SciELO - Scientific Electronic Library Online

 
vol.6 número16Productividad de ovejas Pelibuey y Katahdin en el trópico húmedoConcentración de nitrato, fosfato, boro y cloruro en el agua del río Lerma índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • No hay artículos similaresSimilares en SciELO

Compartir


Ecosistemas y recursos agropecuarios

versión On-line ISSN 2007-901Xversión impresa ISSN 2007-9028

Ecosistemas y recur. agropecuarios vol.6 no.16 Villahermosa ene./abr. 2019  Epub 01-Oct-2019

http://dx.doi.org/10.19136/era.a6n16.1846 

Nota científica

Análisis de ADN fecal para identificar especies de felinos en los Ocotones Chiapas, México

Fecal DNA analysis to identify feline species in Los Ocotones, Chiapas, Mexico

Erik Joaquín Torres-Romero1  * 
http://orcid.org/0000-0002-1078-9223

Eduardo Espinoza-Medinilla2 
http://orcid.org/0000-0003-1313-5767

José Vicente López-Bao1 
http://orcid.org/0000-0001-9213-998X

Francisco Palomares3 

1Unidad de Investigación de Biodiversidad (UO/CSIC/PA), Universidad de Oviedo, 33600 Mieres, España.

2Universidad de Ciencias y Artes de Chiapas, Libramiento Norte Poniente s/n, CP. 29039, Tuxtla Gutiérrez, Chiapas, México.

3Estación Biológica de Doñana, CSIC. Departamento de Biología de la Conservación. Américo Vespucio s/n, CP. 41092, Isla de la Cartuja, Sevilla, España.

RESUMEN:

El conocimiento de las especies que se distribuyen en zonas con manejo forestal es fundamental para comprender los impactos negativos y positivos de esta actividad en la conservación de especies consideradas en protección por el gobierno mexicano a través de la NOM-059-SEMARNAT-2010, como es el caso del jaguar (Panthera onca). El objetivo fue identificar especies y sexo de felinos simpátricos presentes en el área de aprovechamiento forestal Los Ocotones (LOSOCO), ubicada a 36 km de Cintalapa, Chiapas. Se colectaron 33 muestras fecales y se analizaron para identificar perfiles genéticos individuales. Se identificaron dos pumas machos, un puma hembra, un jaguar macho, un ocelote/tigrillo hembra y un puma/leoncillo macho. El análisis genético aportó información relevante sobre el papel que juega la zona por albergar especies de felinos prioritarias para su conservación. Se requiere fortalecer las acciones de protección que ayuden a garantizar su permanencia en la región.

Palabras clave: Actividades humanas; corredor biológico; jaguar; leoncillo; ocelote; puma; tigrillo

ABSTRACT:

Knowledge of species that are distributed in areas with forest management is essential to understand the negative and positive impacts of this activity on the conservation of species considered for protection by the Mexican government through NOM-059-SEMARNAT-2010, such as the jaguar (Panthera onca). The objective was to identify the species and sex of sympatric felines present in the Los Ocotones forest use area (LOSOCO), located 36 km from Cintalapa, Chiapas. Thirty-three fecal samples were collected and analyzed to identify individual genetic profiles. Two male pumas, a female puma, a male jaguar, a female ocelot/tigrillo and a male puma/jaguarundi were identified. The genetic analysis provided relevant information on the role played by the area in hosting priority feline species for conservation purposes. It is necessary to strengthen protection actions that help ensure their permanence in the region.

Keywords: Human activities; biological corridor; jaguar; jaguarundi; ocelot; puma; tigrillo

Introducción

Las presiones antrópicas en el medio ambiente han aumentado en todo el mundo en las últimas décadas, considerándose como un de los principales motores de pérdida de la biodiversidad (Ceballos et al. 2015). Los carnívoros, en particular los grandes felinos, se han visto afectados por la destrucción paulatina de sus ecosistemas, además de que, la caza y comercio ilegal han provocado que varias especies esten en peligro de extinción y muchas otras desapareciendo (Ripple et al. 2014, 2016). Sin embargo, estas especies al tener un amplio atractivo carismático y un perfil de visibilidad icónico más alto que otras, suelen ser elementos desencadenantes de conservación de la biodiversidad (Walpole y Leader Williams 2002, Ripple et al. 2014). También, ejercen o facilitan interacciones mediante el mantenimiento de cascadas tróficas controlando especies presa, y promoviendo un equilibrio en el ecosistema al alimentarse en ocasiones de cadáveres de animales que pueden albergar y propagar enfermedades (Ripple et al. 2014), además de que tienen un importante significado cultural (Treves y Bruskotter 2014).

En México, un total de 20 especies de mamíferos carnívoros terrestres y marinos presentan problemas de conservación, y se encuentran en alguna categoría de protección especial en la NOM-059-SEMARNAT-2010 (SEMARNAT 2010). De manera particular, el estado de Chiapas aún mantiene hábitats adecuados para muchas especies de plantas y animales prioritarias para la conservación, registrándose cinco de las seis especies de felinos silvestres (jaguar, Panthera onca; leoncillo, Puma yagouaroundi; puma, Puma concolor; ocelote, Leopardus pardalis y tigrillo, Leopardus wiedii), que se distribuyen en México (Ceballos et al.2010, Espinoza-Medinilla et al. 2018). Pero los hábitats naturales que aún persisten están siendo afectados por la destrucción y fragmentación de actividades humanas, lo que ocasiona mosaicos de vegetación con diferente grado de perturbación (Dirzo et al. 2009). Por ejemplo, la extracción de madera tiene impacto sobre los ecosistemas, por el establecimiento de máquinas y vehículos, presencia constante de trabajadores, construcción y mantenimiento de caminos y ruido; los cuales afectan los servicios ambientales y la biodiversidad (Rendón et al. 2014). En este sentido, el aprovechamiento forestal podría afectar de manera directa a los felinos, ya que especies como el jaguar, leoncillo y tigrillo, suelen presentar menos tolerancia a las presiones humanas y tienden a desplazarse a otras áreas; y en última instancia desaparecer a nivel local o regional (Ceballos et al. 2010, De Angelo et al. 2011, Giordano 2016). Pero hay predios privados como Los Ocotones (LOSOCO) que promueven un manejo forestal sustentable por mantener vegetación nativa para proteger la cobertura arbórea alta, además de ser hábitat que permite la conexión con otros remanentes de vegetación de im portancia biológica y ecológica. El predio LOSOCO mantiene vegetación natural para refugio o sitios de reproducción y alimentación de especies de felinos. Además de favorecer la movilidad y dispersión de felinos para otros remanentes de vegetación y la recolonización de otras áreas (Espinoza-Medinilla et al. 2018).

Los felinos son especies cripticas, nocturnas y de difícil visualización (Torres-Romero et al. 2017), por lo que realizar estudios con técnicas convencionales como la manipulación directa para la marcación o radio-telemetría, son logísticamente difíciles y los costos suelen ser elevados (Ruell y Crooks 2007). En contraste, las técnicas indirectas, como el foto-trampeo y el rastreo permiten a los investi gadores conocer aspectos ecológicos y/o biológicos de las especies de manera no invasiva, pero en ocasiones la información resultante no permite diferenciar entre especies y sexo (Anderson et al. 2003, Ruell y Crooks 2007). Por lo anterior, el análisis genético de muestras fecales puede utilizarse como método no invasivo que permite determinar características importantes como la especie, sexo, tamaño poblacional, variabilidad genética, filogeografía y relaciones filogenéticas; que pueden ser difíciles de de terminar con otros métodos (Kurose et al. 2005, Naidu et al. 2012).

En este contexto, el conocimiento básico sobre los felinos silvestres en áreas con algún grado de perturbación humana es un paso fundamental para contribuir a diseñar estrategias de conservación de especies y de hábitats en ambientes fragmentados o modificados por actividades antrópicas. Por lo anterior el objetivo fue identificar especies y sexo de felinos simpátricos presentes en el área de aprovechamiento forestal Los Ocotones.

Materiales y métodos

Área de estudio

El predio LOSOCO (16o 38’ 59” LN y 93o 47’ 59” LO) ocupa 2 400 ha, se ubica a 36 km de Cintalapa, Chiapas, a 40 km al Sureste de la Reserva de la Biosfera La Sepultura y al Noreste de la Reserva El Ocote (Figura 1). El área es parte de un gran bloque de vegetación en buen estado de conservación conocido como Selva Zoque, abarca municipios de los estados de Veracruz, Oaxaca y Chiapas, además de incluir a la Sierra Atravesada en Oaxaca y la Sierra Madre de Chiapas (Lira-Torres et al. 2012). No obstante, la Selva Zoque tiene problemas de fragmentación y cambio de uso del suelo. Sin embargo, es un área que puede considerarse como corredor biológico conectado con otras selvas como la Reserva de la Biosfera el Ocote y la Sepultura en Chiapas, los Chimalapas en Oaxaca y la región del Uxpanapa en Veracruz, reconocidas por su importancia para la conservación de la biodiversidad regional (CONANP 2015). LOSOCO está certificada por Rainforest Alliance y Forest Stewardship Council por su manejo forestal sostenible. Cuenta con un jardín botánico y tres unidades de manejo para la conservación de vida silvestre (UMAs) de venado cola blanca, cycadas y orquídeas. El clima es cálido-húmedo con temperatura anual de 18 a 22 °C, mayo es el mes más cálido con 18 °C con precipitación anual de 1 000 a 1 800 mm (Arriaga et al. 2000). La altitud oscila entre 1 000 y 1 220 msnm (INEGI 2005). La vegetación de LOSOCO es diversa, pero predomina el bosque de pino-encino y el bosque tropical subcaducifolio (Rzedowski 1978); de ellos, el bosque de pino es el que más se aprovecha.

Figura 1: Ubicación de la unidad de manejo forestal Los Ocotones (LOSOCO), Chiapas,Selvas de importancia para la conservación y Áreas Naturales Protegidas, México. 

Recolección y conservación de muestras

La recolecta de las muestras fecales se realizó durante dos días en temporada seca en el mes de mayo del 2011. Los recorridos se realizaron a pie a lo largo de los principales caminos y veredas cubriendo toda el área de estudio (2 400 ha), iniciando la búsqueda de 06:00 a 18:00 h. De acuerdo con Aranda (2000) se recolectaron todas las excretas que estuvieran presentes durante el muestreo, considerando aquellas muestras que cumplieran los requisitos de color, olor, forma y tamaño, junto a huellas o restos de presas, presencia de pelos o fragmentos de huesos. Las muestras recolectadas se georreferenciaron con GPS, las muestras frescas se almacenaron con etanol al 96% de 24 a 48 h y después se transfirieron a gel de sílice para su almacenamiento. Mientras que las muestras secas se almacenaron en envases esterilizados y herméticos de plástico de 100 ml con gel de sílice, permaneciendo de esta forma hasta su análisis genético.

Extracción de ADN para la identificación de especies y sexado

La identificación de especies por medio de excretas se realizó mediante marcadores moleculares específicos para felinos desarrolla dos por Roques et al. (2011). La extracción de ADN de heces se realizó de acuerdo con el protocolo basado en el método GuSCN/sílice (Hoss y Paabo 1993, Frantz et al. 2003). Para controlar la contaminación, durante la extracción del ADN y PCR, el procedimiento se realizó en un laboratorio diseñado para manipular material no invasivo. Para la identificación, se utilizaron los siguientes oligonucleótidos (primers): ND5-FEL-274R, ND5-FEL-130F, ND5-Po-149F, ND5-Hy-58F, ND5-Pc/Hy-183F, y ND5- Fp/Fw-167F, específicos para felinos neotropicales (Tabla 1). La identificación sexual se realizó con el método descrito por Pilgrim et al. (2005) y optimizado para su uso en muestras fecales de felinos (Puma concolor, Leopardus pardalis, Leopardus wiedii) por Roques et al. (2011) y (2014).

Tabla 1: Oligonucleótidos (primers) usados en este estudio. 

Primers Secuencia CN (in µM) PCR product
ND5-FEL-274R YGTAGCACTTTKYGTCACATGA 0.25
ND5-FEL-130F CCTTYACYATCAGCATAAT 0.30 166 BPS
ND5-Po-149F TCCGGCTATAGTATTTATTTCTTCC 0.25 147 BPS
ND5-Py-58F TCATTATAACCGGCACCCAACTG 0.25 238 BPS
ND5-Pc/Py-183F GCAGTCATCTCAAACTGACACTG 0.25 113 BPS
ND5-Lp/Lw-167F TYTCCCAGGACAAGAAGCAGTA 0.20 129 BPS

FEL, las cinco especies objetivo; Po, Panthera onca; Py, Puma yagouaroundi; Pc, Puma Concolor; Lp, Leopardus pardalis; Lw, Leopardus wiedii. CN, concentración del primer final en PCR.

Resultados y discusión

Se recolectaron y analizaron 33 muestras fecales en el área de estudio. Del total de muestras fecales, 22 (66.66%) fueron de P concolor, 2 (6.09%) de P onca, 3 (9.09%) de L pardalis/L. wiedii, 3 (9.09) de P. concolor/P. yaguaroundi y 3 (9.09%) no amplificaron. Para la identificación a nivel de sexo, se identificaron dos individuos machos y una hembra de P concolor, un macho P. onca, un L. pardalis/L. wiedii hembra y un P concolor/P. yaguaroundi macho (Tabla 2). Las muestras en las que no se pudo determinar la especie y sexo fue por la baja calidad y cantidad de ADN. No obstante, la tasa de éxito para la identificación a nivel de especie fue del 72.72%, mientras que el sexo fue al 78.78%.

Tabla 2: Resultados de la amplificación genética en muestras fecales recolectadas en el campo.  

Identificación muestra fecal Identificación de especie Sexo ID-individuo
8F190511 Jaguar MNI MNI
06C190511 Jaguar Macho J-M-1
1F190511 Ocelote/Tigrillo MNI MNI
01C190511 Ocelote/Tigrillo Hembra
04C190511 Ocelote/Tigrillo Hembra
10F190511 Puma Macho P-M-1
1F180511 Puma Macho
2F180511 Puma Macho P-M-1
2F190511 Puma Macho MNI
3F180511 Puma Macho P-M-1
3F190511 Puma Macho P-M-1
4F190511 Puma Macho P-M-2
5F190511 Puma Macho P-M-1
6F190511 Puma Macho P-M-1
7F190511 Puma MNI MNI
9F190511 Puma Macho P-M-1
01C180511 Puma Macho P-M-1
02C180511 Puma Hembra
02C190511 Puma Hembra P-H-1
03C180511 Puma Hembra P-H-1
03C190511 Puma Macho P-M-1
04C180511 Puma/Leoncillo Macho
05C180511 Puma Hembra P-H-1
05C180511-B Puma Hembra P-H-1
05C190511 Puma Macho P-M-1
06C180511 Puma Hembra P-H-1
07C190511 Puma Macho P-M-1
08C180511 Puma/Leoncillo Macho
08C190511 Puma Macho P-M-1
10C180511 Puma/Leoncillo MNI MNI
4F180511 MNI MNI MNI
07C180511 MNI MNI MNI
09C180511 MNI MNI MNI

MNI: muestra no identificada, P-H (puma hembra), P-M (puma macho), J-M (jaguar macho).

Los felinos son considerados especies indicadoras del estado de la biodiversidad y de conservación de los ecosistemas naturales (Ordiz et al. 2013, Ripple et al. 2014). Además, especies icónicas como el jaguar han sido utilizadas como especie clave en iniciativas de conservación (Manterola et al. 2011), y para el diseño de corredores biológicos (Salom-Pérez et al. 2010, Hidalgo-Mihart et al. 2018). Bajo este contexto, y por las características de hábitat que presenta la zona de manejo forestal LOSOCO se identificaron especies de felinos relevantes, de las que el jaguar, el leoncillo, el ocelote y el tigrillo tienen estatus de especies en peligro de extinción y amenazadas; mientras que el puma, es una especie que requiere de protección especial en la NOM-059 (SEMARNAT 2010). Pese a las modificaciones causadas por el hombre por la extracción de madera dentro de los LOSOCO, la unidad de manejo mantiene su hábitat natural para albergar especies prioritarias para su conservación.

El hábitat que presenta LOSOCO, adquiere relevancia por albergar a especies prioritarias y por jugar un papel importante como corredor de dispersión para especies con requerimientos espaciales mayores como el jaguar y el puma. Al respecto, se ha reportado que el puma y el jaguar presentan promedios en sus ámbitos hogareños que oscilan entre 328.8 ± 54.9 km2 (pumas machos) y 151.1 ± 26.4 km2 (pumas hembras), mientras que para el jaguar oscilan entre 203.3 ± 132.8 km2 (jaguares machos) y 149 ± 97.1 km2 (jaguares hembras) (González-Borrajo et al. 2017); por lo que su amplio rango de movimiento entre especies machos y hembras permite tener una gran movilidad entre parches conectados para mantener o aumentar las tasas de movimiento hacia otros remanentes de vegetación (Salom-Pérez et al. 2010). Además ofrece beneficios a otras especies con requerimientos espaciales menores como el ocelote, leoncillo y tigrillo (Ceballos et al. 2010, Ripple et al. 2014). Por lo que, los corredores deben ser estrategias indispensables para mantener las poblaciones genética mente sanas mediante el intercambio de individuos (Frankham 2006). En consecuencia y teniendo en cuenta el ámbito hogareño promedio entre el puma y el jaguar que oscila entre 281.87 ± 35.76 km2 y 128.61 ± 49.5 km2, respectivamente (González-Borrajo et al.2017), se infiere de que el predio LOSOCO cuenta con vegetación natural para refugio, sitio de reproducción y de alimentación para especies de felinos, además de contar con características para ser sitio de movilidad y de dispersión hacia otras áreas con importantes remanentes de vegetación, como la Reserva de la Biosfera el Ocote y Sepultura en Chiapas, los Chimalapas en Oaxaca, y Uxpanapa en Veracruz. La importancia de LOSOCO como lugar de presencia permanente de especies como el jaguar y puma, y área de reproducción, debe ser evaluada. Por lo que es imprescindible continuar con estudios en la zona de estudio y las regiones adyacentes para identificar el papel de Los Ocotones en la conectividad de las especies a nivel regional.

Agradecimientos

A M. Hidalgo-Mihart, a los dos revisores anónimos por sus comentarios constructivos al manuscrito. Al apoyo del Señor Ariel Gómez Jiménez propietario de Los Ocotones por las facilidades otorgadas para el desarrollo de la investigación.

Literatura citada

Anderson DR, Cooch EG, Gutierrez RJ, Krebs CJ, Lindberg MA, Pollock KH, et al. (2003) Rigorous science: suggestions on how to raise the bar. Wildlife Society Bulletin 31: 296-305. [ Links ]

Aranda M (2000) Huellas y otros rastros de los mamíferos grandes y medianos de México. Instituto de Ecología, Conabio. México. 212p. [ Links ]

Arriaga L, Espinoza JM, Aguilar C, Martínez E, Gómez L, Loa E (2000) Regiones terrestres prioritarias de México. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad. México. 605p. [ Links ]

Ceballos G, List R, Medellín R, Bonacic C, Pacheco J (2010) Los felinos de América. Cazadores sorprendentes. México. 303p. [ Links ]

Ceballos G, Ehrlich PR, Barnosky AD, Garcia A, Pringle RM, Palmer TM (2015) Accelerated modern human-induced species losses: entering the sixth mass extinction. Science Advances 1, 5, e1400253. Doi: 10.1126/sciadv.1400253 [ Links ]

CONANP (2015) Resolución sobre las cifras oficiales correspondientes a las superficies de las Áreas Naturales Protegidas de competencia Federal en México. México. 18p. http://www.conanp.gob.mx/. Fecha de consulta: 3 de abril de 2018. [ Links ]

De Angelo C, Paviolo A, Di Bitetti M (2011) Differential impact of landscape transformation on pumas (Puma concolor) and jaguars (Panthera onca) in the upper Paraná Atlantic Forest. Diversity and Distributions 17: 422-436. [ Links ]

Dirzo R, Aguirre A, López JC (2009) Diversidad florística de las selvas húmedas en paisajes antropizados. Investigación Ambiental 1: 17-22. [ Links ]

Espinoza-Medinilla E, Torres-Romero EJ, Tarango-Arámbula LA (2018) Additional records of wild mammals in the forest management area: Los Ocotones, Chiapas, Mexico. Agrociencia 52: 553-562 [ Links ]

Frantz AC, Pope LC, Carpenter PJ, Roper TJ, Wilson GJ, Delahay RJ, et al. (2003) Reliable microsatellite genotyping of the Eurasian badger (Meles meles) using faecal DNA. Molecular Ecology 12: 1649-1661. [ Links ]

Frankham R (2006) Genetics and landscape connectivity. In: Crooks KR, Sanjayan M (comps.). Connectivity conservation. Cambridge University Press. Cambridge, England. pp. 72-96. [ Links ]

Giordano AJ (2016) Ecology and status of the Jaguarundi Puma yagouaroundi: a synthesis of existing knowledge. Mammal Review 46: 30-43 [ Links ]

González-Borrajo N, López-Bao JV, Palomares F (2017) Spatial ecology of jaguars, pumas, and ocelots: a review of the state of knowledge. Mammal Review 47: 62-75. [ Links ]

Hidalgo-Mihart M, Contreras-Moreno F, Jesús de la Cruz A, Juárez-López R (2018) Validation of the Calakmul-Laguna de Terminos corridor for jaguars Panthera onca in south-eastern Mexico. Oryx 52: 292-299 [ Links ]

Hoss M, Paabo S (1993) DNA extraction from pleistocene bones by a silica-based purification method. Nucleic Acids Research 21: 3913-3914. [ Links ]

INEGI (2005) Prontuario de información geográfica municipal de los Estados Unidos Mexicanos. Cintalapa, México. Instituto Nacional de Estadística, Geografía e Informática. Mexico. 9p. [ Links ]

Kurose N, Masuda R, Tatara M (2005) Fecal DNA analysis for identifying species and sex of sympatric carnivores: a noninvasive method for conservation on the Tsushima islands, Japan. Journal of Heredity 96: 688-697. [ Links ]

Lira-Torres I, Galindo C, Briones-Salas M (2012) Mamíferos de la Selva Zoque: riqueza, uso y conservación. Revista de Biología Tropical 60: 781-797 [ Links ]

Manterola C, Conde DA, Colchero F, Rivera A, Huerta E, Soler A, et al. (2011) El Jaguar como elemento estratégico para la conservación. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad. Corre dor Biológico Mesoamericano México. Serie Acciones/Número 8 México. 126p [ Links ]

Naidu A, Fitak RR, Munguia-Vega A, Culver M (2012) Novel primers for complete mitochondrial cytochrome b gene sequencing in mammals. Molecular Ecology Resources 12: 191-196. [ Links ]

Ordiz A, Bischof R, Swenson JE (2013) Saving large carnivores, but losing the apex predator? Biological Conservation 168: 128-133 [ Links ]

Pilgrim KL, McKelvey KS, Riddle AE, Schwartz MK (2005) Felid sex identification based on noninvasive genetic samples. Molecular Ecology Notes 5: 60-61. [ Links ]

Rendón H, Martínez A, Pérez DR (2014) Los bosques, sus bienes y servicios: los retos del manejo forestal sustentable. Ciencias 111-112: 29:35 [ Links ]

Ripple WJ, Estes JA, Beschta RL, Wilmers CC, Ritchie EG, Hebblewhite M, et al. (2014) Status and ecological effects of the world’s largest carnivores. Science 343: 151-163. [ Links ]

Ripple WJ, Chapron G, López-Bao JV, Durant SM, Macdonald DW, Lindsey PA, Corlett RT (2016) Saving the world’s terrestrial megafauna. BioScience 66: 807-812. [ Links ]

Roques S, Adrados B, Chavez C, Keller C, Magnusson WE, Palomares F, et al. (2011) Identification of Neotropical felid faeces using RCP-PCR. Molecular Ecology Resources 11: 171-175. [ Links ]

Roques S, Furtado M, Jácomo ATA, Silveira L, Sollmann R, Torres NM, et al. (2014) Monitoring jaguar populations Panthera onca with non-invasive genetics: a pilot study in Brazilian ecosystems. Oryx 48: 361-369. [ Links ]

Ruell WW, Crooks KR (2007) Evaluation of non-invasive genetic sampling methods for felid and canid populations. Journal of Wildlife Management 71: 1690-1694. [ Links ]

Rzedowski J (1978) La vegetación de México. Edit. Limusa. México. 432p. [ Links ]

Salom-Pérez R, Polisar J, Quigley H, Zeller K (2010) Iniciativa del corredor del jaguar: Un corredor biológico y un Compromiso a largo plazo para la conservación. Revista Mesoamericana 14: 25-34. [ Links ]

SEMARNAT (2010) Norma Oficial Mexicana NOM-059- SEMARNAT-2010, Protección ambiental - Especies nativas de México de flora y fauna silvestres - Categorías de riesgo y especificaciones para su inclusión, exclusión o cambio - Lista de especies en riesgo. Diario Oficial de la Federación. 30 de diciembre de 2010, Segunda Sección. Ciudad de México. [ Links ]

Treves A, Bruskotter JT (2014) Tolerance for predatory wildlife. Science 344: 476-477. [ Links ]

Torres-Romero EJ, Espinoza-Medinilla E, Lazcano-Barrero MA, Maffei L (2017) Ecology and conservation of ocelot (Leopardus pardalis) in Northern Quintana Roo, Mexico. Therya 8: 11-18. [ Links ]

Walpole MJ, Leader-Williams N (2002) Tourism and flagship species in conservation. Biodiversity Conservation 11: 543-547 [ Links ]

Recibido: 24 de Mayo de 2018; Aprobado: 01 de Octubre de 2018

*Autor de correspondencia: ejtr23@hotmail.com

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons