<?xml version="1.0" encoding="ISO-8859-1"?><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id>1027-152X</journal-id>
<journal-title><![CDATA[Revista Chapingo. Serie horticultura]]></journal-title>
<abbrev-journal-title><![CDATA[Rev. Chapingo Ser.Hortic]]></abbrev-journal-title>
<issn>1027-152X</issn>
<publisher>
<publisher-name><![CDATA[Universidad Autónoma Chapingo]]></publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id>S1027-152X2015000200005</article-id>
<article-id pub-id-type="doi">10.5154/r.rchsh.2015.01.001</article-id>
<title-group>
<article-title xml:lang="en"><![CDATA[Enological potential of native non-Saccharomyces yeasts from vineyards established in Queretaro, Mexico]]></article-title>
<article-title xml:lang="es"><![CDATA[Potencial enológico de levaduras no-Saccharomyces nativas de viñedos establecidos en Querétaro, México]]></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Ortiz-Barrera]]></surname>
<given-names><![CDATA[Eunice]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Miranda-Castilleja]]></surname>
<given-names><![CDATA[Dalia Elizabeth]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Arvizu-Medrano]]></surname>
<given-names><![CDATA[Sofía María]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Pacheco-Aguilar]]></surname>
<given-names><![CDATA[Juan Ramiro]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Aldrete-Tapia]]></surname>
<given-names><![CDATA[Jesús Alejandro]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Hernández-Iturriaga]]></surname>
<given-names><![CDATA[Montserrat]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname><![CDATA[Martínez-Peniche]]></surname>
<given-names><![CDATA[Ramón Álvar]]></given-names>
</name>
<xref ref-type="aff" rid="A01"/>
</contrib>
</contrib-group>
<aff id="A01">
<institution><![CDATA[,Universidad Autónoma de Querétaro Facultad de Química División de Estudios de Posgrado]]></institution>
<addr-line><![CDATA[Querétaro ]]></addr-line>
<country>México</country>
</aff>
<pub-date pub-type="pub">
<day>00</day>
<month>08</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="epub">
<day>00</day>
<month>08</month>
<year>2015</year>
</pub-date>
<volume>21</volume>
<numero>2</numero>
<fpage>169</fpage>
<lpage>183</lpage>
<copyright-statement/>
<copyright-year/>
<self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S1027-152X2015000200005&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_abstract&amp;pid=S1027-152X2015000200005&amp;lng=en&amp;nrm=iso"></self-uri><self-uri xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_pdf&amp;pid=S1027-152X2015000200005&amp;lng=en&amp;nrm=iso"></self-uri><abstract abstract-type="short" xml:lang="en"><p><![CDATA[Currently, the state of Queretaro is a major wine producer in Mexico; however, marketing these wines is difficult due to their lack of quality and typicity, factors in which wine yeasts play an essential role. Saccharomyes are responsible for ethanol production and non-Saccharomyes (nS) can provide metabolites that enhance wine quality, so their use in mixed cultures is of great interest. In this study, yeasts isolated from the spontaneous fermentation of grape musts from three local vineyards were differentiated as nS in lysine medium. Their &#946;-glucosidase activity and SO2 (30 mg·L-1) and ethanol (6 %) tolerances were evaluated. Outstanding yeasts were tested in mixed microvinifications along with S. cerevisiae (K1-V1116) and identified through analysis of the 26S gene. Of 197 isolated strains, 146 were differentiated as nS; 90 showed &#946;glucosidase activity and eight (NB1, NA4, NB27, NB31, NB39, NR77, NR90, NB108) were selected based on tolerance tests, being identified as belonging to the genus Hanseniaspora. The nS did not interfere with the fermentative activity of K1-V1116, finding no differences in the parameters evaluated between the wines obtained by mixed cultures and the control (K1-V1116). The values obtained for pH, total acidity, volatile acidity and alcohol were considered to be of acceptable quality for dry wines. The strain NB39 stood out for its glycerol production, obtaining the highest value (7.45 g·L-1). We conclude that there are nS yeast strains in the region with enological potential to be used at a commercial level.]]></p></abstract>
<abstract abstract-type="short" xml:lang="es"><p><![CDATA[Actualmente el estado de Querétaro es un importante productor de vinos en México; sin embargo, éstos difícilmente se comercializan debido a su falta de calidad y tipicidad, factores en que las levaduras vínicas juegan un papel esencial. Las Saccharomyes son responsables de la producción de etanol y las no-Saccharomyes (nS) pueden aportar metabolitos que mejoren la calidad, por lo que su uso en inóculos mixtos es de gran interés. En este estudio, levaduras aisladas de la fermentación espontánea de mostos de uva de tres viñedos queretanos se diferenciaron como nS en medio-lisina. Se evaluó su actividad &#946;-glucosidasa, su tolerancia a SO2 (30 mg·L-1) y a etanol (6 %). Aquellas sobresalientes se probaron en microvinificaciones mixtas con Saccharomyces cerevisiae (K1-V1116) y se identificaron mediante el análisis del gen 26S. De 197 cepas aisladas, 146 resultaron nS; 90 presentaron actividad &#946;glucosidasa y ocho (NB1, NA4, NB27, NB31, NB39, NR77, NR90, NB108) se seleccionaron con base en los ensayos de tolerancia, identificándose como pertenecientes al género Hanseniaspora. Las nS no interfirieron en la actividad fermentativa de K1-V1116; ya que no se encontraron diferencias en las variables evaluadas entre los vinos elaborados con cultivos mixtos y el control (K1-V1116). Se obtuvieron valores de pH, acidez total, acidez volátil y alcohol, considerados de calidad aceptable para vinos secos. La cepa NB39 destacó en su producción de glicerol obteniendo el mayor valor (7.45 g·L-1). Se concluye que en la región existen cepas de levaduras nS con potencial enológico para ser utilizadas a nivel comercial.]]></p></abstract>
<kwd-group>
<kwd lng="en"><![CDATA[native strains]]></kwd>
<kwd lng="en"><![CDATA[typicity]]></kwd>
<kwd lng="en"><![CDATA[&#946;-glucosidase]]></kwd>
<kwd lng="en"><![CDATA[Hanseniaspora]]></kwd>
<kwd lng="en"><![CDATA[microvinification]]></kwd>
<kwd lng="en"><![CDATA[mixed cultures]]></kwd>
<kwd lng="es"><![CDATA[cepas nativas]]></kwd>
<kwd lng="es"><![CDATA[tipicidad]]></kwd>
<kwd lng="es"><![CDATA[&#946;-glucosidasa]]></kwd>
<kwd lng="es"><![CDATA[Hanseniaspora]]></kwd>
<kwd lng="es"><![CDATA[microvinificación]]></kwd>
<kwd lng="es"><![CDATA[cultivos mixtos]]></kwd>
</kwd-group>
</article-meta>
</front><body><![CDATA[  	    <p align="justify"><font face="verdana" size="4">Art&iacute;culo cient&iacute;fico</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="center"><font face="verdana" size="4"><b>Enological potential of native non&#45;<i>Saccharomyces</i> yeasts from vineyards established in Queretaro, Mexico</b></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="center"><font face="verdana" size="3"><b>Potencial enol&oacute;gico de levaduras no&#45;<i>Saccharomyces</i> nativas de vi&ntilde;edos establecidos en Quer&eacute;taro, M&eacute;xico</b></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="center"><font face="verdana" size="2"><b>Eunice Ortiz&#45;Barrera; Dalia Elizabeth Miranda&#45;Castilleja; Sof&iacute;a Mar&iacute;a</b> <b>Arvizu&#45;Medrano; Juan Ramiro Pacheco&#45;Aguilar; Jes&uacute;s Alejandro Aldrete&#45;Tapia; Montserrat Hern&aacute;ndez&#45;Iturriaga; Ram&oacute;n &Aacute;lvar Mart&iacute;nez&#45;Peniche</b><sup>*</sup></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><sup><i>1</i></sup> <i>Divisi&oacute;n de Estudios de Posgrado, Facultad de Qu&iacute;mica, Universidad Aut&oacute;noma de Quer&eacute;taro. Centro Universitario s/n, colonia las Campanas, Quer&eacute;taro, C.P. 76010, M&Eacute;XICO.</i> Correo&#45;e: <a href="mailto:alvar@uaq.mx">alvar@uaq.mx</a>, tel. y fax: +52 442 19 21 304 <i>(*Autor para correspondencia).</i></font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2">Received: Junuary 5, 2015.    <br> 	Accepted: August 5, 2015.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Abstract</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Currently, the state of Queretaro is a major wine producer in Mexico; however, marketing these wines is difficult due to their lack of quality and typicity, factors in which wine yeasts play an essential role. <i>Saccharomyes</i> are responsible for ethanol production and non&#45;<i>Saccharomyes</i> (n<i>S</i>) can provide metabolites that enhance wine quality, so their use in mixed cultures is of great interest. In this study, yeasts isolated from the spontaneous fermentation of grape musts from three local vineyards were differentiated as n<i>S</i> in lysine medium. Their &#946;&#45;glucosidase activity and SO<sub>2</sub> (30 mg&middot;L<sup>&#45;1</sup>) and ethanol (6 %) tolerances were evaluated. Outstanding yeasts were tested in mixed microvinifications along with <i>S. cerevisiae</i> (K1&#45;V1116) and identified through analysis of the 26S gene. Of 197 isolated strains, 146 were differentiated as n<i>S</i>; 90 showed &#946;glucosidase activity and eight (NB1, NA4, NB27, NB31, NB39, NR77, NR90, NB108) were selected based on tolerance tests, being identified as belonging to the genus <i>Hanseniaspora</i>. The n<i>S</i> did not interfere with the fermentative activity of K1&#45;V1116, finding no differences in the parameters evaluated between the wines obtained by mixed cultures and the control (K1&#45;V1116). The values obtained for pH, total acidity, volatile acidity and alcohol were considered to be of acceptable quality for dry wines. The strain NB39 stood out for its glycerol production, obtaining the highest value (7.45 g&middot;L<sup>&#45;1</sup>). We conclude that there are n<i>S</i> yeast strains in the region with enological potential to be used at a commercial level.</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Keywords:</b> native strains, typicity, &#946;&#45;glucosidase, <i>Hanseniaspora</i>, microvinification, mixed cultures.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Resumen</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Actualmente el estado de Quer&eacute;taro es un importante productor de vinos en M&eacute;xico; sin embargo, &eacute;stos dif&iacute;cilmente se comercializan debido a su falta de calidad y tipicidad, factores en que las levaduras v&iacute;nicas juegan un papel esencial. Las <i>Saccharomyes</i> son responsables de la producci&oacute;n de etanol y las no&#45;<i>Saccharomyes</i> (n<i>S</i>) pueden aportar metabolitos que mejoren la calidad, por lo que su uso en in&oacute;culos mixtos es de gran inter&eacute;s. En este estudio, levaduras aisladas de la fermentaci&oacute;n espont&aacute;nea de mostos de uva de tres vi&ntilde;edos queretanos se diferenciaron como n<i>S</i> en medio&#45;lisina. Se evalu&oacute; su actividad &#946;&#45;glucosidasa, su tolerancia a SO<sub>2</sub> (30 mg&middot;L<sup>&#45;1</sup>) y a etanol (6 %). Aquellas sobresalientes se probaron en microvinificaciones mixtas con <i>Saccharomyces cerevisiae</i> (K1&#45;V1116) y se identificaron mediante el an&aacute;lisis del gen 26S. De 197 cepas aisladas, 146 resultaron n<i>S</i>; 90 presentaron actividad &#946;glucosidasa y ocho (NB1, NA4, NB27, NB31, NB39, NR77, NR90, NB108) se seleccionaron con base en los ensayos de tolerancia, identific&aacute;ndose como pertenecientes al g&eacute;nero <i>Hanseniaspora</i>. Las n<i>S</i> no interfirieron en la actividad fermentativa de K1&#45;V1116; ya que no se encontraron diferencias en las variables evaluadas entre los vinos elaborados con cultivos mixtos y el control (K1&#45;V1116). Se obtuvieron valores de pH, acidez total, acidez vol&aacute;til y alcohol, considerados de calidad aceptable para vinos secos. La cepa NB39 destac&oacute; en su producci&oacute;n de glicerol obteniendo el mayor valor (7.45 g&middot;L<sup>&#45;1</sup>). Se concluye que en la regi&oacute;n existen cepas de levaduras n<i>S</i> con potencial enol&oacute;gico para ser utilizadas a nivel comercial.</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>Palabras clave:</b> cepas nativas, tipicidad, &#946;&#45;glucosidasa, <i>Hanseniaspora</i>, microvinificaci&oacute;n, cultivos mixtos.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>INTRODUCTION</b></font></p>  	    <p align="justify"><font face="verdana" size="2">The state of Queretaro occupies 2nd place in wine production in Mexico, with vineyards established on an estimated 212 h (de la Cruz, Mart&iacute;nez, Becerril, &amp; Ch&aacute;varo, 2012). Currently, producers are making significant efforts to increase vineyard area and improve wine quality.</font></p>  	    <p align="justify"><font face="verdana" size="2">Wine quality is based on sensory attributes conferred by consumers, so it is a complex and difficult concept to objectively define (Charters &amp; Pettingrew, 2007). However, these attributes are due to the chemical compounds present and their proportions; some of these compounds are regulated, or have recommendations and classifications, depending on the amount in which they are found (International Organisation of Vine and Wine &#91;OIV&#93;, 2015). In turn, wine composition is determined by many factors, including the variety of grape used, environmental and growing conditions, and the microorganisms present from the fruit to the fermentative processes, among others (Fleet, 2003).</font></p>  	    <p align="justify"><font face="verdana" size="2">Wine making is based on alcoholic fermentation, an anaerobic phenomenon mainly conducted by yeasts, which are often divided into two groups: <i>Saccharomyces</i> and non<i>&#45;Saccharomyces</i> (n<i>S</i>) (P&eacute;rez et al<i>.</i>, 2011). The latter mainly includes the genera <i>Candida, Kloeckera, Hanseniaspora, Zygosaccharomyces, Schizosaccharomyces, Torulaspora, Brettanomyces, Saccharomycodes, Pichia</i> and <i>Williopsis</i>. Because of their low tolerance to ethanol, they prevail mainly in grapes and recently&#45;processed must, while <i>S. cerevisiae</i> predominates in advanced stages of fermentation (Raynal et al., 2011).</font></p>  	    <p align="justify"><font face="verdana" size="2">The contribution of n<i>S</i> yeasts to wine quality can take various forms. Production of glycerol by <i>Candida stellata</i> and esters by <i>C. pulcherrima</i> has been reported (Jolly, Augustyn, &amp; Pretorius, 2003). Other n<i>S</i> yeasts are also widely recognized for producing glucosidase enzymes (Zironi, Romano, Suzzi, Battistutta, &amp; Comi, 1993), which, by hydrolyzing such bonds, are capable of releasing volatile compounds linked to sugars, giving greater complexity to the wine's aromatic profile (Ar&eacute;valo, &Uacute;beda, Cordero, &amp; Briones, 2005). Conversely, others such as <i>Kloeckera apiculata</i> are associated with the production of acetic acid, which lowers wine quality (Oc&oacute;n et al., 2010). Because n<i>S</i> yeasts are not efficient in converting sugars to ethanol, applying them for oenological purposes is usually done in mixed cultures with <i>Saccharomyces</i>, so that the latter is the one which performs the fermentative process and the n<i>S</i> contribute positively to the sensory profile (Comitini et al., 2011). Therefore, to determine the potential of n<i>S</i> yeasts to be used in the wine industry, it is necessary to check that their activity in mixed culture does not affect the development of <i>Saccharomyces</i>, or produce compounds that may harm wine quality.</font></p>  	    <p align="justify"><font face="verdana" size="2">Spontaneous wine fermentations carry a high risk of deterioration, but they are usually rewarded with better texture and integration of the flavors in the wine, as compared to those inoculated with commercial strains. In addition, it is recognized that native strains may be better suited to the musts of a particular region, and that they can improve the sensory profile of the wines, giving them unique characteristics which highlight their typicity (Romano, Fiore, Paraggino, Caruso, &amp; Capece, 2003).</font></p>  	    <p align="justify"><font face="verdana" size="2">The predominance of <i>S. cerevisiae</i>, along with a notable growth rate of native n<i>S</i> yeasts during the first days of fermentation, can contribute significantly to the aromatic properties of wines; therefore, adding n<i>S</i> yeasts to a starter culture with <i>S. cerevisiae</i> is an original strategy to improve wine quality (Raynal et al., 2011).</font></p>  	    <p align="justify"><font face="verdana" size="2">In the Mexican wine industry, the yeasts used to inoculate musts are imported, implying technological dependence and capital flight. Mexico apparently does not have any studies related to the selection of native enological yeasts, so the aim of this work was to isolate and evaluate the enological potential of native n<i>S</i> strains selected in the wine region of Queretaro.</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>MATERIALS AND METHODS</b></font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Experimental site and biological material</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Fruits of grape (<i>Vitis vin&iacute;fera</i>) cvs 'Cabernet Franc,' 'Syrah,' 'Merlot' and 'Cabernet Sauvignon' obtained from three commercial vineyards established in the state of Queretaro were used: "El Rosario" (municipality of El Marqu&eacute;s), "El Barreno" (municipality of San Juan del Rio) and "Vi&ntilde;edos Azteca" (municipality of Ezequiel Montes). In addition, yeasts isolated from these fruits were used, and <i>Saccharomyces cerevisiae</i> K1&#45;V1116 (Lallemand, Ontario, Canada) was utilized as a reference strain.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Isolation and differentiation of yeasts</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Grapes were collected at technological maturity, based on sugar content (average 20 &deg;Bx). A random sampling of clusters using three rows of plants per variety was performed, without discriminating on the basis of health status and taking about 1 kg of grapes per cultivar in each vineyard.</font></p>  	    <p align="justify"><font face="verdana" size="2">The yeasts were obtained from spontaneous fermentation of the previously collected fruits, without addition of sulfur dioxide (SO2). Aliquots of the fermenting must were taken every 48 hours and decimal dilutions were made from which 0.1&#45;mL samples were taken; they were placed in Petri dishes with potato dextrose agar (PDA), supplemented with rose bengal (60 &micro;g&middot;mL<sup>&#45;1</sup>) and ampicillin (100 &micro;g&middot;mL<sup>&#45;1</sup>), and incubated at 25 &deg;C for three days. The colonies grown in the dishes were isolated based on their morphology by transferring them to nutrient yeast dextrose agar (NYDA) plates, supplemented with ampicillin solution (100 &micro;g&middot;mL<sup>&#45;1</sup> medium) (Sandoval&#45;Ch&aacute;vez, Mart&iacute;nez&#45;Peniche, Hern&aacute;ndez&#45;Iturriaga, Fern&aacute;ndez&#45;Escart&iacute;n, Arvizu&#45;Medrano, &amp; Soto&#45;Mart&iacute;nez, 2011).</font></p>  	    <p align="justify"><font face="verdana" size="2">Differentiation of the n<i>S</i> yeasts was performed by incubating all the isolated yeasts in lysine medium (Oxoid, Hampshire, UK) at 25 &deg;C for four days, considering as n<i>S</i> positive those capable of developing after two consecutive reseedings (Jolly et al., 2003).</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>Determination of &#946;&#45;glucosidase activity</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Then 10 &micro;L of a yeast inoculum, previously cultured (48 h at 25 &deg;C) on nutrient yeast dextrose broth (NYDB), were placed, dropwise, on esculin&#45;glycerol agar (EGA) medium with pH adjusted to 6.0, which was incubated at 25 &deg;C for three days. The strains were considered positive for &#946;&#45;glucosidase activity when, around the colony, there were color changes in the medium towards brown (P&eacute;rez et al., 2011).</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Ethanol tolerance and sulfur dioxide</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Yeast population dynamics was determined using an automated turbidimetric analyzer (Bioscreen<sup>&reg;</sup>C), in which the different strains were inoculated in the individual wells of the plate (1 x 10<sup>5</sup> CFU) containing YPD (yeast&#45; peptone&#45;dextrose adjusted to pH 3.5 and 20 &deg;Bx) liquid medium, and incubated at 25 &deg;C for 72 h. To determine ethanol tolerance, 6 % of this compound was added into the medium, while in the case of SO<sub>2</sub>, 30 mg of total SO<sub>2</sub> were added per liter. The evaluated parameter was the detection time of the yeasts using the optical density (OD) measurement at a wavelength of 600 nm.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Yeast identification</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Strains selected from the tolerance tests were identified using polymerase chain reaction (PCR), amplifying the D1/D2 domain of the gene encoding the subunit 26S rRNA, followed by sequencing. Extraction of genomic DNA was performed by taking 1 mL of yeast culture (in the period from 24&#45;48 h), whose cells were lysed by the standard heat method (95 &deg;C for 10 min), followed by purification using the phenol&#45;chloroform technique. For amplification of the D1/D2 domain, the primers NL1 (5'GCATATCAATAAGCGGAGGAAAAC&#45;3') and NL4 (5'&#45;GGTCCGTGTTTCAAGACGG&#45;3') were used under the following conditions (Cano, Guarro, &amp; Gen&eacute;<i>,</i> 2004): 2 min at 95 &deg;C, 35 cycles (30 s at 95 &deg;C, 1 min at 56.75 &deg;C and 1 min at 72 &deg;C) and 10 min at 72 &deg;C. For sequencing, the amplified fragments were sent to the Synthesis and Sequencing Unit of the Institute of Biotechnology at the National Autonomous University of Mexico (UNAM). With the data received, homology was sought with the sequences reported in the National Center for Biotechnology Information (NCBI) database using the Blast program (Aldrete&#45;Tapia, Escobar&#45;Ram&iacute;rez, Tamplin, &amp; Hern&aacute;ndez&#45;Iturriaga, 2014).</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Microvinification trials</b></font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">Microvinification trials were conducted in 1 L flasks containing 700 mL of must from healthy grapes harvested in 2012 at technological maturity, which was based on the sugar/acid ratio of the varieties 'Cabernet Sauvignon' and 'Merlot' (maturation indices: 26 and 30 g sugar/g tartaric acid, respectively). A randomized block experimental design, considering the varieties as replications, was used. Prior to inoculation, the must was thermovinificated (60 &deg;C for 20 min, reaching 20 &deg;C in less than 5 min) (Rib&eacute;reau&#45;Gayon, Dubordieu, Don&egrave;che, &amp; Lonvaud, 2006) and adjusted to a pH of 3.5 and 21&deg;Bx. In each of the flasks, and for each cultivar, 3 x 10<sup>6</sup> CFU&middot;mL<sup>&#45;1</sup> of the n<i>S</i> strain to analyze were inoculated, and an hour later 1 x 10<sup>6</sup> CFU&middot;mL<sup>&#45;1</sup> of the yeast <i>Saccharomyces</i> K1&#45;V1116. The flasks were incubated at 25 &deg;C for 10 days, during which time plate counts were performed using NYDA (<i>Saccharomyces</i>) and lysine (n<i>S</i>) media, and follow&#45;up was given to the fermentation by determining the density, which was calculated by measuring the weight of the liquid within the flask (subtracting the weight of the flask measured prior to filling it) and its corresponding volume for each sampling (subtracting the milliliters used in the sampling).</font></p>  	    <p align="justify"><font face="verdana" size="2">To determine the overall quality of the wines obtained, the following determinations were made: a) pH, by means of a Conductronic&#45;brand potentiometer; b) total soluble solids (TSS, &deg;Bx), using an ATAGO&#45;brand manual refractometer (range of 0 &#45; 32 &deg;Bx); c) alcoholic strength, by direct distillation and pycnometry; d) Total titratable acidity (TTA), by titration with 0.1 N sodium hydroxide (NaOH), reported in g&middot;L<sup>&#45;1</sup> tartaric acid; e) volatile acidity (Garc&iacute;a&#45;Tena method); f ) residual sugars (Fehling Causse Bonnans) and g) glycerol (spectrophotometry).</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Data analysis</b></font></p>  	    <p align="justify"><font face="verdana" size="2">For the microvinification trials, a randomized block design with nine treatments (eight yeast strains + one reference) and two replications (grape cultivars) was used. With the data obtained from the physical and chemical variables, analysis of variance and Tukey's test (<i>P</i> &le; 0.05) were performed using JMP 9.0 statistical software.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>RESULTS AND DISCUSSION</b></font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Isolation and differentiation</b></font></p>  	    <p align="justify"><font face="verdana" size="2">A total of 198 yeasts were isolated, with the "El Barreno" ranch having a greater number (106) compared to "El Rosario" (71) and " Vi&ntilde;edos Azteca" (21), which may be due to the higher sugar content, on average, in the first vineyard (21 &deg;Bx), at least compared to "El Rosario" (18 &deg;Bx). The health status was similar in these two vineyards, but not so in the case of "Vi&ntilde;edos Azteca" where, at the time of the samplings, it had problems with fungal diseases, which probably contributed to the fewer number of yeasts isolated from this vineyard.</font></p>  	    <p align="justify"><font face="verdana" size="2">The test in lysine medium allowed the identification of 146 n<i>S</i> (74 %) from the total number of isolates, confirming what was previously reported by several authors (Fern&aacute;ndez, &Uacute;beda and Briones 2000; Fleet, 2003; Ricci, Martini, Bonechi, Trabalzini, Santucci, &amp; Rossi, 2004), in the sense that in the early stages of musts in spontaneous fermentation, the n<i>S</i> yeasts predominate due to their abundance from the fruits. Of these, 58 % came from "El Barreno", 28 % from "El Rosario" and 14 % from "Vi&ntilde;edos Azteca."</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><a href="#f1">Figure 1</a> shows the development of some strains in the lysine medium, where SR30 and SR31 stand out. In others such as SR34, less intense development can be seen, and, finally, there was none in SR33. The strains that were positive were assigned, from that moment on, the letter "N" instead of "S" for belonging to the group of non&#45;<i>Saccharomyces</i>.</font></p>  	    <p align="center"><font face="verdana" size="2"><a name="f1"></a></font></p>  	    <p align="center"><font face="verdana" size="2"><img src="/img/revistas/rcsh/v21n2/a5f1.jpg"></font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>&#946;&#45;glucosidase activity</b></font></p>  	    <p align="justify"><font face="verdana" size="2">According to the tests conducted in EGA medium, of the 146 n<i>S</i> strains, 90 (62 %) were &#946;&#45;glucosidase positive. The percentages of n<i>S</i> yeasts with this activity vary depending on the vineyard, with 68 % corresponding to "El Barreno," 51 % to "El Rosario" and 50 % to "Vi&ntilde;edos Azteca." In all cases the values exceeded 50 %, which is high when compared with other studies such as that of Arroyo, Cordero&#45;Bueso, Serrano, and Valero (2010), where 29 % of the yeasts studied showed this activity. It should also be remembered that part of the positive impact attributed to n<i>S</i> yeasts is their greater ability to produce glucosidase enzymes, which can favor the aromatic profile of wines (Jolly, Augustyn, &amp; Pretorius<i>,</i> 2006).</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Ethanol tolerance and sulfur dioxide</b></font></p>  	    <p align="justify"><font face="verdana" size="2">The detection time ranges for the yeasts assessed in the medium containing ethanol ranged from 18.2 h (NR90) to 72.0 h (NR107) (<a href="/img/revistas/rcsh/v21n2/a5f2.jpg" target="_blank">Figure 2</a>). The selection criteria for this test was based on a limited (but not absent) resistance to this compound, which would result in high detection times (over 18 h). In principle, this feature would reduce the viability of the must in the early stages of fermentation, thereby avoiding competition with the <i>Saccharomyces</i> but allowing them to develop enough to produce the metabolites of interest (&Aacute;lvarez, Zamora, &amp; Acedo, 2009). Some yeasts that showed high detection times, and that were not chosen for failing to meet the rest of the selection criteria, were NB65 and NB75.</font></p>  	    <p align="justify"><font face="verdana" size="2">Regarding tolerance to sulfur dioxide, the yeasts that had lower detection times (greater SO<sub>2</sub> tolerance) were: NB1 (12.37 h), NB27 (12.37 h) and NR90 (2.9 h), contrasting with NB73 that obtained 96.1 h. It is known that moderate amounts of total SO<sub>2</sub> (30&#45;100 mg&middot;L<sup>&#45;1</sup>) lengthen the lag phase of yeasts by one or two days, while high amounts (greater than 200 mg&middot;L<sup>&#45;1</sup>) can inhibit it (Rib&eacute;reau&#45;Gayon et al., 2006). One of the desirable features in n<i>S</i>, as a potential commercial yeast, is its tolerance to SO<sub>2</sub> concentrations typically added during vinification (30&#45;50 mg&middot;L<sup>&#45;1</sup>), allowing it to survive the sulfating and make its eventual contribution before the alcohol concentrations are increased (Navarre &amp; Navarre, 1998).</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">Based on the combined behaviors exhibited by all yeasts, we selected, for further testing, those eight that are framed within the inset of <a href="/img/revistas/rcsh/v21n2/a5f2.jpg" target="_blank">Figure 2</a>. Of these, and in terms of their origin, five (NB1, NB27, NB31, NB39 and NB108) come from "El Barreno," two (NR77 and NR90) from "El Rosario" and one from "Vi&ntilde;edos Azteca" (NA4), proportions that substantially match the percentages of &#946;&#45;glucosidase positive n<i>S</i> strains.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Identification of selected yeasts</b></font></p>  	    <p align="justify"><font face="verdana" size="2">The eight selected yeasts were identified by amplification and sequencing of the D1/D2 domain, as mentioned in the methodology. All were identified as belonging to the genus <i>Hanseniaspora</i>; NR90 was <i>H. guillermondi</i> and the rest <i>H. uvarum</i> (<a href="/img/revistas/rcsh/v21n2/a5t1.jpg" target="_blank">Table 1</a>).</font></p>  	    <p align="justify"><font face="verdana" size="2">The genus <i>Hanseniaspora</i> is considered ethanol&#45;sensitive, being able to ferment grape must up to 5 % alcohol, which coincides with the behavior observed in tolerance tests obtained by Bioscreen<sup>&reg;</sup>. On the other hand, it has been reported that <i>Hanseniaspora guillermondii</i> can produce greater concentrations of higher alcohols, esters and glycerol than <i>Saccharomyces</i>, and its production of acetic acid varies at strain level (Zironi et al<i>.</i>, 1993). For their part, Medina et al<i>.</i> (2008) report that wines obtained from mixed microvinifications, using one strain of the genus <i>Hanseniaspora</i> together with one <i>Saccharomyces</i>, show greater aromatic complexity (more fruity and intense), also improving their sensory acceptance. This suggests that the isolates obtained in this study, by belonging to the genus <i>Hanseniaspora</i>, can modify the sensory profile of the wines, provided that they are able to act together with a fermentative yeast such as <i>Saccharomyces</i>, without any inhibition in the early stages of fermentation by either of the two (Raynal et al., 2011).</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Fermentative behavior</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Taking the decrease in density over time as a measure of the progress of fermentation (Rib&eacute;reau&#45;Gayon et al., 2006), it was observed that each of the eight mixed cultures evolved in a similar manner to that obtained in the musts inoculated only with the yeast K1&#45;V1116 (<i>Saccharomyces cerevisiae</i>) (<a href="/img/revistas/rcsh/v21n2/a5f3.jpg" target="_blank">Figure 3</a>); this shows that none of the selected yeasts delay fermentation under these conditions, or compete with the fermentative strain (K1&#45;V1116).</font></p>  	    <p align="justify"><font face="verdana" size="2">According to the region's wine producers, one of the factors in Queretaro that undermine the quality of their wines is the low alcoholic strength that occasionally occurs (about 10 %) (de la Cruz et al<i>.,</i> 2012), resulting from limited sugar accumulation in cold years; therefore, if this type of mixed cultures, n<i>S</i> + <i>Saccharomyces</i>, is to be implemented, it is imperative to verify that the speed of fermentation, and especially the alcohol produced by the action of the latter, is not affected by the action of the former.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2"><b>Kinetics of the yeasts</b></font></p>  	    <p align="justify"><font face="verdana" size="2">In general, and as expected, in all mixed fermentations the predominant yeast was <i>S. cerevisiae</i> (K1&#45;V1116), which remained until the end of fermentation, there not being any observed interference by the n<i>S</i> yeasts on its development, as demonstrated by the similar kinetics of strain K1&#45;V1116 in the presence of different n<i>S</i> (<a href="/img/revistas/rcsh/v21n2/a5f4.jpg" target="_blank">Figure 4</a>).</font></p>  	    <p align="justify"><font face="verdana" size="2">On the other hand, the same figure shows a different behavior based on the variety of the musts. In 'Merlot' except when inoculated with only K1&#45;V1116, there is a drastic decrease in the populations of all yeasts during the first 36 h of fermentation, which would correspond to the lag stage; this decrease is, in most cases, a log cycle. In inoculations with NA4 and NB108, this decrease was almost four cycles. In all cases the yeast populations were recovered by the second day of fermentation. In the 'Cabernet Sauvignon' musts, the n<i>S</i> strains tend to remain constant during the first three days, and then decrease their populations by the fourth day.</font></p>  	    <p align="justify"><font face="verdana" size="2">The parameters evaluated to determine fruit maturation (sugars and acidity) show no important differences that allow explaining this differential behavior among varieties. However, although the pH was adjusted prior to inoculation in both musts, the type and proportion of organic acids, as well as other compounds such as fatty and phenolic acids present in the fruit, can be different in type and concentration, and thus some exert more stress on microorganisms (Bauer, Rossington, Mamnum, Kuchler, &amp; Piper, 2003; Lafon&#45;Lafourcade, Geneix, &amp; Rib&eacute;reau&#45;Gayon, 1984).</font></p>  	    <p align="justify"><font face="verdana" size="2">Most n<i>S</i> reached their peak population about two days after their inoculation, increasing slightly with respect to the initial inoculum (1 Log &#91;CFU&middot;mL<sup>&#45;1</sup>&#93;), and then decreased dramatically by the fourth day, at which time the fermentation was nearly over and therefore would have a high alcoholic strength (above 8 %, based on density). This was what was expected to be obtained based on the selection made (growth in the presence of 6 % ethanol) and the genus to which the tested strains belong, agreeing with previous studies such as that reported by Comitini et al. (2011).</font></p>  	    <p align="justify"><font face="verdana" size="2">However, some n<i>S</i> yeasts were detected even after five days in the musts of both varieties, as in the case of strains NB1, NB27, NB31, NB39 and NR77 and, only in the case of the must of the variety 'Merlot,' NR90, NB108 and NA4. Of these, based on the results of the ethanol tolerance test, NR90 and NA4 showed shorter detection times (18.17 and 24 h); therefore, this result is consistent with greater tolerance to this compound, which is usually the main constraint towards the end of fermentation (Jolly et al., 2003). In contrast to the above, the other yeasts showed little ethanol tolerance in the Bioscreen<sup>&reg;</sup> tests, with times exceeding 35 h; for this reason, populations were not expected to remain in the advanced stages of fermentation as occurred. It should be remembered that in the ethanol (6 %) tolerance tests, it was present from the beginning, whereas in the must, the yeasts had time to activate mechanisms that allow them to gradually adapt to increasing concentrations of alcohol in the medium (Bauer &amp; Pretorius, 2000).</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>Physical and chemical analysis of the wines obtained</b></font></p>  	    <p align="justify"><font face="verdana" size="2">No differences for pH, total soluble solids, TTA, volatile acidity, residual sugars, alcohol percentage, and total and free sulfur dioxide were obtained among the wines made with eight different n<i>S</i> strains in the presence of K1&#45;V1116, or by comparing them with those obtained in fermentations only with the <i>Saccharomyces</i> reference strain, which shows that the n<i>S</i> strains do not adversely affect the most general quality aspects. The ranges of pH (3.44 to 3.51), TTA (6.3 to 7.5 g&middot;L<sup>&#45;1</sup> tartaric acid), volatile acidity (0.10 to 0.21 g&middot;L<sup>&#45;1</sup> acetic acid), alcoholic strength (11.2 to 13.6 % ethanol) and residual sugars (2.5 to 3.5 g&middot;L<sup>&#45;1</sup>) obtained are within normal parameters (<a href="/img/revistas/rcsh/v21n2/a5t2.jpg" target="_blank">Table 2</a>) (OIV, 2012).</font></p>  	    <p align="justify"><font face="verdana" size="2">On the other hand, it is noteworthy that strain NB39 obtained a glycerol concentration in the wine higher than that of most of the other yeasts (<a href="/img/revistas/rcsh/v21n2/a5f5.jpg" target="_blank">Figure 5</a>). Glycerol contributes to the visual aspect, smoothness and viscosity of wines when it is in appropriate concentrations (greater than 5.2 g&middot;L<sup>&#45;1</sup>). The yeast strains used during winemaking are one of the most important factors determining the abundance of this compound in the final product (Rib&eacute;reau&#45;Gayon et al., 2006), so the superior performance of NB39 is notable.</font></p>  	    ]]></body>
<body><![CDATA[<p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>CONCLUSIONS</b></font></p>  	    <p align="justify"><font face="verdana" size="2">Most of the yeasts isolated from fermenting musts belonged to the non&#45;<i>Saccharomyces</i> group, of which the majority turned out to be &#946;&#45;glucosidase positive. Of these, eight (9 %) showed a desirable behavior in the presence of 30 mg&middot;L<sup>&#45;1</sup> total SO<sub>2</sub> and 6 % ethanol. Seven selected yeasts belonged to the species <i>Hanseniaspora uvarum</i>, and the strain NR90 was identified as <i>H. guillermondi</i>. No adverse effects were observed in the physical and chemical parameters evaluated in the wines produced with n<i>S</i> mixed cultures and commercial K1&#45;V1116, behavior that demonstrates the potential to be used in mixed cultures in wine production. Finally, the strain NB39 stood out by producing the highest concentration of glycerol in the wine.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>ACKNOWLEDGEMENTS</b></font></p>  	    <p align="justify"><font face="verdana" size="2">The authors thank the following for allowing the use of their facilities for this research: Antonino Sierra, owner of El Rosario farm; Alejandro Zendejas, owner of the El Barreno Ranch; Jorge Ferreira, owner of Azteca Vineyards and Alberto Rodr&iacute;guez, owner of CIA. Vin&iacute;cola San Patricio S.A. de C.V.</font></p>  	    <p align="justify"><font face="verdana" size="2">&nbsp;</font></p>  	    <p align="justify"><font face="verdana" size="2"><b>REFERENCES</b></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Aldrete&#45;Tapia, J. A., Escobar&#45;Ram&iacute;rez., M. C., Tamplin, M. L., &amp; Hern&aacute;ndez&#45;Iturriaga, M. (2014). High&#45;throughput sequencing of microbial communities in Poro cheese, an artisanal Mexican cheese. <i>Food Microbiology</i>, <i>44</i>, 136&#45;141. doi: 10.1016/j.fm.2014.05.022</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778278&pid=S1027-152X201500020000500001&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">&Aacute;lvarez, A., Zamora, M. A., &amp; Acedo, E. F. (2009). Perspectivas para el uso de levaduras nativas durante la elaboraci&oacute;n de bacanora. <i>Revista Latinoamericana de Microbiolog&iacute;a, 51</i>(1&#45;2), 58&#45;63. Recuperado de: <a href="http://www.medigraphic.com/pdfs/lamicro/mi-2009/mi091_2h.pdf" target="_blank">http://www.medigraphic.com/pdfs/lamicro/mi&#45;2009/mi091_2h.pdf</a></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778279&pid=S1027-152X201500020000500002&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Ar&eacute;valo, V. M., &Uacute;beda, J. F., Cordero, R. R., &amp; Briones, A. I. (2005). Optimization of a rapid method for studying the cellular location of &#946;&#45;glucosidase activity in wine yeasts. <i>Journal of Applied Microbiology, 99</i>(3), 558&#45;564. doi: 10.1111/j.1365&#45;2672.2005.02627.x</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778280&pid=S1027-152X201500020000500003&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Arroyo, T., Cordero&#45;Bueso, G., Serrano, A., &amp; Valero, E. (2010). &#946;&#45;glucosidase production by non&#45;Saccharomyces yeast isolated from vineyards. <i>Expression of Multidisciplinary Flavour Science. Winterthur, Switzerland</i>, 359&#45;362. Recuperado de <a href="https://home.zhaw.ch/yere/pdf/Teil90%20-%20Expression%20of%20Multidisciplinary.pdf" target="_blank">https://home.zhaw.ch/yere/pdf/Teil90%20&#45;%20Expression%20of%20Multidisciplinary.pdf</a></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778281&pid=S1027-152X201500020000500004&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Bauer, F. F., &amp; Pretorius, I. S. (2000). Yeast stress response and fermentation efficiency: how to survive winemaking &#150; A review. <i>South African Journal of Enology and Viticulture, 21</i>, 27&#45;51. Recuperado de <a href="http://www.sawislibrary.co.za/dbtextimages/76343.pdf" target="_blank">http://www.sawislibrary.co.za/dbtextimages/76343.pdf</a></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778282&pid=S1027-152X201500020000500005&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Bauer, B. E., Rossington, M. M., Mamnum, Y., Kuchler, K., &amp; Piper, P. W. (2003) Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants. <i>European Journal of Biochemistry, 270</i>(15), 3189&#45;3195. doi: 10.1046/j.1432&#45;1033.2003.03701.x</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778283&pid=S1027-152X201500020000500006&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Cano, J., Guarro, J., &amp; Gen&eacute;, J. (2004). Molecular and morphological identification of <i>Colletotrichum</i> species of clinical interest. <i>Journal of Clinical Microbiology, 42</i>(6), 2450&#45;2454. doi: 10.1128/JCM.42.6.2450&#45;2454.2004</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778284&pid=S1027-152X201500020000500007&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Charters, S., &amp; Pettigrew, S. (2007). The dimensions of wine quality. Food Quality and Preference, 18(7), 997&#45;1007. doi:10.1016/j.foodqual.2007.04.003</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778285&pid=S1027-152X201500020000500008&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Comitini, F., Gobbi, M., Domizio, P., Romani, C. Lencioni, L. Mannazzu, I., &amp; Ciani, M. (2011). Selected non&#45; <i>Saccharomyces</i> wine yeasts in controlled multistarter fermentations with <i>Saccharomyces cerevisiae</i>. <i>Food Microbiology, 28</i>(5), 873&#45;882. doi: 10.1016/j.fm.2010.12.001</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778286&pid=S1027-152X201500020000500009&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">de la Cruz, M. A., Mart&iacute;nez, R. A., Becerril, E., &amp; Ch&aacute;varo, M. S. (2012). Caracterizaci&oacute;n de vinos tintos producidos en Quer&eacute;taro. <i>Revista Fitotecnia Mexicana,</i> N&uacute;m. Especial <i>5</i> (35), 61&#45;67. Recuperado de <a href="http://www.redalyc.org/articulo.oa?id=61024388012" target="_blank">http://www.redalyc.org/articulo.oa?id=61024388012</a></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778287&pid=S1027-152X201500020000500010&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Fern&aacute;ndez, M., &Uacute;beda, J. F., &amp; Briones, A. I. (2000). Typing of non&#45;S<i>accharomyces</i> yeasts with enzymatic activities of interest in wine&#45;making<i>. International Journal of Food Microbiology, 59</i>, 29<i>&#45;</i>36<i>. doi:</i> 10.1016/S0168&#45;1605(00)00283&#45;X</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778288&pid=S1027-152X201500020000500011&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Fleet, G. H. (2003). Yeast interactions and wine flavour<i>. International Journal of Food Microbiology</i>, 86, 11&#45;22. doi:10.1016/S0168&#45;1605(03)00245&#45;9</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778289&pid=S1027-152X201500020000500012&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Jolly, N. P., Augustyn, O. P. H., &amp; Pretorius, I. S. (2003). The effect of non&#45;<i>Saccharomyces</i> yeasts on fermentation and wine quality. <i>South African Journal of Enology and Viticulture, 24</i>(2), 55&#45;62. Recuperado de <a href="http://www.sawislibrary.co.za/dbtextimages/17136.pdf" target="_blank">http://www.sawislibrary.co.za/dbtextimages/17136.pdf</a></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778290&pid=S1027-152X201500020000500013&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Jolly, N. P., Augustyn, O. P. H., &amp; Pretorius, I. S. (2006). The role and use of non&#45;<i>Saccharomyces</i> yeast in wine production. <i>South African Journal of Enology and Viticulture, 27</i>, 15&#45;38.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778291&pid=S1027-152X201500020000500014&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Lafon&#45;Lafourcade, S., Geneix, C., &amp; Rib&eacute;reau&#45;Gayon, P. (1984). Inhibition of alcoholic fermentation of grape must by fatty acids produced by yeasts and their elimination by yeast ghosts. <i>Applied and Environmental Microbiology</i>, <i>47</i>(6), 1246&#45;1249.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778293&pid=S1027-152X201500020000500015&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Medina, K., Ferreri, L., Fari&ntilde;a, L., Boido, E., Dellacassa, E., Gaggero, C., &amp; Carrau, F. (2008). Aplicaci&oacute;n de la levadura <i>Hanseniaspora vineae</i> en cultivos mixtos con <i>Saccharomyces cerevisiae</i> en la vinificaci&oacute;n. <i>Enolog&iacute;a</i>, <i>4,</i> 1&#45;6.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778295&pid=S1027-152X201500020000500016&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p> 	    <!-- ref --><p align="justify"><font face="verdana" size="2">Navarre, J. P., &amp; Navarre, C. (1998). <i>Manuel d'oenologie</i>. Par&iacute;s, Francia: Lavoisier.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778297&pid=S1027-152X201500020000500017&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>      <!-- ref --><p align="justify"><font face="verdana" size="2">Oc&oacute;n, E., Guti&eacute;rrez, A. R., Garijo, P., Tenorio, C., L&oacute;pez, I., L&oacute;pez, R., &amp; Santamar&iacute;a, P. (2010). Quantitative and qualitative analysis of non&#45;<i>Saccharomyces</i> yeasts in spontaneous alcoholic fermentations. <i>European Food Research and Technology, 230</i>(6), 885&#45;891. doi: 10.1007/s00217&#45;010&#45;1233&#45;7</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778299&pid=S1027-152X201500020000500018&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Organizaci&oacute;n internacional de la vid y el vino (OIV) (2015). <i>Compendium of international methods of analysis</i>. Par&iacute;s, Francia: Autor.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778300&pid=S1027-152X201500020000500019&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Organizaci&oacute;n internacional de la vid y el vino (OIV) (2012). <i>International standard for labelling of wine</i>. Par&iacute;s, Francia: Autor.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778302&pid=S1027-152X201500020000500020&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">P&eacute;rez, G., Fari&ntilde;a, L., Barquet, M., Boido, E., Gaggero, C., Dellacassa, E., &amp; Carrau, F. (2011). A quick screening method to identify &#946;&#45;glucosidase activity in native wine yeast strains: application of Esculin Glycerol Agar (EGA) medium. <i>World Journal of Microbiology and Biotechnology</i>, <i>27</i>, 47&#45;55. doi: 10.1007/s11274&#45;010&#45;0425&#45;4.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778304&pid=S1027-152X201500020000500021&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Raynal, C., Wardrop, F., Pillet, O., Languet, P., Heras, J. M., Dumon, A., &amp; Ortiz, A. (2011). Fermentaci&oacute;n controlada mediante la inoculaci&oacute;n secuencial de una levadura no&#45;<i>Saccharomyces</i> y de una levadura <i>Saccharomyces cerevisiae</i>, una herramienta innovadora para el en&oacute;logo. <i>Alimentaria</i>, <i>428</i>, 83&#45;92. Recuperado de <a href="http://www.enoreports.com/enoreports/pdf/lallemand_jul10.pdf" target="_blank">http://www.enoreports.com/enoreports/pdf/lallemand_jul10.pdf</a></font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778306&pid=S1027-152X201500020000500022&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Rib&eacute;reau&#45;Gayon, P., Dubordieu, D., Don&egrave;che, B., &amp; Lonvaud, A. (2006). <i>Handbook of Enology. Vol.1.The Microbiology of Wine and Vinifications</i>. (2nd Ed). Burdeos, Francia: John Wiley and Sons, Ltd.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778307&pid=S1027-152X201500020000500023&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Ricci, M., Martini, S., Bonechi, C., Trabalzini, L., Santucci, A., &amp; Rossi, C. (2004). Inhibition effects of ethanol on the kinetics of glucose metabolism by <i>S. cerevisiae</i>: NMR and modeling study. <i>Chemical Physics Letters</i>, <i>387</i>(46), 377&#45;382. doi: 10.1016/j.cplett.2004.02.041</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778309&pid=S1027-152X201500020000500024&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Romano, P., Fiore, C., Paraggino, M., Caruso, M., &amp; Capece, A. (2003). Function of yeast species and strains in wine flavour. <i>International Journal of Food Microbiology</i>, <i>86</i>(1&#45; 2), 169&#45;180. doi:10.1016/S0168&#45;1605(03)00290&#45;3</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778310&pid=S1027-152X201500020000500025&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --><!-- ref --><p align="justify"><font face="verdana" size="2">Sandoval&#45;Ch&aacute;vez, R. A., Mart&iacute;nez&#45;Peniche, R. A., Hern&aacute;ndez&#45;Iturriaga, M., Fern&aacute;ndez&#45;Escart&iacute;n, E., Arvizu&#45;Medrano, S., &amp; Soto&#45;Mart&iacute;nez, L. (2011). Control biol&oacute;gico y qu&iacute;mico contra control biol&oacute;gico y qu&iacute;mico contra <i>Fusarium stilboides</i> en pimiento morr&oacute;n en poscosecha. <i>Revista Chapingo Serie Horticultura</i>, <i>17</i>(2), 161&#45;172.    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778311&pid=S1027-152X201500020000500026&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --></font></p>  	    <!-- ref --><p align="justify"><font face="verdana" size="2">Zironi, R., Romano, P., Suzzi, G., Battistutta, F., &amp; Comi, G. (1993). Volatile metabolites produced in wine by mixed and sequential cultures of <i>Hanseniaspora guilliermondii</i> or <i>Kloeckera apiculata</i> and <i>Saccharomyces cerevisiae</i>. <i>Biotechnology Letters</i>, <i>15</i>(3), 235&#45;238. doi: 10.1007/BF00128311</font>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[&#160;<a href="javascript:void(0);" onclick="javascript: window.open('/scielo.php?script=sci_nlinks&ref=6778313&pid=S1027-152X201500020000500027&lng=','','width=640,height=500,resizable=yes,scrollbars=1,menubar=yes,');">Links</a>&#160;]<!-- end-ref --> ]]></body><back>
<ref-list>
<ref id="B1">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Aldrete-Tapia]]></surname>
<given-names><![CDATA[J. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Escobar-Ramírez]]></surname>
<given-names><![CDATA[M. C.]]></given-names>
</name>
<name>
<surname><![CDATA[Tamplin]]></surname>
<given-names><![CDATA[M. L.]]></given-names>
</name>
<name>
<surname><![CDATA[Hernández-Iturriaga]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[High-throughput sequencing of microbial communities in Poro cheese, an artisanal Mexican cheese]]></article-title>
<source><![CDATA[Food Microbiology]]></source>
<year>2014</year>
<volume>44</volume>
<page-range>136-141</page-range></nlm-citation>
</ref>
<ref id="B2">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Álvarez]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[Zamora]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Acedo]]></surname>
<given-names><![CDATA[E. F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Perspectivas para el uso de levaduras nativas durante la elaboración de bacanora]]></article-title>
<source><![CDATA[Revista Latinoamericana de Microbiología]]></source>
<year>2009</year>
<volume>51</volume>
<numero>1</numero>
<issue>1</issue>
<page-range>58-63</page-range></nlm-citation>
</ref>
<ref id="B3">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Arévalo]]></surname>
<given-names><![CDATA[V. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Úbeda]]></surname>
<given-names><![CDATA[J. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Cordero]]></surname>
<given-names><![CDATA[R. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Briones]]></surname>
<given-names><![CDATA[A. I.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Optimization of a rapid method for studying the cellular location of &#946;-glucosidase activity in wine yeasts]]></article-title>
<source><![CDATA[Journal of Applied Microbiology]]></source>
<year>2005</year>
<volume>99</volume>
<numero>3</numero>
<issue>3</issue>
<page-range>558-564</page-range></nlm-citation>
</ref>
<ref id="B4">
<nlm-citation citation-type="">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Arroyo]]></surname>
<given-names><![CDATA[T.]]></given-names>
</name>
<name>
<surname><![CDATA[Cordero-Bueso]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
<name>
<surname><![CDATA[Serrano]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[Valero]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[&#946;-glucosidase production by non-Saccharomyces yeast isolated from vineyards]]></article-title>
<source><![CDATA[Expression of Multidisciplinary Flavour Science]]></source>
<year>2010</year>
<page-range>359-362</page-range><publisher-loc><![CDATA[Winterthur ]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B5">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Bauer]]></surname>
<given-names><![CDATA[F. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Pretorius]]></surname>
<given-names><![CDATA[I. S.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Yeast stress response and fermentation efficiency: how to survive winemaking - A review]]></article-title>
<source><![CDATA[South African Journal of Enology and Viticulture]]></source>
<year>2000</year>
<volume>21</volume>
<page-range>27-51</page-range></nlm-citation>
</ref>
<ref id="B6">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Bauer]]></surname>
<given-names><![CDATA[B. E.]]></given-names>
</name>
<name>
<surname><![CDATA[Rossington]]></surname>
<given-names><![CDATA[M. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Mamnum]]></surname>
<given-names><![CDATA[Y.]]></given-names>
</name>
<name>
<surname><![CDATA[Kuchler]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[Piper]]></surname>
<given-names><![CDATA[P. W.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants]]></article-title>
<source><![CDATA[European Journal of Biochemistry]]></source>
<year>2003</year>
<volume>270</volume>
<numero>15</numero>
<issue>15</issue>
<page-range>3189-3195</page-range></nlm-citation>
</ref>
<ref id="B7">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Cano]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Guarro]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
<name>
<surname><![CDATA[Gené]]></surname>
<given-names><![CDATA[J.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Molecular and morphological identification of Colletotrichum species of clinical interest]]></article-title>
<source><![CDATA[Journal of Clinical Microbiology]]></source>
<year>2004</year>
<volume>42</volume>
<numero>6</numero>
<issue>6</issue>
<page-range>2450-2454</page-range></nlm-citation>
</ref>
<ref id="B8">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Charters]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[Pettigrew]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The dimensions of wine quality]]></article-title>
<source><![CDATA[Food Quality and Preference]]></source>
<year>2007</year>
<volume>18</volume>
<numero>7</numero>
<issue>7</issue>
<page-range>997-1007</page-range></nlm-citation>
</ref>
<ref id="B9">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Comitini]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[Gobbi]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Domizio]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Romani]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Lencioni]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[Mannazzu]]></surname>
<given-names><![CDATA[I.]]></given-names>
</name>
<name>
<surname><![CDATA[Ciani]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Selected non- Saccharomyces wine yeasts in controlled multistarter fermentations with Saccharomyces cerevisiae]]></article-title>
<source><![CDATA[Food Microbiology]]></source>
<year>2011</year>
<volume>28</volume>
<numero>5</numero>
<issue>5</issue>
<page-range>873-882</page-range></nlm-citation>
</ref>
<ref id="B10">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[de la Cruz]]></surname>
<given-names><![CDATA[M. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Martínez]]></surname>
<given-names><![CDATA[R. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Becerril]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Chávaro]]></surname>
<given-names><![CDATA[M. S.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Caracterización de vinos tintos producidos en Querétaro]]></article-title>
<source><![CDATA[Revista Fitotecnia Mexicana]]></source>
<year>2012</year>
<volume>35</volume>
<numero>5</numero>
<issue>5</issue>
<page-range>61-67</page-range></nlm-citation>
</ref>
<ref id="B11">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Fernández]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Úbeda]]></surname>
<given-names><![CDATA[J. F.]]></given-names>
</name>
<name>
<surname><![CDATA[Briones]]></surname>
<given-names><![CDATA[A. I.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Typing of non-Saccharomyces yeasts with enzymatic activities of interest in wine-making]]></article-title>
<source><![CDATA[International Journal of Food Microbiology]]></source>
<year>2000</year>
<volume>59</volume>
<page-range>29-36</page-range></nlm-citation>
</ref>
<ref id="B12">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Fleet]]></surname>
<given-names><![CDATA[G. H.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Yeast interactions and wine flavour]]></article-title>
<source><![CDATA[International Journal of Food Microbiology]]></source>
<year>2003</year>
<volume>86</volume>
<page-range>11-22</page-range></nlm-citation>
</ref>
<ref id="B13">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Jolly]]></surname>
<given-names><![CDATA[N. P.]]></given-names>
</name>
<name>
<surname><![CDATA[Augustyn]]></surname>
<given-names><![CDATA[O. P. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Pretorius]]></surname>
<given-names><![CDATA[I. S.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The effect of non-Saccharomyces yeasts on fermentation and wine quality]]></article-title>
<source><![CDATA[South African Journal of Enology and Viticulture]]></source>
<year>2003</year>
<volume>24</volume>
<numero>2</numero>
<issue>2</issue>
<page-range>55-62</page-range></nlm-citation>
</ref>
<ref id="B14">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Jolly]]></surname>
<given-names><![CDATA[N. P.]]></given-names>
</name>
<name>
<surname><![CDATA[Augustyn]]></surname>
<given-names><![CDATA[O. P. H.]]></given-names>
</name>
<name>
<surname><![CDATA[Pretorius]]></surname>
<given-names><![CDATA[I. S.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[The role and use of non-Saccharomyces yeast in wine production]]></article-title>
<source><![CDATA[South African Journal of Enology and Viticulture]]></source>
<year>2006</year>
<volume>27</volume>
<page-range>15-38</page-range></nlm-citation>
</ref>
<ref id="B15">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Lafon-Lafourcade]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[Geneix]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Ribéreau-Gayon]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Inhibition of alcoholic fermentation of grape must by fatty acids produced by yeasts and their elimination by yeast ghosts]]></article-title>
<source><![CDATA[Applied and Environmental Microbiology]]></source>
<year>1984</year>
<volume>47</volume>
<numero>6</numero>
<issue>6</issue>
<page-range>1246-1249</page-range></nlm-citation>
</ref>
<ref id="B16">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Medina]]></surname>
<given-names><![CDATA[K.]]></given-names>
</name>
<name>
<surname><![CDATA[Ferreri]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[Fariña]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[Boido]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Dellacassa]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Gaggero]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Carrau]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Aplicación de la levadura Hanseniaspora vineae en cultivos mixtos con Saccharomyces cerevisiae en la vinificación]]></article-title>
<source><![CDATA[Enología]]></source>
<year>2008</year>
<volume>4</volume>
<page-range>1-6</page-range></nlm-citation>
</ref>
<ref id="B17">
<nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Navarre]]></surname>
<given-names><![CDATA[J. P.]]></given-names>
</name>
<name>
<surname><![CDATA[Navarre]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
</person-group>
<source><![CDATA[Manuel d'oenologie]]></source>
<year>1998</year>
<publisher-loc><![CDATA[París ]]></publisher-loc>
<publisher-name><![CDATA[Lavoisier]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B18">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ocón]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Gutiérrez]]></surname>
<given-names><![CDATA[A. R.]]></given-names>
</name>
<name>
<surname><![CDATA[Garijo]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Tenorio]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[López]]></surname>
<given-names><![CDATA[I.]]></given-names>
</name>
<name>
<surname><![CDATA[López]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[Santamaría]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Quantitative and qualitative analysis of non-Saccharomyces yeasts in spontaneous alcoholic fermentations]]></article-title>
<source><![CDATA[European Food Research and Technology]]></source>
<year>2010</year>
<volume>230</volume>
<numero>6</numero>
<issue>6</issue>
<page-range>885-891</page-range></nlm-citation>
</ref>
<ref id="B19">
<nlm-citation citation-type="">
<collab>Organización internacional de la vid y el vino</collab>
<source><![CDATA[Compendium of international methods of analysis]]></source>
<year>2015</year>
<publisher-loc><![CDATA[París ]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B20">
<nlm-citation citation-type="">
<collab>Organización internacional de la vid y el vino</collab>
<source><![CDATA[International standard for labelling of wine]]></source>
<year>2012</year>
<publisher-loc><![CDATA[París ]]></publisher-loc>
</nlm-citation>
</ref>
<ref id="B21">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Pérez]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
<name>
<surname><![CDATA[Fariña]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[Barquet]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Boido]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Gaggero]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Dellacassa]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Carrau]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[A quick screening method to identify &#946;-glucosidase activity in native wine yeast strains: application of Esculin Glycerol Agar (EGA) medium]]></article-title>
<source><![CDATA[World Journal of Microbiology and Biotechnology]]></source>
<year>2011</year>
<volume>27</volume>
<page-range>47-55</page-range></nlm-citation>
</ref>
<ref id="B22">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Raynal]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Wardrop]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[Pillet]]></surname>
<given-names><![CDATA[O.]]></given-names>
</name>
<name>
<surname><![CDATA[Languet]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Heras]]></surname>
<given-names><![CDATA[J. M.]]></given-names>
</name>
<name>
<surname><![CDATA[Dumon]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[Ortiz]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Fermentación controlada mediante la inoculación secuencial de una levadura no-Saccharomyces y de una levadura Saccharomyces cerevisiae, una herramienta innovadora para el enólogo]]></article-title>
<source><![CDATA[Alimentaria]]></source>
<year>2011</year>
<volume>428</volume>
<page-range>83-92</page-range></nlm-citation>
</ref>
<ref id="B23">
<nlm-citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ribéreau-Gayon]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Dubordieu]]></surname>
<given-names><![CDATA[D.]]></given-names>
</name>
<name>
<surname><![CDATA[Donèche]]></surname>
<given-names><![CDATA[B.]]></given-names>
</name>
<name>
<surname><![CDATA[Lonvaud]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
</person-group>
<source><![CDATA[Handbook of Enology. Vol.1.The Microbiology of Wine and Vinifications]]></source>
<year>2006</year>
<edition>2</edition>
<publisher-loc><![CDATA[Burdeos ]]></publisher-loc>
<publisher-name><![CDATA[John Wiley and Sons, Ltd.]]></publisher-name>
</nlm-citation>
</ref>
<ref id="B24">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Ricci]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Martini]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[Bonechi]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Trabalzini]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
<name>
<surname><![CDATA[Santucci]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
<name>
<surname><![CDATA[Rossi]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Inhibition effects of ethanol on the kinetics of glucose metabolism by S. cerevisiae: NMR and modeling study]]></article-title>
<source><![CDATA[Chemical Physics Letters]]></source>
<year>2004</year>
<volume>387</volume>
<numero>46</numero>
<issue>46</issue>
<page-range>377-382</page-range></nlm-citation>
</ref>
<ref id="B25">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Romano]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Fiore]]></surname>
<given-names><![CDATA[C.]]></given-names>
</name>
<name>
<surname><![CDATA[Paraggino]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Caruso]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Capece]]></surname>
<given-names><![CDATA[A.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Function of yeast species and strains in wine flavour]]></article-title>
<source><![CDATA[International Journal of Food Microbiology]]></source>
<year>2003</year>
<volume>86</volume>
<numero>1</numero>
<issue>1</issue>
<page-range>169-180</page-range></nlm-citation>
</ref>
<ref id="B26">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Sandoval-Chávez]]></surname>
<given-names><![CDATA[R. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Martínez-Peniche]]></surname>
<given-names><![CDATA[R. A.]]></given-names>
</name>
<name>
<surname><![CDATA[Hernández-Iturriaga]]></surname>
<given-names><![CDATA[M.]]></given-names>
</name>
<name>
<surname><![CDATA[Fernández-Escartín]]></surname>
<given-names><![CDATA[E.]]></given-names>
</name>
<name>
<surname><![CDATA[Arvizu-Medrano]]></surname>
<given-names><![CDATA[S.]]></given-names>
</name>
<name>
<surname><![CDATA[Soto-Martínez]]></surname>
<given-names><![CDATA[L.]]></given-names>
</name>
</person-group>
<article-title xml:lang="es"><![CDATA[Control biológico y químico contra control biológico y químico contra Fusarium stilboides en pimiento morrón en poscosecha]]></article-title>
<source><![CDATA[Revista Chapingo Serie Horticultura]]></source>
<year>2011</year>
<volume>17</volume>
<numero>2</numero>
<issue>2</issue>
<page-range>161-172</page-range></nlm-citation>
</ref>
<ref id="B27">
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname><![CDATA[Zironi]]></surname>
<given-names><![CDATA[R.]]></given-names>
</name>
<name>
<surname><![CDATA[Romano]]></surname>
<given-names><![CDATA[P.]]></given-names>
</name>
<name>
<surname><![CDATA[Suzzi]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
<name>
<surname><![CDATA[Battistutta]]></surname>
<given-names><![CDATA[F.]]></given-names>
</name>
<name>
<surname><![CDATA[Comi]]></surname>
<given-names><![CDATA[G.]]></given-names>
</name>
</person-group>
<article-title xml:lang="en"><![CDATA[Volatile metabolites produced in wine by mixed and sequential cultures of Hanseniaspora guilliermondii or Kloeckera apiculata and Saccharomyces cerevisiae]]></article-title>
<source><![CDATA[Biotechnology Letters]]></source>
<year>1993</year>
<volume>15</volume>
<numero>3</numero>
<issue>3</issue>
<page-range>235-238</page-range></nlm-citation>
</ref>
</ref-list>
</back>
</article>
