara <i>et al., </i>2001). The <i>T. citricida </i>transmits CTV isolates 6 to 25 times more efficiently than <i>A. gossypii </i>(Yokomi <i>et al., </i>1994). Wherever the <i>T. citricida </i>has been introduced, severe decline strains of CTV have appeared, and in some instances, stem&#150;pitting strains of CTV (Halbert <i>et al., </i>2004; Rocha&#150;Pe&ntilde;a <i>et al., </i>1995a, 1998).</font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b>CONCLUSIONS</b></font></p>     <p align="justify"><font face="verdana" size="2">It can be concluded the usefulness of the serological and molecular tools for the discrimination of CTV isolates. Both BD&#150;PCR and hybridization with specific DNA probes were more suitable for strain discrimination of CTV isolates, than the MCA13 monoclonal antibody. The BD&#150;PCR was able to detect mixtures of mild and severe CTV isolates, while hybridization with specific DNA probes was suitable for detecting either mild, decline inducing and stem pitting CTV isolates. In the state of Nuevo Le&oacute;n severe CTV isolates were discovered.</font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b>ACKNOWLEDGMENTS</b></font></p>     <p align="justify"><font face="verdana" size="2">This research had support by Fundaci&oacute;n Produce Nuevo Le&oacute;n, A. C. grant No. 1322, CONACYT&#150;SIREYES Project No. 032/95, both Institutions from M&eacute;xico, and by the USDA/University of Florida Specific Cooperative Research Agreement and the Binational Agricultural Research and Development with Israel (BARD). Journal Series Number INIFAP/CIRNE/A&#150;447.</font></p>     <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b>LITERATURE CITED </b></font></p>     <!-- ref --><p align="justify"><font face="verdana" size="2">Almeyda&#150;Le&oacute;n, I. H., M. A. Rocha&#150;Pe&ntilde;a, M. M. Iracheta&#150;C&aacute;rdenas, F. Orona&#150;Castro, y R. X. Loredo&#150;Salazar. 2007. T&eacute;cnicas moleculares para detectar enfermedades vasculares en c&iacute;tricos. Primera Semana Internacional de la Citricultura. INIFAP, Campo Experimental Ixtacuaco. Mart&iacute;nez de la Torre, Veracruz, M&eacute;xico. 117 p.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546244&pid=S1405-3195201000040000500001&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Bar&#150;Joseph, M. 1978. Cross&#150;protection incompleteness: A possible cause for natural spread of <i>citrus tristeza virus </i>after a prolonged lag period in Israel. Phytopathology 68: 1110&#150;1111.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546245&pid=S1405-3195201000040000500002&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Brlansky, R. H., V. D. Damsteegt, D. S. Howd, and A. Roy. 2003. Molecular analyses of <i>Citrus tristeza virus </i>subisolates separated by aphid transmission. Plant Dis. 87: 397&#150;401.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546246&pid=S1405-3195201000040000500003&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Cevik, B., S. S. Pappu, H. R. Pappu, D. Benscher, M. Irey, R. F. Lee, and C. L. Niblett. 1996. Application of bidirectional PCR to citrus tristeza virus: detection and strain differentiation. <i>In: </i>J. V. da Graca, P. Moreno, and L. W. Timmer (eds). Proc. 13th Conf. Intern. Organ. Citrus Virol. Riverside, California. pp: 17&#150;24.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546247&pid=S1405-3195201000040000500004&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Garnsey, S. M., E. L. Civerolo, D. J. Gumpf, C. Paul, M. E. Hilf, R. F. Lee, R. H. Brlansky, R. K. Yokomi, and J. S. Hartung. 2005. Biological characterization of an international collection of <i>Citrus tristeza virus </i>(CTV) isolates. <i>In: </i>M. E. Hilf, N. Dur&aacute;n&#150;Vila, and M. A. Rocha&#150;Pe&ntilde;a (eds). Proc. 16th Conf. Intern. Organ. Citrus Virol. Riverside, California. pp: 75&#150;93. </font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546248&pid=S1405-3195201000040000500005&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Gen&ccedil;, H. 2005. A new method for the detection of minor populations of citrus tristeza virus strains infecting single citrus trees. Turk. J. Agric. For. 29: 449&#150;459.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546249&pid=S1405-3195201000040000500006&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Halbert, S. E., H. Gen&ccedil;, B. Cevik, L. G. Brown, I. M. Rosales, K. L. Manjunath, M. Pomerinke, D. A. Davison, R. F. Lee, and C. L. Niblett. 2004. Distribution and characterization of <i>Citrus tristeza virus </i>in south Florida following establishment of <i>Toxoptera citricida. </i>Plant Dis. 88: 935&#150;941.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546250&pid=S1405-3195201000040000500007&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Herron, C. M., T. E. Mirkov, N. Sol&iacute;s&#150;Gracia, C. J. Kahlke, M. Skaria, and J. V. da Graca. 2005. Severity of <i>Citrus tristeza virus </i>isolates from Texas. Plant Dis. 89: 575&#150;580.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546251&pid=S1405-3195201000040000500008&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Huang, Z., P. Rundell, X. Guan, and C. A. Powell. 2004. Detection and isolate differentiation of <i>Citrus tristeza virus </i>in infected field trees based on reverse transcription polymerase chain reaction. Plant Dis. 88: 625&#150;629.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546252&pid=S1405-3195201000040000500009&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Hung, T. H., M. L. Wu, and H. J. Su. 2000. A rapid method based on the one&#150;step reverse transcriptase&#150;polymerase chain reaction (RTPCR) technique for detection of different strains of <i>Citrus tristeza virus. </i>J. Phytopathol. 148: 469&#150;475.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546253&pid=S1405-3195201000040000500010&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Iracheta&#150;C&aacute;rdenas, M., B. D. Sandoval&#150;Alejos, M. E. Rom&aacute;n&#150;Calder&oacute;n, K. L. Manjunath, R. F. Lee, and M. A. Rocha&#150;Pe&ntilde;a. 2008. Production of polyclonal antibodies to the recombinant coat protein of <i>Citrus tristeza virus </i>and their effectiveness for virus detection. J. Phytopathol. 156: 243&#150;250.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546254&pid=S1405-3195201000040000500011&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Korkmaz, S., B. Cevyk, S. &Oacute;nder, and N. K. Koc. 2008. Biological, serological, and molecular characterization of <i>Citrus tristeza virus </i>isolates from different citrus cultivation regions of Turkey. Turkish J. Agric. For. 32: 369&#150;379.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546255&pid=S1405-3195201000040000500012&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Marques, N. T., A. M. Bailey, C. L. Niblett, and G. Nolasco. 2006. Differentiation of <i>Citrus tristeza virus </i>(CTV) isolates by cleavage fragment length polymorphism (CFLP) analysis of the major coat protein gene. Phytopathologia Mediterranea 45: 99&#150;109.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546256&pid=S1405-3195201000040000500013&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Narv&aacute;ez, G., B. S. Skander, M. A. Ayll&oacute;n, L. Rubio, J. Guerri, and P. Moreno. 2000. A new procedure to differentiate <i>Citrus tristeza virus </i>isolates by hybridisation with digoxigeninlabelled cDNA probes. J. Virol. Methods 85: 83&#150;92.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546257&pid=S1405-3195201000040000500014&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Niblett, C. L., H. Gen&ccedil;, B. Cevik, S. Halbert, L. Brown, G. Nolasco, G. Bonacalza, K. L. Manjunath, V. J. Febres, H. R. Pappu, and R. F. Lee. 2000. Progress on strain differentiation of <i>Citrus tristeza virus </i>and its application to the epidemiology of the citrus tristeza disease. Virus Research 71: 91&#150;106.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546258&pid=S1405-3195201000040000500015&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Nickel, O., H. P. Santos Filho, and A. D. Vilarinhos. 1996. Segregation of citrus tristeza virus strains by graft propagation. <i>In: </i>J. V. Graca, P. Moreno, and R. K. Yokomi (eds). Proc. 13th Conf. Int. Organ. Citrus Virol. Riverside, California. pp: 64&#150;70. </font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546259&pid=S1405-3195201000040000500016&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Nikolaeva, O. V., A. V. Karasev, S. M. Garnsey, and R. F. Lee. 1998. Serological differentiation of the citrus tristeza virus isolates causing stem pitting in sweet orange. Plant Dis. 82: 1276&#150;1280.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546260&pid=S1405-3195201000040000500017&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Pappu, H. R., S. S. Pappu, C. L. Niblett, R. F. Lee, R. F., and E. L. Civerolo. 1993. Comparative sequence analysis of the coat protein gene of biologically distinct citrus tristeza virus isolates. Virus Genes 7: 255&#150;264.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546261&pid=S1405-3195201000040000500018&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Permar, T. A., S. M. Garnsey, D. J. Gumpf, and R. F. Lee. 1990. A monoclonal antibody that discriminates strains of citrus tristeza virus. Phytopathology 80: 224&#150;228. </font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546262&pid=S1405-3195201000040000500019&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Rocha&#150;Pe&ntilde;a M. A., F. M. Ochoa&#150;Corona, J. P. Mart&iacute;nez&#150;Soriano, C. N. Roistacher, and R. F. Lee. 1998. Citrus tristeza virus: Events that occur before, during and after the disease epidemics. Subtropical Plant Sci. 50: 26&#150;36. </font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546263&pid=S1405-3195201000040000500020&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Rocha&#150;Pe&ntilde;a, M. A., J. I. L&oacute;pez&#150;Arroyo, M. A. Pe&ntilde;a del R&iacute;o, and I. H. Almeyda&#150;Le&oacute;n. 2005. Current situation on citrus virus and virus&#150;like diseases and their vectors in Mexico. <i>In: </i>N. Dur&aacute;n&#150;Vila, M. E. Hilf, M. A. Rocha&#150;Pe&ntilde;a (eds). Proc 16th Conf Intern Organ Citrus Virol. Riverside, California. pp: 381&#150;385.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546264&pid=S1405-3195201000040000500021&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Rocha&#150;Pe&ntilde;a, M. A., R. F. Lee, and C. L. Nibblet. 1991. Development of a dot&#150;immunobinding assay for citrus tristeza virus. J. Virol. Methods 34: 297&#150;309.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546265&pid=S1405-3195201000040000500022&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Rocha&#150;Pe&ntilde;a, M. A., R. F. Lee, R. Lastra, C. L. Niblett, F. M. Ochoa&#150;Corona, S. M. Garnsey, and R. K. Yokomi. 1995a. <i>Citrus tristeza virus </i>and its aphid vector <i>Toxoptera citricida: </i>Threats to citrus production in the Caribbean and Central and North America. Plant Dis. 79: 437&#150;445.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546266&pid=S1405-3195201000040000500023&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Rocha&#150;Pe&ntilde;a, M. A., R. F. Lee, and R. K. Yokomi. 1995b. Biological properties and aphid transmission of selected citrus tristeza virus isolates from Florida. Rev. Mex. Fitopatol. 13: 88&#150;94.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546267&pid=S1405-3195201000040000500024&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Roy, A., P. Ramachandran, and R.H. Brlansky. 2003. Grouping and comparison of Indian citrus tristeza virus isolates based on coat protein gene sequences and restriction analysis patterns. Arch. Virol. 148: 707&#150;722. </font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546268&pid=S1405-3195201000040000500025&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">SAGARPA.   2006.  Avances  del  Programa Nacional de Reconversi&oacute;n Productiva de la Cadena Citr&iacute;cola. Secretar&iacute;a de Agricultura,   Ganader&iacute;a,   Desarrollo   Rural,   Pesca y Alimentaci&oacute;n. M&eacute;xico. 24 p. </font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546269&pid=S1405-3195201000040000500026&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Silva&#150;Vara, S., M. A. Pe&ntilde;a del R&iacute;o, R. Pe&ntilde;a&#150;Mart&iacute;nez, N. Villegas&#150;Jim&eacute;nez, K. F. Byerly&#150;Murphy, y M. A. Rocha&#150;Pe&ntilde;a. 2001. Distribuci&oacute;n del virus de la tristeza en tres plantaciones comerciales de c&iacute;tricos del estado de Nuevo Le&oacute;n, M&eacute;xico. Agrociencia 35: 441&#150;450. </font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546270&pid=S1405-3195201000040000500027&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">USP. 2000. Detection and differentiation of specific strains of <i>Citrus tristeza virus. </i>United States Patent Number 6,140,046. <a href="http://www.freepatentsonline.com/6140046.html" target="_blank">http://www.freepatentsonline.com/6140046.html</a> (Accessed January, 2008).</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546271&pid=S1405-3195201000040000500028&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Yokomi, R. K., R. Lastra, M. B. Stoetzel, V. D. Damgsteet, R. F. Lee, S. M. Garnsey, T. R. Gottwald, M. A. Rocha&#150;Pe&ntilde;a, and C. L. Niblett. 1994. Establishment of the brown citrus aphid <i>Toxoptera citricida </i>(Kirkaldy) (Homoptera: Aphididae) in Central America and the Caribbean basin and its transmission of citrus tristeza virus. J. Econ. Entomol. 87: 1078&#150;1085.</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=546272&pid=S1405-3195201000040000500029&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><p align="justify"><font face="verdana" size="2">&nbsp;</font></p>     <p align="justify"><font face="verdana" size="2"><b><a name="notas" id="notas"></a>NOTES</b></font></p>     ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><sup>6</sup> Cevik, B. 1997. Molecular differentiation of strains of <i>Citrus tristeza virus </i>using the coat protein gene sequences. MSc. Thesis. University of Florida. Gainesville. 112 p.</font></p>     <p align="justify"><font face="verdana" size="2"><sup>7</sup> Gonz&aacute;lez&#150;Garza, R. 1983. Identificaci&oacute;n y control de las virosis de los c&iacute;tricos en los estados de Nuevo Le&oacute;n y Tamaulipas. Informe de Labores. CAEGET/INIA/SARH. Convenio Cooperativo de Investigaci&oacute;n en Virolog&iacute;a Vegetal INIFAP&#150;UANL. Monterrey, Nuevo Le&oacute;n, M&eacute;xico (Mimeo). 175 p.</font></p>      ]]></body><back>
<ref-list>
<ref id="B1">
<nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Almeyda-León]]></surname>
<given-names><![CDATA[I. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Iracheta-Cárdenas]]></surname>
<given-names><![CDATA[M. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Orona-Castro]]></surname>
<given-names><![CDATA[F]]></given-names>
</name>
<name>
<surname><![CDATA[Loredo-Salazar]]></surname>
<given-names><![CDATA[R. X.]]></given-names>
</name>
</person-group>
<source><![CDATA[Técnicas moleculares para detectar enfermedades vasculares en cítricos]]></source>
<year>2007</year>
<page-range>117</page-range><publisher-loc><![CDATA[Martínez de la Torre^eVeracruz Veracruz]]></publisher-loc>
<publisher-name><![CDATA[INIFAP]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B2">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Bar-Joseph]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Cross-protection incompleteness: A possible cause for natural spread of citrus tristeza virus after a prolonged lag period in Israel]]></article-title>
<source><![CDATA[Phytopathology]]></source>
<year>1978</year>
<volume>68</volume>
<page-range>1110-1111</page-range></nlm-citation>
</ref>
<ref id="B3">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Brlansky]]></surname>
<given-names><![CDATA[R. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Damsteegt]]></surname>
<given-names><![CDATA[V. D.]]></given-names>
</name>
<name>
<surname><![CDATA[Howd]]></surname>
<given-names><![CDATA[D. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Roy]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Molecular analyses of Citrus tristeza virus subisolates separated by aphid transmission]]></article-title>
<source><![CDATA[Plant Dis.]]></source>
<year>2003</year>
<volume>87</volume>
<page-range>397-401</page-range></nlm-citation>
</ref>
<ref id="B4">
<nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Cevik]]></surname>
<given-names><![CDATA[B]]></given-names>
</name>
<name>
<surname><![CDATA[Pappu]]></surname>
<given-names><![CDATA[S. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Pappu]]></surname>
<given-names><![CDATA[H. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Benscher]]></surname>
<given-names><![CDATA[D]]></given-names>
</name>
<name>
<surname><![CDATA[Irey]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Application of bidirectional PCR to citrus tristeza virus: detection and strain differentiation]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Graca]]></surname>
<given-names><![CDATA[J. V. da]]></given-names>
</name>
<name>
<surname><![CDATA[Moreno]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
<name>
<surname><![CDATA[Timmer]]></surname>
<given-names><![CDATA[L. W.]]></given-names>
</name>
</person-group>
<source><![CDATA[Proc. 13th Conf. Intern. Organ. Citrus Virol.]]></source>
<year>1996</year>
<page-range>17-24</page-range><publisher-loc><![CDATA[Riverside^eCalifornia California]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B5">
<nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Garnsey]]></surname>
<given-names><![CDATA[S. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Civerolo]]></surname>
<given-names><![CDATA[E. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Gumpf]]></surname>
<given-names><![CDATA[D. J.]]></given-names>
</name>
<name>
<surname><![CDATA[Paul]]></surname>
<given-names><![CDATA[C]]></given-names>
</name>
<name>
<surname><![CDATA[Hilf]]></surname>
<given-names><![CDATA[M. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Brlansky]]></surname>
<given-names><![CDATA[R. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Yokomi]]></surname>
<given-names><![CDATA[R. K.]]></given-names>
</name>
<name>
<surname><![CDATA[Hartung]]></surname>
<given-names><![CDATA[J. S.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Biological characterization of an international collection of Citrus tristeza virus (CTV) isolates]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Hilf]]></surname>
<given-names><![CDATA[M. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Durán-Vila]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
</person-group>
<source><![CDATA[Proc. 16th Conf. Intern. Organ. Citrus Virol]]></source>
<year>2005</year>
<page-range>75-93</page-range><publisher-loc><![CDATA[Riverside^eCalifornia California]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B6">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Genç]]></surname>
<given-names><![CDATA[H]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A new method for the detection of minor populations of citrus tristeza virus strains infecting single citrus trees]]></article-title>
<source><![CDATA[Turk. J. Agric. For.]]></source>
<year>2005</year>
<volume>29</volume>
<page-range>449-459</page-range></nlm-citation>
</ref>
<ref id="B7">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Halbert]]></surname>
<given-names><![CDATA[S. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Genç]]></surname>
<given-names><![CDATA[H]]></given-names>
</name>
<name>
<surname><![CDATA[Cevik]]></surname>
<given-names><![CDATA[B]]></given-names>
</name>
<name>
<surname><![CDATA[Brown]]></surname>
<given-names><![CDATA[L. G.]]></given-names>
</name>
<name>
<surname><![CDATA[Rosales]]></surname>
<given-names><![CDATA[I. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Manjunath]]></surname>
<given-names><![CDATA[K. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Pomerinke]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Davison]]></surname>
<given-names><![CDATA[D. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Distribution and characterization of Citrus tristeza virus in south Florida following establishment of Toxoptera citricida]]></article-title>
<source><![CDATA[Plant Dis.]]></source>
<year>2004</year>
<volume>88</volume>
<page-range>935-941</page-range></nlm-citation>
</ref>
<ref id="B8">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Herron]]></surname>
<given-names><![CDATA[C. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Mirkov]]></surname>
<given-names><![CDATA[T. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Solís-Gracia]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
<name>
<surname><![CDATA[Kahlke]]></surname>
<given-names><![CDATA[C. J.]]></given-names>
</name>
<name>
<surname><![CDATA[Skaria]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Graca]]></surname>
<given-names><![CDATA[J. V. da]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Severity of Citrus tristeza virus isolates from Texas]]></article-title>
<source><![CDATA[Plant Dis.]]></source>
<year>2005</year>
<volume>89</volume>
<page-range>575-580</page-range></nlm-citation>
</ref>
<ref id="B9">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Huang]]></surname>
<given-names><![CDATA[Z]]></given-names>
</name>
<name>
<surname><![CDATA[Rundell]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
<name>
<surname><![CDATA[Guan]]></surname>
<given-names><![CDATA[X]]></given-names>
</name>
<name>
<surname><![CDATA[Powell]]></surname>
<given-names><![CDATA[C. A.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Detection and isolate differentiation of Citrus tristeza virus in infected field trees based on reverse transcription polymerase chain reaction]]></article-title>
<source><![CDATA[Plant Dis.]]></source>
<year>2004</year>
<volume>88</volume>
<page-range>625-629</page-range></nlm-citation>
</ref>
<ref id="B10">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Hung]]></surname>
<given-names><![CDATA[T. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Wu]]></surname>
<given-names><![CDATA[M. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Su]]></surname>
<given-names><![CDATA[H. J.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A rapid method based on the one-step reverse transcriptase-polymerase chain reaction (RTPCR) technique for detection of different strains of Citrus tristeza virus]]></article-title>
<source><![CDATA[J. Phytopathol.]]></source>
<year>2000</year>
<volume>148</volume>
<page-range>469-475</page-range></nlm-citation>
</ref>
<ref id="B11">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Iracheta-Cárdenas]]></surname>
<given-names><![CDATA[M]]></given-names>
</name>
<name>
<surname><![CDATA[Sandoval-Alejos]]></surname>
<given-names><![CDATA[B. D.]]></given-names>
</name>
<name>
<surname><![CDATA[Román-Calderón]]></surname>
<given-names><![CDATA[M. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Manjunath]]></surname>
<given-names><![CDATA[K. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Production of polyclonal antibodies to the recombinant coat protein of Citrus tristeza virus and their effectiveness for virus detection]]></article-title>
<source><![CDATA[J. Phytopathol.]]></source>
<year>2008</year>
<volume>156</volume>
<page-range>243-250</page-range></nlm-citation>
</ref>
<ref id="B12">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Korkmaz]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Cevyk]]></surname>
<given-names><![CDATA[B]]></given-names>
</name>
<name>
<surname><![CDATA[Ónder]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Koc]]></surname>
<given-names><![CDATA[N. K.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Biological, serological, and molecular characterization of Citrus tristeza virus isolates from different citrus cultivation regions of Turkey]]></article-title>
<source><![CDATA[Turkish J. Agric. For.]]></source>
<year>2008</year>
<volume>32</volume>
<page-range>369-379</page-range></nlm-citation>
</ref>
<ref id="B13">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Marques]]></surname>
<given-names><![CDATA[N. T.]]></given-names>
</name>
<name>
<surname><![CDATA[Bailey]]></surname>
<given-names><![CDATA[A. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Nolasco]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Differentiation of Citrus tristeza virus (CTV) isolates by cleavage fragment length polymorphism (CFLP) analysis of the major coat protein gene]]></article-title>
<source><![CDATA[Phytopathologia Mediterranea]]></source>
<year>2006</year>
<volume>45</volume>
<page-range>99-109</page-range></nlm-citation>
</ref>
<ref id="B14">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Narváez]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
<name>
<surname><![CDATA[Skander]]></surname>
<given-names><![CDATA[B. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Ayllón]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Rubio]]></surname>
<given-names><![CDATA[L]]></given-names>
</name>
<name>
<surname><![CDATA[Guerri]]></surname>
<given-names><![CDATA[J]]></given-names>
</name>
<name>
<surname><![CDATA[Moreno]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A new procedure to differentiate Citrus tristeza virus isolates by hybridisation with digoxigeninlabelled cDNA probes]]></article-title>
<source><![CDATA[J. Virol. Methods]]></source>
<year>2000</year>
<volume>85</volume>
<page-range>83-92</page-range></nlm-citation>
</ref>
<ref id="B15">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Genç]]></surname>
<given-names><![CDATA[H]]></given-names>
</name>
<name>
<surname><![CDATA[Cevik]]></surname>
<given-names><![CDATA[B]]></given-names>
</name>
<name>
<surname><![CDATA[Halbert]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Brown]]></surname>
<given-names><![CDATA[L]]></given-names>
</name>
<name>
<surname><![CDATA[Nolasco]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
<name>
<surname><![CDATA[Bonacalza]]></surname>
<given-names><![CDATA[G]]></given-names>
</name>
<name>
<surname><![CDATA[Manjunath]]></surname>
<given-names><![CDATA[K. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Febres]]></surname>
<given-names><![CDATA[V. J.]]></given-names>
</name>
<name>
<surname><![CDATA[Pappu]]></surname>
<given-names><![CDATA[H. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Progress on strain differentiation of Citrus tristeza virus and its application to the epidemiology of the citrus tristeza disease]]></article-title>
<source><![CDATA[Virus Research]]></source>
<year>2000</year>
<volume>71</volume>
<page-range>91-106</page-range></nlm-citation>
</ref>
<ref id="B16">
<nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Nickel]]></surname>
<given-names><![CDATA[O]]></given-names>
</name>
<name>
<surname><![CDATA[Santos Filho]]></surname>
<given-names><![CDATA[H. P.]]></given-names>
</name>
<name>
<surname><![CDATA[Vilarinhos]]></surname>
<given-names><![CDATA[A. D.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Segregation of citrus tristeza virus strains by graft propagation]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Graca]]></surname>
<given-names><![CDATA[J. V.]]></given-names>
</name>
<name>
<surname><![CDATA[Moreno]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
<name>
<surname><![CDATA[Yokomi]]></surname>
<given-names><![CDATA[R. K.]]></given-names>
</name>
</person-group>
<source><![CDATA[Proc. 13th Conf. Int. Organ. Citrus Virol.]]></source>
<year>1996</year>
<page-range>64-70</page-range><publisher-loc><![CDATA[Riverside^eCalifornia California]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B17">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Nikolaeva]]></surname>
<given-names><![CDATA[O. V.]]></given-names>
</name>
<name>
<surname><![CDATA[Karasev]]></surname>
<given-names><![CDATA[A. V.]]></given-names>
</name>
<name>
<surname><![CDATA[Garnsey]]></surname>
<given-names><![CDATA[S. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Serological differentiation of the citrus tristeza virus isolates causing stem pitting in sweet orange]]></article-title>
<source><![CDATA[Plant Dis.]]></source>
<year>1998</year>
<volume>82</volume>
<page-range>1276-1280</page-range></nlm-citation>
</ref>
<ref id="B18">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Pappu]]></surname>
<given-names><![CDATA[H. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Pappu]]></surname>
<given-names><![CDATA[S. S.]]></given-names>
</name>
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Civerolo]]></surname>
<given-names><![CDATA[E. L.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Comparative sequence analysis of the coat protein gene of biologically distinct citrus tristeza virus isolates]]></article-title>
<source><![CDATA[Virus Genes]]></source>
<year>1993</year>
<volume>7</volume>
<page-range>255-264</page-range></nlm-citation>
</ref>
<ref id="B19">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Permar]]></surname>
<given-names><![CDATA[T. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Garnsey]]></surname>
<given-names><![CDATA[S. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Gumpf]]></surname>
<given-names><![CDATA[D. J.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A monoclonal antibody that discriminates strains of citrus tristeza virus]]></article-title>
<source><![CDATA[Phytopathology]]></source>
<year>1990</year>
<volume>80</volume>
<page-range>224-228</page-range></nlm-citation>
</ref>
<ref id="B20">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Ochoa-Corona]]></surname>
<given-names><![CDATA[F. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Martínez-Soriano]]></surname>
<given-names><![CDATA[J. P.]]></given-names>
</name>
<name>
<surname><![CDATA[Roistacher]]></surname>
<given-names><![CDATA[C. N.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Citrus tristeza virus: Events that occur before, during and after the disease epidemics]]></article-title>
<source><![CDATA[Subtropical Plant Sci.]]></source>
<year>1998</year>
<volume>50</volume>
<page-range>26-36</page-range></nlm-citation>
</ref>
<ref id="B21">
<nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[López-Arroyo]]></surname>
<given-names><![CDATA[J. I.]]></given-names>
</name>
<name>
<surname><![CDATA[Peña del Río]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Almeyda-León]]></surname>
<given-names><![CDATA[I. H.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Current situation on citrus virus and virus-like diseases and their vectors in Mexico]]></article-title>
<person-group person-group-type="editor">
<name>
<surname><![CDATA[Durán-Vila]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
<name>
<surname><![CDATA[Hilf]]></surname>
<given-names><![CDATA[M. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
</person-group>
<source><![CDATA[Proc 16th Conf Intern Organ Citrus Virol.]]></source>
<year>2005</year>
<page-range>381-385</page-range><publisher-loc><![CDATA[Riverside ]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B22">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Nibblet]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Development of a dot-immunobinding assay for citrus tristeza virus]]></article-title>
<source><![CDATA[J. Virol. Methods]]></source>
<year>1991</year>
<volume>34</volume>
<page-range>297-309</page-range></nlm-citation>
</ref>
<ref id="B23">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Lastra]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Ochoa-Corona]]></surname>
<given-names><![CDATA[F. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Garnsey]]></surname>
<given-names><![CDATA[S. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Yokomi]]></surname>
<given-names><![CDATA[R. K.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Citrus tristeza virus and its aphid vector Toxoptera citricida: Threats to citrus production in the Caribbean and Central and North America]]></article-title>
<source><![CDATA[Plant Dis.]]></source>
<year>1995</year>
<volume>79</volume>
<page-range>437-445</page-range></nlm-citation>
</ref>
<ref id="B24">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Yokomi]]></surname>
<given-names><![CDATA[R. K.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Biological properties and aphid transmission of selected citrus tristeza virus isolates from Florida]]></article-title>
<source><![CDATA[Rev. Mex. Fitopatol.]]></source>
<year>1995</year>
<volume>13</volume>
<page-range>88-94</page-range></nlm-citation>
</ref>
<ref id="B25">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Roy]]></surname>
<given-names><![CDATA[A]]></given-names>
</name>
<name>
<surname><![CDATA[Ramachandran]]></surname>
<given-names><![CDATA[P]]></given-names>
</name>
<name>
<surname><![CDATA[Brlansky]]></surname>
<given-names><![CDATA[R.H.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Grouping and comparison of Indian citrus tristeza virus isolates based on coat protein gene sequences and restriction analysis patterns]]></article-title>
<source><![CDATA[Arch. Virol.]]></source>
<year>2003</year>
<volume>148</volume>
<page-range>707-722</page-range></nlm-citation>
</ref>
<ref id="B26">
<nlm-citation citation-type="book">
<collab>SAGARPA</collab>
<source><![CDATA[Avances del Programa Nacional de Reconversión Productiva de la Cadena Citrícola]]></source>
<year>2006</year>
<page-range>24</page-range><publisher-name><![CDATA[Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B27">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Silva-Vara]]></surname>
<given-names><![CDATA[S]]></given-names>
</name>
<name>
<surname><![CDATA[Peña del Río]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Peña-Martínez]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Villegas-Jiménez]]></surname>
<given-names><![CDATA[N]]></given-names>
</name>
<name>
<surname><![CDATA[Byerly-Murphy]]></surname>
<given-names><![CDATA[K. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Distribución del virus de la tristeza en tres plantaciones comerciales de cítricos del estado de Nuevo León, México]]></article-title>
<source><![CDATA[Agrociencia]]></source>
<year>2001</year>
<volume>35</volume>
<page-range>441-450</page-range></nlm-citation>
</ref>
<ref id="B28">
<nlm-citation citation-type="">
<collab>USP</collab>
<source><![CDATA[Detection and differentiation of specific strains of Citrus tristeza virus]]></source>
<year>2000</year>
</nlm-citation>
</ref>
<ref id="B29">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Yokomi]]></surname>
<given-names><![CDATA[R. K.]]></given-names>
</name>
<name>
<surname><![CDATA[Lastra]]></surname>
<given-names><![CDATA[R]]></given-names>
</name>
<name>
<surname><![CDATA[Stoetzel]]></surname>
<given-names><![CDATA[M. B.]]></given-names>
</name>
<name>
<surname><![CDATA[Damgsteet]]></surname>
<given-names><![CDATA[V. D.]]></given-names>
</name>
<name>
<surname><![CDATA[Lee]]></surname>
<given-names><![CDATA[R. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Garnsey]]></surname>
<given-names><![CDATA[S. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Gottwald]]></surname>
<given-names><![CDATA[T. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Rocha-Peña]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Niblett]]></surname>
<given-names><![CDATA[C. L.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Establishment of the brown citrus aphid Toxoptera citricida (Kirkaldy) (Homoptera: Aphididae) in Central America and the Caribbean basin and its transmission of citrus tristeza virus]]></article-title>
<source><![CDATA[J. Econ. Entomol.]]></source>
<year>1994</year>
<volume>87</volume>
<page-range>1078-1085</page-range></nlm-citation>
</ref>
</ref-list>
</back>
</article>
