Serviços Personalizados
Journal
Artigo
texto em 
Inglês (pdf)
Artigo em XML
Referências do artigo
Tradução automática
Enviar este artigo por emailIndicadores
-
Citado por SciELO -
Acessos
Links relacionados
-
Similares em
SciELO
Compartilhar
Permalink
Abanico veterinario
versão On-line ISSN 2448-6132versão impressa ISSN 2007-428X
Abanico vet vol.12 Tepic Jan./Dez. 2022 Epub 31-Out-2022
https://doi.org/10.21929/abavet2022.6
Original Article
Ruminal bacteria and protozoa present in sheep supplemented with probiotics identified by counting and PCR endpoint
1
*
http://orcid.org/0000-0002-6640-2753
2
**
http://orcid.org/0000-0001-9298-0840
1
http://orcid.org/0000-0002-3247-568X
2
http://orcid.org/0000-0002-6170-5464
1Unidad Académica de Ciencias Biológicas, Universidad Autónoma de Zacatecas. Avenida preparatoria s/n colonia Hidráulica, CP. 98068, Zacatecas, Zacatecas, México.
2Unidad Académica de Medicina Veterinaria y Zootecnia, Universidad Autónoma de Zacatecas. Carretera Panamericana Fresnillo-Zacatecas s/n, Centro, CP. 98500 Víctor Rosales, Zacatecas, México.
3Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Campo experimental Zacatecas, México.
4Facultad de Medicina Veterinaria y Zootecnia. Centro de Investigación y Estudios Avanzados en Salud Animal. Universidad Autónoma del Estado de México. Toluca, México.
Some microbial cultures, mainly the use of probiotics, have been used in ruminant nutrition, generating a positive effect by solving imbalances due to dietary changes in the rumen. The objective was to identify and evaluate bacteria and ruminal protozoa present in sheep supplemented with biopreparation of microorganisms (PNC) vs commercial probiotic REVET® (PCRE) at different concentrations by Neubauer chamber count and PCR endpoint. Twenty-one Katahdin and Dorper cross sheep of 3 months of 18-25 kg were used, they were supplemented with PNC and PCRE, at different concentrations: PNC 100%, 66%, 33%, control, PCRE 100%, 66%, 33%. The ruminal liquid was obtained through a probe, the ruminal microorganisms were counted in a Neubauer chamber every six hours. Genomic DNA extraction using the Ultra Clean Microbial DNA kit, DNA quantification was performed in a spectrophotometer, and PCR reactions were performed with oligonucleotides synthesized by Invitrogen®. Statistical analysis was through the GENMODE procedure for counting bacteria and protozoa. The highest amount of protozoa was at 24 hours in PNC at 100%, followed by PNC 33% at 18 hours, for commercial probiotic PCRE at 66% at 12 hours. Regarding bacteria, they showed statistically equal values. Genomic DNA quantification was greater than 25 ng/µL. The inhibitory effect of the probiotic on Fibrobacter succinogenes at a concentration of 100% was demonstrated. Total bacteria were not affected by probiotic supplementation. Therefore, it is concluded that the non-commercial probiotic can be an alternative to supplement the diet of growing sheep, observing an increase in bacteria and protozoa. Likewise, probiotics are an additive that can be used successfully since they did not modify the population of total bacteria in the rumen.
Keywords: sheep; ruminal fermentation; bacteria; protozoan; PCR
Algunos cultivos microbianos principalmente el uso de probióticos se han utilizado en la nutrición de rumiantes, generando un efecto positivo al solucionar los desbalances debido a cambios dietéticos en el rumen. El objetivo fue identificar y evaluar por conteo en cámara de Neubauer y PCR punto final bacterias y protozoarios ruminales presentes en ovinos suplementados con biopreparado de microorganismos (PNC) vs probiótico comercial REVET® (PCRE) a diferentes concentraciones. Se utilizaron 21 ovinos cruza Katahdin y Dorper de 3 meses de 18-25 Kg, se suplementaron con PNC y PCRE, a diferentes concentraciones: PNC 100%, 66%, 33%, testigo, PCRE 100%, 66%, 33%. El líquido ruminal se obtuvo a través de sonda, los microorganismos ruminales se contaron en cámara de Neubauer cada seis horas. La extracción de ADN genómico utilizando el kit Ultra Clean Microbial DNA, la cuantificación de ADN se realizó en un espectrofotómetro y las reacciones de PCR se realizaron con oligonucleótidos sintetizados por Invitrogen®. El análisis estadístico fue mediante el procedimiento GENMODE para el conteo de bacterias y protozoarios. La mayor cantidad de protozoarios fue a las 24 horas en PNC al 100%, seguido del PNC 33% a las 18 horas, para probiótico comercial PCRE al 66% a 12 horas. En cuanto a bacterias mostraron valores estadísticamente iguales. La cuantificación de ADN genómico fue mayor a 25 ng/µL. Se demostró el efecto inhibitorio del probiótico sobre Fibrobacter succinogenes en una concentración de 100%. Las bacterias totales no se vieron afectadas con la suplementación del probiótico. Por lo que se concluye que el probiótico no comercial puede ser una alternativa para complementar la dieta de los ovinos en crecimiento observándose un incremento de bacterias y protozoarios. Así mismo, los probióticos son un aditivo que puede ser utilizado con éxito ya que no modificó la población de bacterias totales en el rumen.
Palabras clave: ovinos; fermentación ruminal; bacterias; protozoario; PCR
INTRODUCTION
Livestock production systems develop dietary formulations using feed additives that have the potential to modify the rumen environment by enhancing or inhibiting specific microbial populations, probiotics have been used to enhance the rumen microbiota, which is responsible for the degradation of cellulose and hemicellulose, which allows ruminants to feed on pasture and forage consumption. In addition, probiotics can be used to modulate rumen fermentation and native microbiota, as they are a source of potentially useful microorganisms (Fraga et al., 2014).
Microbial probiotics (Saccharomyces cerevisiae, Lactobacillus plantarum and Bacillus subtilis) used in ruminants improve dry matter intake and productivity. S. cerevisiae yeast is important and its inclusion in diets is known to improve utilization of poor quality forages (Shriver-Munsch et al., 2011; Khattab et al., 2020), increases fiber digestibility and stabilizes rumen pH (Moallem et al., 2009; Degirmencioglu et al., 2013; Meller et al., 2014; Khattab et al., 2020). Lactobacillus plantarum improves nutrient intake, growth performance and ruminal fermentation in lambs (Izuddin et al., 2019; Khattab et al., 2020). Qiao et al. (2010) mentioned that B. subtilis in lambs reduced the incidence of diarrhea, increased dry matter intake and daily weight gain before weaning. Probiotics influence the intestinal tract with symbiosis of beneficial bacteria, on host health which may also involve growth stimulation and contribute to higher productivity (Markowiak & Ślizewska, 2018).
The concentration of microbial populations living in the rumen in anaerobiosis, specifically for bacteria, protozoa and fungi are 1010 cells/mL, 106 cells/mL and 104 cells/mL respectively (Jouany, 1994; Cardona-Iglesias et al., 2017). To allow slow-growing organisms; such as fungi and ruminal protozoa to reproduce, prolonged residence of the feed inside the rumen for periods of 48 to 72 hours is needed to sustain the concentration of microbial populations (McAllister et al., 1994, Gharechahi et al., 2021). Castillo-Lopez & Domínguez-Ordóñez (2019), Castillo-Lopez et al. (2014) and Petri et al. (2012) report that by using high-throughput DNA sequencing they have revealed the presence of 13 major bacterial phyla in the rumen, which include 40 bacterial orders, about 80 bacterial classes, and at least 180 bacterial families, about 320 bacterial genera and more than 2,000 operational bacterial taxonomic units. Bacterial density in the rumen is in the range of 107 to 1010 cells/mL of rumen fluid (Castillo-Lopez et al., 2014; Danielsson et al., 2017). The most abundant ruminal bacterial genus is Prevotella, which accounts for 20% of the bacterial community (Castillo-Lopez & Domínguez-Ordóñez, 2019).
Although the number of protozoan genera is smaller than that of bacteria, protozoa are physically larger than bacteria and may constitute approximately half of the total ruminal microbial biomass. Of the protozoa, more than 20 species have been identified whose concentration in the rumen is approximately 106 cells/mL of rumen fluid (Martin, 1994; Bodas et al., 2012; Castillo-Lopez & Domínguez-Ordóñez, 2019).
Fibrobacter succinogenes is a dominant species in the gastrointestinal system of herbivorous animals; it is characterized as a Gram-negative, anaerobic bacterium with the ability to degrade fiber and in greater quantity (Kobayashi, 2006; Jun et al., 2007). This bacterium, which is also one of only two cultivated species, is an efficient cellulose degrader. Specifically, it has a particularly high activity against crystalline cellulose that requires close physical contact with this substrate (Suen et al., 2011). Therefore, the objective was to identify and evaluate by counting and endpoint PCR ruminal bacteria and protozoa present in sheep supplemented with microorganism biopreparation (PNC) vs. commercial probiotic REVET® (PCRE) at different concentrations.
MATERIAL AND METHODS
Experimental design for animals
The experiment was conducted in El Remolino community, Juchipila municipality, Zacatecas, Mexico, located between 103˚07'26.15'' N and 21˚21'48.10'' W, at 1220 m a.s.l. The study was conducted in the dry season (dry season with average high temperatures of 38-40°C) starting at the end of March and ending with the first rains in June. It included 21 growing hair lambs, Katahdin X Dorper cross, healthy, aged 59 ± 5 days, with average weights of 14.3 ± 1. 7 kg, housed in homogeneous conditions in individual wire mesh pens, canoe feeders, 20 liter bucket as water trough for each pen, supplementation with the different doses of the non-commercial probiotic biopreparation and commercial probiotic REVET® was added in water, which was ad libitum (El-Sayed & Mousa, 2020). Growing sheep were allocated into two groups and distributed as shown in Table 1. A diet based on ground corn stubble 70%, ground alfalfa 15%, corn grain 5%, molasses 8%, bicarbonate 1.5%, vitamin and mineral premix 0.1%, common salt 0.4% was fed. The experimental units were subjected to a 17-day adaptation period prior to the dry season, from March to June.
Table 1 Treatments used in drinking water
| Treatments | % Dose | Quantity of animals |
|---|---|---|
| T1 PNC | 100% of the recommended dosage in 6 L of water + diet | 3 |
| T2 PNC | 66% of the recommended dosage in 6 L of water + diet | 3 |
| T3 PNC | 33% of the recommended dosage in 6 L of water + diet | 3 |
| T4 control | 0% of the recommended dosage in 6 L of water + diet | 3 |
| T5 PCRE | 100 % of the recommended dosage in 6 L of water + diet | 3 |
| T6 PCRE | 66 % of the recommended dosage in 6 L of water + diet | 3 |
| T7 PCRE | 33% of the recommended dosage in 6 L of water + diet | 3 |
PNC: biopreparation of microorganisms. PCRE: commercial probiotic REVET®
Preparation of the solid biopreparation of microorganisms (PNC)
For the preparation of the solid PNC, 40 kg of wheat bran, 20 kg of forest probiotic (decomposing organic matter) containing the efficient solid microorganisms (biopreparation), 0.5 kg molasses solution in five liters of water were mixed in a plastic barrel with a capacity of 100 liters. The container was opened every two to three days to release gases generated during the 30 days it took for the PNC to be ready and as reported by Kyan et al. (1999).
Preparation of liquid PNC
To prepare the liquid PNC, 8 kg of solid PNC were taken, were wrapped in a blanket and placed in 100 L of water with 5 kg of molasses, and left to stand for two hours (Kyan et al., 1999), after which time it was ready to be used. Subsequently, the content of microorganisms was characterized by using selective media sown on a plate. The administration NCP contained: mesophiles 1.94x107 CFU/100mL, Lactobacillus sp. 1.6x106 CFU/100mL, Staphylococcus aureus 4.2x104 CFU/100mL, Candida sp. 5.5x103 CFU/100mL, E. coli 1.18x106 CFU/100mL, fungi 4.0x105 CFU/100mL and yeasts 4.27x107. Table 1 shows the PNC supply in the different treatments.
Preparation of the liquid commercial probiotic REVET® (PCRE)
The probiotic for administration contributes to the balance of intestinal microorganisms in sheep, prevents ruminal dysfunction, increases microbial synthesis, and maintains the balance and optimal conditions of the rumen flora. The doses recommended by the manufacturer are 3 g per day in sheep, which were diluted in 6 liters of water (100%), 1.32 g diluted in 6 liters of water (66%) and 0.99 g diluted in 6 liters of water (33%). According to the supplier's specifications, it contains Lactobacillus acidophilus 7.3x1018 CFU/100mL, Streptococcus faecium 1.1x106 CFU/100mL and Saccharomyces cerevisiae 3.6x1011 CFU/100mL. The probiotic was offered in the 6 liters of water every day at 08:00 hours.
Obtaining the rumen liquid
The ruminal fluid was obtained by means of a 0.5" and 1m long ruminal probe attached to a syringe. The experiment lasted 110 days; of which the sampling times were m1 (time 0), m2 (30 days), m3 (60 days) and m4 (110 days); m3 sampling was performed every 6 hours at eight time intervals (0, 6, 12, 12, 18, 24, 30, 36 and 48 hours). Approximately 30 mL of ruminal fluid was collected.
Obtaining and quantification of bacteria and protozoa
The rumen liquid obtained was mixed and filtered to obtain a homogeneous sample and filtered. With a pipette, 1 mL of ruminal liquid was extracted, to which 9 mL of saline solution with 10% formalin were added, then the samples were refrigerated for later analysis, 2 mL of this last solution were obtained and 8 mL of distilled water were added, which was centrifuged at 2000 xg for 20 minutes, from the supernatant a sample was taken for counting in the Neubauer chamber with the support of a Carl Zeiss microscope at 40X.
PCR endpoint
Total bacteria, Fibrobacter succinogenes and ruminal anaerobic fungi were identified by endpoint PCR; the method consisted of obtaining ruminal liquid through a 0.5" and 1m long probe attached to a syringe; this aliquot was kept at -20°C for later processing in the laboratory. DNA extraction was performed with the Ultra Clean Microbial DNA Isolation kit from MO BIO Laboratories Inc and its quantification was carried out in a spectrophotometer (NanoDrop ND-1000 LabTech), its purity was determined considering absorbance ratios of 260/280 and 260/230 nm (Green et al., 2012; Daza et al., 2014). Dilutions of the DNA extracted from each sample were performed in order to place 50 ng/µL equimolar concentrations. The sequence of the oligonucleotides used is shown in Table 2 in addition to the molecular weight of each fragment.
Table 2 Sequence of oligonucleotides
| Destination species | Oligonucleotide sequence | pb |
|---|---|---|
| Total bacteria | f- CGGCAACGAGCGCGAACCC r- CCATTGTAGCACGTGTGTAGCC | 130 |
| Fibrobacter succinogenes | f- GTTCGGAATTACTGGGCGTAAA r- CGCCTGCCCCTGAACTATC | 121 |
| Anaerobic fungi | f- GAGGAAGTAAAAGTCGTAACAAGGTTTC r- CAAATTCACAAAGGGTAGGATGATT | 120 |
PCR mix had a final volume of 25 µL, which contained: reaction buffer 1X (Tris-HCl 20 mM pH 8.4, KCL 50 mM (Invitrogen®)), MgCl2 1. 2 mM (Invitrogen®)), MgCl2 1.25mM (Invitrogen®), dNTPs 0.25 µM (Invitrogen®), each primer 0.5 µM of, Platinum Taq DNA Polymerase 1U (Invitrogen®), and ampoule water. To avoid contamination, the reaction mixture was carried out in a laminar flow hood (FH1200). The amplified products were subjected to electrophoresis in a horizontal chamber (Thermo® EC 330) in 0.8% agarose gels in TAE 1X with ethidium bromide, using Wide Range DNA Marker from 250 to 10,000 bp (Sigma-Aldrich®) as a reference marker.
Statistical analysis
An analysis of orthogonal contrasts and the chi-square test was performed in the SAS program (SAS, 2011), and the GENMOD procedure of SAS was used for counting protozoa and bacteria (Castañeda et al., 2021).
RESULTS AND DISCUSSION
The bacteria, protozoa and fungi that make up the rumen ecosystem differ in their nutrient requirements and metabolism (Bach et al., 2005; Rodríguez et al., 2007; Matthews et al., 2018). Anaerobic rumen bacteria, protozoa and fungi degrade fibrous material, which allows ruminants to utilize plant fiber for nutrition (Rodríguez et al., 2007). Bacteria are the most numerous microorganisms and, like the previous ones, play an important role in the biological degradation of dietary fiber, Rodríguez et al. (2012) state that there are many bacteria and yeasts that can be used in a beneficial way to maintain a healthy and balanced digestive flora.
Table 3 shows the results of the protozoa count carried out every six hours, where it is observed that the 100% PCRE treatment presents the lowest values at time zero (7.5x103 cells/mL), when in general the average is 105 cells/mL.
Table 3 Quantification of protozoa (cells/mL) treatment Probiotic Non-Commercial (PNC) and Probiotic Commercial REVET® (CRE) at different time (hours) HOURS
| HOURS | 0 | 6 | 12 | 18 | 24 | 30 | 36 | 48 |
|---|---|---|---|---|---|---|---|---|
| CONTROL | 1.5x105 | 8.7x104 | 2.5x104 | 1.2x105 | 1.5x105 | 7.2x104 | 5.5x104 | 2.5x104 |
| PNC 100% | 1.0x105 | 1.1x105 | 5.2x104 | 1.0x105 | 1.5x105 | 7.5x104 | 7.2x104 | 8.2x104 |
| PNC 66% | 1.0x104 | 6.5x104 | 1.3x105 | 1.2x105 | 8.7x104 | 3.0x104 | 5.7x104 | 4.0x104 |
| PNC 33% | 3.5x104 | 9.5x104 | 3.7x104 | 1.5x105 | 4.7x104 | 2.5x104 | 1.7x104 | 1.1x105 |
| CONTROL | 1.5x105 | 8.7x104 | 2.5x104 | 1.2x105 | 1.5x105 | 7.2x104 | 5.5x104 | 2.5x104 |
| PCRE 100% | 7.5x103 | 1.7x104 | 4.7x104 | 2.2x104 | 3.5x104 | 1.1x105 | 2.7x104 | 1.0x104 |
| PCRE 66% | 1.2x105 | 2.4x105 | 2.4x105 | 9.7x104 | 1.1x105 | 6.0x104 | 6.5x104 | 6.0x104 |
| PCRE 33% | 1.7x105 | 4.2x104 | 1.9x105 | 3.2x104 | 3.5x104 | 7.5x103 | 9.7x104 | 2.1x105 |
PNC: biopreparation of microorganisms. PCRE: commercial probiotic REVET®
Table 4 and 5 present the results of the statistical analysis showing that the comparison between treatments is significant (P<0.05), but not between counting times (P>0.05).
Table 4 Comparison of protozoan counts between PNC and PCRE treatments
| Treatment | Average estimate | Mean Confidence limit | Estimate β | Standard error | Chi Square | P> Chi Square | |
|---|---|---|---|---|---|---|---|
| PNC100%-PCRE100% | 0.9618 | 0.7958 | 0.9939 | 3.2258 | 0.9518 | 11.49 | 0.0007 |
| PNC100%-PCRE66% | 0.3547 | 0.1004 | 0.7303 | -0.5985 | 0.8136 | 0.54 | 0.462 |
| PNC100%-PCRE33% | 0.6563 | 0.2025 | 0.9349 | 0.6468 | 1.0294 | 0.39 | 0.5298 |
| PNC66%-PCRE100% | 0.9012 | 0.6083 | 0.9817 | 2.2106 | 0.9033 | 5.99 | 0.0144 |
| PNC66%-PCRE66% | 0.1661 | 0.0368 | 0.5096 | -1.6137 | 0.843 | 3.66 | 0.0556 |
| PNC66%-PCRE33% | 0.4089 | 0.0853 | 0.8369 | -0.3684 | 1.0223 | 0.13 | 0.7185 |
| PNC33%-PCRE100% | 0.8515 | 0.4865 | 0.972 | 1.7468 | 0.9188 | 3.61 | 0.0573 |
| PNC33%-PCRE66% | 0.1113 | 0.0207 | 0.4259 | -2.0775 | 0.9075 | 5.24 | 0.0221 |
| PNC33%-PCRE33% | 0.3032 | 0.0513 | 0.7779 | -0.8322 | 1.0641 | 0.61 | 0.4342 |
| PNC100%-CONTROL | 0.5822 | 0.2133 | 0.8775 | 0.3319 | 0.8352 | 0.16 | 0.6911 |
| PNC66%- CONTROL | 0.3355 | 0.0871 | 0.7277 | -0.6834 | 0.8501 | 0.65 | 0.4215 |
| PNC33%- CONTROL | 0.241 | 0.0501 | 0.6567 | -1.1472 | 0.9163 | 1.57 | 0.2106 |
| PCRE100%-CONTROL | 0.0525 | 0.008 | 0.2758 | -2.894 | 0.984 | 8.65 | 0.0033 |
| PCRE66%- CONTROL | 0.7171 | 0.313 | 0.9338 | 0.9303 | 0.8757 | 1.13 | 0.2881 |
| PCRE33%- CONTROL | 0.4219 | 0.0832 | 0.8544 | -0.3149 | 1.0637 | 0.09 | 0.7672 |
PNC: biopreparation of microorganisms. PCRE: commercial probiotic REVET®
Between-treatment test contrasts show that the PNC treatment at 100% is different (P<0.05) from its counterpart PCRE at 100%, PNC at 66% is different (P<0.05) from PCRE at 100% and 66% (P=0.055) and PNC at 33% is different (P>0.057) from PCRE at 100% and 66% (P<0.05), as well as PCRE 100% was different (P>0.05) from the control.
Table 5 Analysis of variance
| Source | Degrees of freedom | Chi Square | P> Chi Square |
|---|---|---|---|
| Treatment | 6 | 18.43 | 0.0052 |
| Time | 7 | 7.17 | 0.4118 |
The chi-square test for the number of protozoa in the PNC vs. PCRE treatments at 66% of the recommended dose. It did not show a higher number of protozoa in the PNC, although a more favorable growth was observed with respect to the PCRE at 66% with a P<0.0556. In the PNC vs. PCRE treatments at 33% concentration, no statistically significant difference was observed between the counts of protozoa in the 33% PNC and PCRE treatments (P<0.05).
Bacterial counts were performed every 6 hours in eight time intervals obtaining average concentrations of 106 cells/mL in most of the times and treatments, being the 66% PNC treatment the one that presented the highest concentration of bacteria (1.49x107 cells/mL), while in the 30-hour time the lowest concentration was identified in the different treatments (Table 6).
Table 6 Quantification of bacteria in the PNC and PCRE treatments (cells/mL) at different times (hours) HOURS
| HOURS | 0 | 6 | 12 | 18 | 24 | 30 | 36 | 48 |
|---|---|---|---|---|---|---|---|---|
| Control | 3.1x106 | 1.6x106 | 1.0x106 | 2.75x106 | 9.5x105 | 2.8x106 | 1.6x106 | 1.65x106 |
| PNC 100% | 2.7x106 | 2.5x106 | 1.4x106 | 2.5x106 | 2.6x106 | 8.0x105 | 1.7x106 | 8.5x105 |
| PNC 66% | 2.55x106 | 1.25x106 | 1.49x107 | 2.8x106 | 8.75x106 | 5.0x105 | 1.25x106 | 2.5x106 |
| PNC 33% | 3.5x106 | 8.45x106 | 1.25x106 | 6.05x106 | 1.6x106 | 1.5x105 | 2.9 x106 | 4.45x106 |
| Control | 3.1x106 | 1.6x106 | 1.0x106 | 2.75x106 | 9.5x105 | 2.8x106 | 1.6x106 | 1.65x106 |
| PCRE 100% | 7.5x105 | 1.35x106 | 1.35x106 | 3.65x106 | 2.5x106 | 3.7x106 | 3.35x106 | 1.05x106 |
| PCRE 66% | 3.2x106 | 5.3x106 | 1.45x106 | 2.8x106 | 1.4x106 | 5.6x106 | 3.9x106 | 5.15x106 |
| PCRE 33% | 4.05x106 | 2.15x106 | 2.8x106 | 5.9x106 | 7.0x106 | 4.5x105 | 1.7x106 | 1.85x106 |
PNC: biopreparation of microorganisms. PCRE: commercial probiotic REVET®.
In work by Uchida et al. (1987) reported that a single protozoan can take up to 104 bacteria per hour. These estimates indicate that protozoan predation can renew the entire bacterial biomass in the rumen at high protozoan density (105 to 106). Sheep supplemented with PNC and PCRE benefit in protozoan and bacterial populations.
Table 7 and 8 shows the chi-square test in which it is observed that there is no statistically significant difference between the bacterial counts with the different doses of PNC vs PCRE studied (P<0.05). The only comparison showed differences between PNC 100% vs PCRE 66%, being higher in PCRE 66%.
Table 7 Comparison of bacterial counts between PNC and PCRE treatments
| Treatment | Average estimate | Mean Confidence limit | Estimate β | Standard error | Chi Square | P> Chi Square | |
|---|---|---|---|---|---|---|---|
| PNC100%-PCRE100% | 0.4364 | 0.1282 | 0.803 | -0.2557 | 0.8475 | 0.09 | 0.7629 |
| PNC100%-PCRE66% | 0.1458 | 0.0299 | 0.4859 | -1.7679 | 0.8732 | 4.1 | 0.0429 |
| PNC100%-PCRE33% | 0.2255 | 0.0538 | 0.5987 | -1.2339 | 0.8338 | 2.19 | 0.1389 |
| PNC66%-PCRE100% | 0.5539 | 0.1625 | 0.8882 | 0.2164 | 0.947 | 0.05 | 0.8192 |
| PNC66%-PCRE66% | 0.2149 | 0.0401 | 0.6421 | -1.2958 | 0.9594 | 1.82 | 0.1768 |
| PNC66%-PCRE33% | 0.3183 | 0.0712 | 0.7398 | -0.7618 | 0.9218 | 0.68 | 0.4086 |
| PNC33%-PCRE100% | 0.7429 | 0.3163 | 0.9475 | 1.0611 | 0.9348 | 1.29 | 0.2563 |
| PNC33%-PCRE66% | 0.3891 | 0.0952 | 0.794 | -0.4511 | 0.9186 | 0.24 | 0.6234 |
| PNC33%-PCRE33% | 0.5207 | 0.1567 | 0.864 | 0.0829 | 0.901 | 0.01 | 0.9267 |
| PNC100%-CONTROL | 0.4713 | 0.1579 | 0.8091 | -0.1148 | 0.7955 | 0.02 | 0.8852 |
| PNC66%- CONTROL | 0.5884 | 0.2011 | 0.8903 | 0.3573 | 0.886 | 0.16 | 0.6867 |
| PNC33%- CONTROL | 0.7689 | 0.3639 | 0.9509 | 1.202 | 0.8983 | 1.79 | 0.1809 |
| PCRE100%- CONTROL | 0.5352 | 0.1744 | 0.8625 | 0.1409 | 0.8652 | 0.03 | 0.8707 |
| PCRE66%- CONTROL | 0.8393 | 0.4782 | 0.9675 | 1.6531 | 0.8879 | 3.47 | 0.0626 |
| PCRE33%- CONTROL | 0.7538 | 0.366 | 0.942 | 1.1191 | 0.8513 | 1.73 | 0.1886 |
PNC: biopreparation of microorganisms. PCRE: commercial probiotic REVET®
Table 8 Analysis of variance
| Source | Freedom degrees | Chi Square | P> Chi Square |
|---|---|---|---|
| Treatment | 6 | 7.01 | 0.399 |
| Time | 7 | 7.17 | 0.2574 |
Sheep supplemented with PNC and PCRE are benefited in the populations of protozoa and bacteria. According to Williams & Coleman (2012) the multiplication times for protozoa vary from 5-14 hours, coinciding with the times of concentrations in the PCRE the maximum populations were presented at 12 hours at 66% and at 18 hours with 33%, Jouany (1994) and Williams & Coleman (2012) found that several species of ruminal protozoa have alpha amylase and one of those with the highest amylolytic activity of this type is Entodinium caudatum, likewise, Mould & Thomas (1958) and Arcos-García et al., (2007), found alpha and beta amylase in holotrophic protozoa that promote the splitting of the reserve and structural sugar units of plants.
In the nutritional part, probiotics and enterobacteria compete for essential amino acids and sugars, reduce the production of toxic amines, this is remedied with acidophilic Lactobacillus important to the health status of the animal (Castillo-Lopez et al., 2013). The bacterial density in the rumen 107 and 1010 rumen fluid cells, the most abundant bacteroid phyla include 75% of the total bacterial population (Castillo-Lopez & Domínguez-Ordóñez, 2019).
Non-commercial probiotics (NCPs) can be an alternative to supplement the diet of growing sheep, it is necessary to indicate that NCPs in sheep could be used to optimize production in the integral diet of animals, without causing negative impact on the ecology which can be achieved through the direct supply of NCPs and PCRE.
Regarding the DNA concentrations recorded for the control treatment, an average concentration of 58.36 ng/µL was obtained, with a minimum value of 28 ng/µL and a value of 100 ng/µL. Table 9 shows each of the concentrations obtained, as well as the 260/280 ratio, which indicates that the DNA purity is adequate for PCR protocols.
In sheep supplemented with CNP, genomic DNA was obtained at the following average concentrations 77.6 ng/µL, 69.7 ng/µL and 70.18 ng/µL, in the 100%, 66% and 33% treatments, respectively (Table 9). The concentrations of DNA obtained from rumen fluid microorganisms of sheep supplemented with PCRE averaged 46.81 ng/mL in 100%, 46.09 ng/mL in 66% and 36.36 ng/mL in 33%.
Table 9 DNA concentrations of samples in different treatments
| Control | PNC 100% | PNC PNC PCRE 66% 33% 100% | PCRE 66% | PCRE 33% | ||||
|---|---|---|---|---|---|---|---|---|
| Sampling | Concentration (ng/mL) | |||||||
| M1 (0 Days) | 48 | ---- | ----- | 72 | 103 | 65 | 52 | |
| M2 (30 Days) | 65 | 94 | 84 | 64 | 60 | 72 | -------- | |
| 6hr | 57 | 136 | 41 | 34 | 36 | 37 | 28 | |
| 12hr | 28 | 45 | 95 | 127 | 59 | 30 | 30 | |
| 18hr | 100 | 26 | 78 | 199 | 37 | 36 | 29 | |
| 24hr | 88 | 234 | 109 | 34 | 28 | 61 | 42 | |
| 30hr | 58 | 46 | 48 | 23 | 25 | 53 | ------ | |
| M3 (60 Days) | 36hr | 70 | 46 | 49 | 42 | 48 | 31 | 85 |
| 42hr | 31 | 38 | 74 | 37 | 55 | 48 | 55 | |
| 48hr | 55 | 44 | 50 | 71 | 25 | 29 | 45 | |
| M4 (110 Days) | 42 | 61 | 69 | 69 | 39 | 45 | 34 | |
PNC: biopreparation of microorganisms. PCRE: commercial probiotic REVET®
The diversity of total bacteria in the rumen is important during feed degradation and fermentation, since this allows having a wide variety of enzymes, as well as precise biochemical reactions that help hydrolyze the plant material to simpler structures and can have greater availability for the microorganisms and increase the fermentation products (López et al., 2020).
With respect to total bacteria, the PCR amplification band corresponds to 130 bp, being able to identify this characteristic band in the control gel, which corresponds to Figure 1 (A). According to these results, it can be mentioned that the probiotic with the best adaptation effect on total bacteria was the PNC, since it allowed the bacterial microbiota to continue growing in the rumen and, therefore, did not affect feed degradation and ruminal fermentation.
Rumen bacteria are involved in cellulose degradation, this species presents more than 100 sequences coding for enzymes that degrade polysaccharides (Morrison et al., 2003; Jun et al., 2007; Firkins, 2021), most of them are responsible for the degradation of cellulosic substrates, in addition these bacteria degrade xylan, hemicellulose and the monosaccharides of plant walls (Mirón, 1991; Hobson & Stewart, 2012).
It was demonstrated that PCRE has an inhibitory effect on Fibrobacter succinogenes at a concentration of 100%, since the specific band for the oligonucleotide (121 bp) is not observed compared to the control as seen in Figure 1 (H), however, for the concentrations of 66 and 33% this band is present (Figure 1, J, K).
Figure 1 Band amplification by PCR. Lane 1, Molecular weight marker (250 to 10,000 bp); MP range Lane 2, M1 (0 days); Lane 3, M2 (30 days); Lane 4 to 11, M3 (60 days -6, 12, 18, 24, 30, 36, 42, 48 h-); Lane 12, M4 (110 days). Total bacteria (A, B, C, D, E, F, G), Fibrobacter succinogenes (H, I, J, K, L, M, N) and anaerobic fungi (O, P, Q, R, S, T, U) in each of the treatments (Control, 100%, 66% and 33%) with commercial probiotic (PCRE) and non-commercial probiotic (PNC)
Ruminal anaerobic fungi play a strategic role in the digestion of fibrous feeds, since they present a great ability to colonize lignified cellulose walls and to weaken fibrous plant tissues, as well as the degradation of the structural components of their cell wall (Galindo et al., 2017). For anaerobic fungi (120 bp), these were not affected with probiotic supplementation at any of their concentrations (Figure 1, P, Q, R, S, T, U).
The effect of probiotics seems to be related to the mechanisms and metabolic processes carried out by the microorganisms involved in ruminal fermentation and methane formation, Rodríguez et al. (2013) state that there are many bacteria and yeasts that can be used in a beneficial way to maintain a healthy and balanced digestive flora. The most commonly used microorganisms are Lactobacillus sp., Sreptococcus faeccium, B. subtilis, B. cereus, B. licheniformis, B. stearothermophyllus and S. cerevisiae.
Lactobacillus grow rapidly in the intestine and are perhaps the best-known bacteria that can transform lactose into lactic acid. This increase in lactic acid decreases the intestinal pH, which affects the survival of microorganisms that are not beneficial for the ruminal flora, pathogens, among others.
CONCLUSIONS
The non-commercial probiotic can be an alternative to supplement the diet of growing sheep in the canyon region of Juchipila, Zacatecas, Mexico, by generating an increase in bacteria and protozoa. Probiotics are an additive that can be used successfully since it did not modify the population of total bacteria and anaerobic fungi in the rumen.
REFERENCES
Arcos-García JL, López-Pozos R, Bernabé-Hernández A, Hoffman JA. 2007. La actividad microbiana en la fermentación ruminal y el efecto de la adición de Saccharomyces cerevisiae. Ciencia y Tecnología. 11(32):51:62. https://www.utm.mx/edi_anteriores/pdf/nota3t32.pdf [ Links ]
Bach A, Calsamiglia S, Stern MD. 2005. Nitrogen metabolism in the rumen. Journal of dairy science. 88(1):e9-21. https://doi.org/10.3168/jds.S0022-0302(05)73133-7 [ Links ]
Bodas R, Prieto N, García-González R, Andrés S, Giráldez FJ, López S. 2012. Manipulation of rumen fermentation and methane production with plant secondary metabolites. Animal Feed Science and Technology. 176(1-4):78-93. https://doi.org/10.1016/j.anifeedsci.2012.07.010 [ Links ]
Cardona-Iglesias JL, Mahecha-Ledesma L, Angulo-Arizala J. 2017. Arbustivas forrajeras y ácidos grasos: estrategias para disminuir la producción de metano entérico en bovinos. Agronomía Mesoamericana, 28 (1), 273-288. https://www.scielo.sa.cr/scielo.php?script=sci_arttext&pid=S1659-13212017000100022 [ Links ]
Castañeda ARO, Álvarez MJA, Rojas MC, Lira AJJ, Ríos UÁ, Martínez IF. 2021. Nivel de infestación de Rhipicephalus microplus y su asociación con factores climatológicos y la ganancia de peso en bovinos Bos taurus x Bos indicus. Revista mexicana de ciencias pecuarias, 12(1), 273-285. https://doi.org/10.22319/rmcp.v12i1.5392 [ Links ]
Castillo-Lopez E, Wiese BI, Hendrick S, McKinnon JJ, McAllister TA, Beauchemin KA, Penner GB. 2014. Incidence, prevalence, severity, and risk factors for ruminal acidosis in feedlot steers during backgrounding, diet transition, and finishing. Journal of animal science. 92(7):3053-3063. https://doi.org/10.1111/j.1365-2672.2012.05295.x [ Links ]
Castillo-Lopez E, Domínguez-Ordóñez MG. 2019. Factores que afectan la composición microbiana ruminal y métodos para determinar el rendimiento de la proteína microbiana. Revisión. Revista mexicana de ciencias pecuarias. 10(1):120-148. http://dx.doi.org/10.22319/rmcp.v10i1.4547 [ Links ]
Castillo-Lopez E, Klopfenstein TJ, Fernando SC, Kononoff PJ. 2013. In vivo determination of rumen undegradable protein of dried distillers grains with solubles and evaluation of duodenal microbial crude protein flow. Journal of animal science. 91(2):924-934. https://doi.org/10.2527/jas.2012-5323 [ Links ]
Danielsson R, Dicksved J, Sun L, Gonda H, Müller B, Schnürer A, Bertilsson J. 2017. Methane production in dairy cows correlates with rumen methanogenic and bacterial community structure. Frontiers in microbiology. 8(1):226. https://doi.org/10.3389/fmicb.2017.00226 [ Links ]
2017. Methane production in dairy cows correlates with rumen methanogenic and bacterial community structure. Frontiers in microbiology. 8(1):226. https://doi.org/10.3389/fmicb.2017.00226 Daza C, Guillen J, Rey J, Ruiz V. 2014. Evaluación de un método de extracción y purificación de DNA a partir de tejido muscular fijado en formaldehido de cadáveres no identificados. Revista Med. 22(1): 42-49. http://www.scielo.org.co/pdf/med/v22n1/v22n1a06.pdf [ Links ]
Degirmencioglu T, Ozcan T, Ozbilgin S, Senturklu S. 2013. Effects of yeast culture addition (Saccharomyces cerevisiae) to Anatolian water buffalo diets on milk composition and somatic cell count. J. Dairy Prod. process. improv. 63:42-48. https://doi.org/10.15567/mljekarstvo [ Links ]
Denman SE, McSweeney CS. 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS microbiology ecology. 58(3):572-582. https://doi.org/10.1111/j.1574-6941.2006.00190.x [ Links ]
El-Sayed AA, Mousa SA. 2020. Effects of administration of probiotic on body growth and hematobiochemical profile in growing Barki lambs. Comparative Clinical Pathology. 29(1):297-303. https://doi.org/10.1007/s00580-019-03057-z [ Links ]
Firkins JL. 2021. Invited Review: Advances in rumen efficiency. Applied Animal Science, 37(4), 388-403. https://doi.org/10.15232/aas.2021-02163 [ Links ]
Fraga M, Perelmuter K, Valencia MJ, Martínez M, Abin-Carriquiry A, Cajarville C, Zunino P. 2014. Evaluation of native potential probiotic bacteria using in vitro ruminal fermentation system. Annsls microbiology. 64(3):1149-1156. https://annalsmicrobiology.biomedcentral.com/articles/10.1007/s13213-013-0753-3 [ Links ]
Galindo J, Elías A, Muñoz E, Marrero Y, González N, Sosa A. 2017. Activadores ruminales, aspectos generales y sus ventajas en la alimentación de animales rumiantes. Cuban Journal of Agricultural Science. 51(1):11-23. http://scielo.sld.cu/pdf/cjas/v51n1/cjas02117.pdf [ Links ]
Gharechahi J, Vahidi MF, Bahram M, Han JL, Ding XZ, Salekdeh GH. 2021. Metagenomic analysis reveals a dynamic microbiome with diversified adaptive functions to utilize high lignocellulosic forages in the cattle rumen. The ISME Journal, 15(4), 1108-1120. https://doi.org/10.1038/s41396-020-00837-2 [ Links ]
Green MR, Hughes H, Sambrook J, MacCallum P. 2012. Molecular cloning: a laboratory manual. In Molecular cloning: a laboratory manual. Pp. 1890-1890. ISBN 978-1-93611342-2. https://www.cshlpress.com/pdf/sample/2013/MC4/MC4FM.pdf [ Links ]
Hobson PN, Stewart CS. 2012. The rumen microbial ecosystem. Springer Science & Business Media. (Eds.). https://books.google.com.pr/books?id=B8quw8mhYCkC&printsec=frontcover&source=gbs_ge_summary_r&cad=0#v=onepage&q&f=false [ Links ]
Izuddin WI, Loh TC, Samsudin AA, Foo HL, Humam AM, Shazali N. 2019. Effects of postbiotic supplementation on growth performance, ruminal fermentation and microbial profile, blood metabolite and GHR, IGF-1 and MCT-1 gene expression in post-weaning lambs. BMC Vet. Res. 15, 315. https://doi.org/10.1186/s12917-019-2064-9 [ Links ]
Jouany JP. 1994. Methods of manipulating the microbial metabolism in the rumen. In Annales de zootechnie. 43(1):49-62. https://hal.archives-ouvertes.fr/hal00888958/document [ Links ]
Jun HS, Qi M, Ha JK, Forsberg CW. 2007. Fibrobacter succinogenes, a dominant fibrolytic ruminal bacterium: transition to the post genomic era. Asian-Australasian Journal of Animal Sciences. 20(5):802-810. https://doi.org/10.5713/ajas.2007.802 [ Links ]
Kobayashi Y. 2006. Inclusion of novel bacteria in rumen microbiology: need for basic and applied science. Animal Science Journal. 77(4):375-385. https://doi.org/10.1111/j.1740-0929.2006.00362.x [ Links ]
Khattab IM, Abdel-Wahed AM, Khattab AS, Anele UY, El-Keredy A, Zaher M. 2020. Effect of dietary probiotics supplementation on intake and production performance of ewes fed Atriplex hay-based diet. Livestock Science. 237(April):104065. https://doi.org/10.1016/j.livsci.2020.104065 [ Links ]
Kyan T, Shintani M, Kanda S, Sakurai M, Ohashi H, Fujisawa A, Pongdit S. 1999. Kyusei nature farming and the technology of effective microorganisms. Atami (Japan), Asian Pacific Natural Agricultural Network. https://www.bokashi.se/dokument/bibliotek/APNAN%2520Manual.pdf [ Links ]
López FR, Álvarez AA, León RDA, Taylor OVM, Guiral GD, Ríos CS, Loranz SE, Katherine PL, Vergara AS. 2020. La investigación con Streptomyces spp. como herramienta para el estudio de los microorganismos del suelo. Centro de investigaciones Facultad de Ciencias de la Salud. Primera edición, Volumen 1. Editorial Zapata- Manizales. ISBN: 978-958-8859-62-0. https://repository.unilibre.edu.co/handle/10901/18649 [ Links ]
Markowiak P, Śliżewska K. 2018. The role of probiotics, prebiotics and synbiotics in animal nutrition. Gut pathogens. 10(1):1-20. https://doi.org/10.1186/s13099-018-0250-0 [ Links ]
Martin SA. 1994. Nutrient transport by ruminal bacteria: a review. Journal of animal science. 72(11):3019-3031. https://doi.org/10.2527/1994.72113019x [ Links ]
Matthews C, Crispie F, Lewis E, Reid M, O'Toole PW, Cotter PD. 2018. The rumen microbiome: a crucial consideration when optimising milk and meat production and nitrogen utilisation efficiency. Gut microbes, 10(2), 115-132. https://doi.org/10.1080/19490976.2018.1505176 [ Links ]
Meller RA, Firkins JL, Gehman AM. 2014. Efficacy of live yeast in lactating dairy cattle. Prof. Anim. Sci. 30, 413-417. https://doi.org/10.15232/pas.2014-01308 [ Links ]
McAllister TA, Bae HD, Jones GA, Cheng KJ. 1994. Microbial attachment and feed digestion in the rumen. Journal of animal science. 72(11):3004-3018. https://doi.org/10.2527/1994.72113004x [ Links ]
Mirón J, 1991. La hidrólisis de los componentes monosacáridos de la pared celular de la alfalfa mediante monocultivos o combinaciones de pares de bacterias ruminales definidas. Revista de bacteriología aplicada. 70(3): 245-252. https://doi.org/10.1111/j.1365-2672.1991.tb02932.x [ Links ]
Moallem U, Lehrer H, Livshitz L, Zachut M, Yakoby S, 2009. The effects of live yeast supplementation to dairy cows during the hot season on production, feed efficiency, and digestibility. J. Dairy Sci. 92:343-351. https://doi.org/10.3168/jds.2007-0839 [ Links ]
Morrison M, Neslon KE, Cann I, Forsberg CW, Mackie RI, Russell JB, White BA, Wilson DB, Amaya K, Cheng B, Qi S, Jun HS, Mulligan S, Tran K, Carty H, Khouri H, Nelson W, Daugherty S, Tran K. 2003. The Fibrobacter succinogenes strain S85 sequencing project. 3rd ASM-TIGR, Microbial Genome Meeting. New Orleans. https://www.koreascience.or.kr/article/JAKO200710103409172.j [ Links ]
Mould DL, Thomas GJ. 1958. The enzymic degradation of starch by Holotrich protozoa from sheep rumen. Biochem. J. 69:327. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1196559/pdf/biochemj00831-0014.pdf [ Links ]
Petri RM, Forster RJ, Yang W, McKinnon JJ, McAllister TA. 2012. Characterization of rumen bacterial diversity and fermentation parameters in concentrate fed cattle with and without forage. Journal of Applied Microbiology. 112(6):1152-1162. https://doi.org/10.1111/j.1365-2672.2012.05295.x [ Links ]
Qiao GH, Shan AS, Ma N, Ma QQ, Sun ZW. 2010. Effect of supplemental Bacillus cultures on rumen fermentation and milk yield in Chinese Holstein cows. J. Anim. Physiol. Anim. Nutr. 94:429-436. https://doi.org/10.1111/j.1439-0396.2009.00926.x [ Links ]
Rodríguez I, Salazar M, Villalobos E. 2012. Lactobacillus spp. Del tracto intestinal de Gallus gallus con potencial probiótico. Revista Científica de la Facultad de Ciencias Biológicas. 32(2):62-72. https://xdoc.mx/documents/lactobacillus-spp-del-tractointestinal-de-gallus-gallus-con-potencial-5ebc63e4de0c8 [ Links ]
Rodríguez R, Sosa A, Rodríguez Y. 2007. La síntesis de proteína microbiana en el rumen y su importancia para los rumiantes. Revista Cubana de Ciencia Agrícola. 41(4):303-311. https://www.redalyc.org/pdf/1930/193017712001.pdf [ Links ]
Rodríguez R, Lores J, Gutiérrez D, Ramírez A, Gómez S, Elías A, Jay O. 2013. Inclusión del aditivo microbiano Vitafert en la fermentación ruminal in vitro de una dieta para cabras. Revista Cubana de Ciencia Agrícola. 47(2):171-178. https://www.redalyc.org/pdf/1930/193028751011.pdf [ Links ]
SAS Institute Inc. 2011. SAS 9.3. Cary, NC: SAS Institute Inc. https://support.sas.com/documentation/onlinedoc/base/procstat93m1.pdf [ Links ]
Shriver-Munsch CM, Ramsing EM, Males JR, Sanchez WK, Yoon I, Bobe G. 2011. Effect of various dosages of Saccharomyces cerevisiae fermentation product on reproductive function in multiparous dairy cows. In: Page 38 in Proc. 13th Annual Northwest Reproductive Sciences Symposium. Corvallis, OR. https://ir.library.oregonstate.edu/concern/graduate_thesis_or_dissertations/xg94hs88v [ Links ]
Suen G, Weimer PJ, Stevenson DM, Aylward FO, Boyum J, Deneke J, Drinkwater C, Ivanova NN, Mikhailova N, Chertkov O, Goodwin LA, Currie CR, Mead D, Brumm PJ. 2011. The complete genome sequence of Fibrobacter succinogenes S85 reveals a cellulolytic and metabolic specialist. Plos One. 6:e18814. https://doi.org/10.1371/journal.pone.0018814 [ Links ]
Uchida I, Takase S, Kayakiri H, Kiyoto S, Hashimoto M, Tada T, Koda S, Morimoto Y. 1987. Structure of FR 900482, a novel antitumor antibiotic from a Streptomyces. Journal of the American Chemical Society. 109(13):4108-4109. https://doi.org/10.1021/ja00247a043 [ Links ]
WIlliams AG, Coleman GS. 2012. The rumen protozoa. Springer Science & Business Media. Nueva York. https://link.springer.com/chapter/10.1007/978-94-009-1453-73 [ Links ]
Received: September 01, 2021; Accepted: March 02, 2022
Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons
