Services on Demand
Journal
Article
text in 
English (pdf)
Article in xml format
Article references
Automatic translation
Send this article by e-mailIndicators
-
Cited by SciELO -
Access statistics
Related links
-
Similars in
SciELO
Share
Permalink
Revista mexicana de ciencias pecuarias
On-line version ISSN 2448-6698Print version ISSN 2007-1124
Rev. mex. de cienc. pecuarias vol.11 n.3 Mérida Jul./Sep. 2020 Epub Feb 05, 2021
https://doi.org/10.22319/rmcp.v11i3.5516
Articles
Lymph nodes and ground beef as public health importance reservoirs of Salmonella spp.
a Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Centro de Enseñanza Práctica, Investigación en Producción y Salud Animal, Avenida Universidad 3000, Ciudad Universitaria, Ciudad de México, México.
b UNAM, FMVZ. Departamento de Medicina Preventiva y Salud Pública. Ciudad de México. México.
c Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria. Departamento de Secuenciación y Bioinformática del Centro Nacional de Referencia de Plaguicidas y Contaminantes. Ciudad de México, México.
d UNAM, FMVZ. Departamento de Patología. Ciudad de México. México.
This study aimed to determine the frequency of contamination, serovar diversity,
and multilocus sequence typing (MLST) of Salmonella enterica
(SE) in lymph nodes and ground beef. A total of 1,545 samples from 400 beef
carcasses were analyzed. Samples included peripheral (PLN) and deep lymph nodes
(DLN), lean and fatty ground beef obtained in warm (April-July) and cold
(September-December) seasons during 2017 and 2018. The pure isolates were
subjected to complete genome sequencing. With these data, the in
silico prediction of serovars and the MLST profile was performed.
In total, 78 SE isolates were obtained (5 % of the total analyzed samples). The
frequency of contamination was associated with the type of sample (
Key words Salmonella; Cattle; Lymph nodes; Ground beef; Serovars; MLST
El objetivo fue estimar la frecuencia de contaminación, diversidad de serotipos y
tipificación por multilocus (MLST) de Salmonella enterica (SE)
en linfonodos y carne molida de bovino. Para ello, se analizaron 1,545 muestras
provenientes de 400 canales bovinas. El muestreo incluyó linfonodos
superficiales (LNS) y profundos, carne molida magra y con grasa, obtenidas en
estación cálida (abril-julio) y fría (septiembre-diciembre) durante 2017 y 2018.
Los aislamientos puros se sometieron a secuenciación completa del genoma. Con
estos datos, se realizó la predicción in silico de serotipos y
del perfil de MLST. En total, se obtuvieron 78 aislamientos de SE (5 % del total
de muestras analizadas). La frecuencia de contaminación se asoció con el tipo de
muestra (
Palabras clave Salmonella; Bovinos; Linfonodos; Carne molida; Serotipos; MLST
Introduction
Foodborne salmonellosis is a public health concern worldwide1. The meat of different species, including beef, functions as a reservoir for its primary etiologic agent: Salmonella enterica subsp. enterica, from now on referred to as Salmonella2. In North America, ground beef has been linked to recent salmonellosis outbreaks3, which is why it is considered one of the main vehicles of human exposure to Salmonella. In Mexico, percentages of positive samples range between 16 and 68 % in ground beef at points of sale4,5, which is why research in this area is relevant from a public health perspective.
Recent experimental data report Salmonella isolates from apparently healthy cattle lymph nodes, in frequencies that range from <10 to >90%6,7. Furthermore, it has been proven that peripheral lymph nodes show a higher contamination rate as compared to deep lymph nodes, while the number of animals with contaminated lymph nodes is much higher in commercial feedlot cattle than in culled cattle7,8. However, results tend to vary significantly across geographical areas and season of the year, a phenomenon determined by unknown mechanisms.
In studies with Salmonella strains obtained from culled cattle, the typification of isolates by pulsed field gel electrophoresis showed clonality between lymph node and ground beef strains9. However, this type of study has not been performed in commercial feedlot animals.
Despite the high rates of positivity to Salmonella reported in bovine samples in Mexico4-6, the contribution of lymph nodes to this phenomenon has not been addressed. Therefore, this study aimed to estimate the frequency of contamination and the diversity of Salmonella serovars in lymph nodes and the meat and fat associated with them at different seasons of the year.
Material and methods
Study design and sample size determination
The sample size was calculated with the statistical equation used to estimate a population proportion when the number of elements in that population is unknown10:
Where: n= sample size; Zα 2= Z value in a normal distribution Zα= 1.96 when α= 0.05; p= population proportion with the studied characteristic (if unknown, 0.5 is used, as in this case); q= population proportion without the studied characteristic (1-p); d= desired error or precision, fixed at 10% (0.1).
Thus, it was obtained a sample size of 96, which was rounded to 100. The sampling was performed twice a year for two consecutive years, and in two seasons of each year. The samples collected between April and July were labeled as “warm” season samples, and those collected between September and December were labeled as “cold” season samples.
Carcasses came from young bulls, crosses of Bos Indicus, with an average age of 24-36 months, processed in a Federal Inspection type slaughterhouse in Veracruz, and transported under refrigeration (<4 ºC) for approximately eight hours, until they arrived at a selling point in Mexico City. Upon arrival, carcasses were kept under refrigeration for two days until sample collection (72 to 96 h postmortem). The sale point was visited each week on Monday and Tuesday until completing between five and ten carcasses per week, depending on the number of carcasses available.
Sampling
Peripheral (PLN, superficial cervical and subiliac) and deep lymph nodes (DLN, axillary and celiac) were collected from each carcass. Lymph nodes were selected based on the probability that they were included in the grinding process, due to their anatomical location. In addition to the lymph nodes, approximately 200 g of lean meat (LM, 50 % of the chuck roll and 50 % of the sirloin, as they are the most used cuts to produce ground beef) and fatty meat (FM) were collected from the surrounding areas of the PLN and DLN (approximately 50 % of each). Before analysis, the individual portions of each sample type were combined to form a single sample. On some occasions, certain parts of the carcass were compromised for sale and were not available for sampling. Therefore, it was not possible to obtain all sample types of 100% of the carcasses. Thus, the sampling unit was defined as the sample composites of PLN, DLN, LM, and FM. A total of 1,545 samples were collected from all sources in the two years of the study.
Table 1 Distribution of the 1,545 meat and lymph node samples analyzed by season and year between April 3, 2017 and December 14, 2018
| Sample type | Warm season | Cold season | |||||
|---|---|---|---|---|---|---|---|
| 2017 | 2018 | Total | 2017 | 2018 | Total | ||
| PLN | 168 | 98 | 266 | 33 | 102 | 135 | |
| DLN | 166 | 98 | 264 | 33 | 102 | 135 | |
| LM | 130 | 98 | 228 | 33 | 102 | 135 | |
| FM | 149 | 98 | 247 | 33 | 102 | 135 | |
| Total | 1,005 | 540 | |||||
Warm season: April-July, cold season: September-December.
PLN= peripheral lymph nodes, DLN= deep lymph nodes, LM= lean meat, FM= fatty meat.
The individual portions of each sample type were placed in previously identified sterile plastic bags and kept in coolers with cooling gels (at approximately 4°C) during their transportation to the laboratory (maximum two hours).
Microbiological analysis
Lymph node samples were prepared following the methods previously described11, with some modifications. Lymph nodes were weighed and subsequently submerged in boiling water for 5 s to sterilize their surface. Then, half of the buffered peptone water (BPW) necessary to reach an approximate 1:10 dilution (8 g of DLN in 80 ml of BPW and 25 g of PLN in 225 ml of BPW) was added, and lymph nodes were ground for 3 s in a previously sterilized Oster blender. The ground samples were emptied in a previously identified Stomacher® bag, and, using the rest of the BPW, the remainder contained in the blender was recuperated, assuring the transfer of the whole sample to the Stomacher® bag, subsequently homogenizing the mixture for 1 min.
For the analysis of the lean meat (LM) samples, 25 g were ground in a sterile Oster blender for 30 s. Subsequently, the content was placed in a previously identified Stomacher® bag with 225 ml of BPW, and the mixture was homogenized for 1 min. Finally, fatty meat (FM) samples were ground in a sterile Oster blender for 30 s, approximately 1/3 of fat and 2/3 of meat from the surrounding areas of PLN and DLN (50 % from each type of lymph node). After grinding, 25 g were aseptically weighed and subjected to the same procedure described for lean meat.
Homogenates were left to rest for two hours at room temperature, before following the pre-enrichment, selective enrichment, isolation, and biochemical confirmation procedures for Salmonella spp., established in the current Official Mexican Standard12. According to previously described methods, presumptive positive Salmonella spp. isolates were also molecularly confirmed by PCR using the invA gene (284 bp)13. DNA was extracted with the Ez-10 Spin Column Bacterial Genomic DNA Miniprep Kit (BioBasic, Inc., Canada), following the instructions of the supplier, from pure strains, previously refreshed in tryptic soy broth (MCD Lab®, PRONADISA-CONDA®, Spain) for 18-24 h. Forward (CGCCATGGTATGGATTTGTC) and reverse (GTGGTAAAGCTCATCAAGCG) primers were used in PCR with a total volume of 10 μl, employing the MyTaqTM Mix reagents (Bioline, U. K.) with the following final concentrations: 5 μl of MyTaqTM Mix, 0.2 μl of each dNTP, and 2.1 μl of nuclease-free water. The thermocycling conditions were: 94 ºC/3 min of initial denaturation; 35 denaturation, annealing, and extension cycles (95 ºC/45 s, 62 ºC/30 s, 72ºC/45 s, respectively), and a final extension at 72 ºC/2 min. The PCR amplified products were subjected to a 2% agarose gel electrophoresis (SeaKem® LE Agarose, Lonza, USA). Gels were run in a Tris/borate/EDTA buffer (TBE 1x) at 80 V for 50 min using SYBR Safe DNA Gel Stain (Invitrogen, USA) to reveal the DNA fragments. The visualization and digitization of images were performed in a Gel Logic 2200 imaging system (Kodak, USA) with the Care Stream® software (Carestream Health, Inc., USA). In each run, it was included a strain, from the laboratory, of S. enterica subsp. enterica ser. Typhimurium, previously confirmed by biochemical methods, PCR, and whole-genome sequencing. Confirmed isolates were preserved in two ways. In the first one, 1 ml inocula were prepared by taking fresh colonies and mixing them in brain-heart infusion broth (Merck, Germany) with 10% glycerol and kept at -70 °C in an ultra-low freezer. Moreover, a backup of the isolates was kept in tryptic soy agar (TSA, PRONADISA-CONDA®, Spain) at room temperature.
Serovar prediction and multilocus sequence typing (MLST)
The serovar of the obtained strains was predicted from the whole genome sequencing data (raw reads). Genomic DNA was extracted from fresh colonies in TSA broth with agitation at 37 °C for approximately 18 h. Then, it was centrifuged 1 ml of TSA broth at 5,000 xg for 10 min to obtain a cell pellet. Subsequently, following the instructions provided by the manufacturer, it was used the High Pure PCR Template Preparation Kit (Roche Molecular Systems, Inc., Switzerland) to obtain the genomic DNA.
Sequencing was performed in an Illumina NextSeq (Illumina, USA) equipment, using the Nextera XT version 3 kit (Illumina, USA) to prepare the DNA library, with an insert of 150 bp and a minimum estimated depth of 30X. The obtained raw reads were used to predict the serovar through in silico analysis, with the help of the SeqSero program14. Finally, a multilocus sequence typing (MLST) analysis was performed, based on seven house-keeping genes (aroC, dnaN, hemD, hisD, purE, sucA)15, in the server of the Center for Genomic Epidemiology16. As MLST has been used for decades and there is a public access database17, it is possible to estimate the epidemiological importance of the isolates through comparison with the ST previously reported in human and animal clinical samples. Furthermore, the allele profile was used to create a minimum spanning phylogenetic tree, using the GrapeTree18 program, to analyze the ST diversity in the sample under study.
Statistical analysis
To determine if there was an association between the type of sample, the season of year, and the Salmonella serovar with the frequency of contamination, it was employed a chi-square test. If a significant association was observed, the odds ratio was used to estimate the factors with the greatest influence on the contamination rate of the different studied matrices. Data were analyzed using the Statgraphics Centurion XV program (StatPoint, Technologies, USA).
Results
Overall, it was observed a 5% Salmonella spp. contamination
frequency, with 78 isolates obtained from the 1,545 samples analyzed in the two
years (Figure 1). A strong association
between the sample type and the pathogen positivity was observed (
Figure 1 Frequency of contamination with Salmonella spp. in bovine samples of lean meat (LM, n=363), fatty meat (FM, n=382), deep lymph nodes (DLN, n=399), and peripheral lymph nodes (PLN, n=401), collected between April 2017 and December 2018
There was also a significant association between the frequency of contamination
and the season of year (
Figure 2 Frequency of contamination with Salmonella spp. in bovine samples of lean meat (LM, n=363), fatty meat (FM, n=382), deep lymph nodes (DLN, n=399), and peripheral lymph nodes (PLN, n=401), collected between April 2017 and December 2018
The serovar was also associated with the sample type (
Figure 3 Number of S. enterica subsp. enterica isolates by serovar and source in the warm (a) and cold (b) season. LM: lean meat (n=363), FM: fatty meat (n=382), DLN: deep lymph nodes (n=399), PLN: peripheral lymph nodes (n=401)
The MLST showed that the isolates of each serovar corresponded to the same ST (Figure 4). The exception was Salmonella typhimurium, which had two ST (19 and 34). However, both ST only differed in the dnaN allele. Therefore, they satisfy the criteria to be considered a clonal complex, as they coincide in six of the seven alleles included in the MLST scheme15).
Figure 4 Minimum spanning phylogenetic tree obtained from the MLST profile of 78 isolates of S. enterica subsp. enterica.
Each circle corresponds to a ST, and the divisions inside correspond to an isolate. The numbers in the tree branches indicate the number of alleles with different sequences between ST. Serovars are color-coded, and the source of isolation is indicated inside or adjacent to each circle (in red text, if they come from the warm season; or in blue, if they come from the cold season).
Discussion
The frequencies of positivity to the pathogen observed here (2.5 to 9.7 %) are lower than those reported in other studies with ground beef (16-68%)4,5 and lymph nodes (50-94 %)6,19,20. However, the variability of this phenomenon between geographical areas and season of the year is well documented20,21. Overall, the study confirms the importance of apparently healthy cattle as a reservoir of various Salmonella serovars of epidemiological importance. This is demonstrated by the detection of ST 19 and 34 of the Typhimurium serovar, which are associated with human clinical cases and with the globally distributed DT104 strain22. Similarly, isolates of the Kentucky serovar (ST 198) have been associated with human and animal infections in the United States23. These findings highlight the need to continue investigating Salmonella populations of non-clinical origin, associated with animal production, due to their role as a reservoir of human infections.
The results also support previous observations on the higher positivity rates to the pathogen in peripheral lymph nodes, especially in warm climate conditions7,8. Although the environmental factors responsible for this variability have not been deciphered, the higher incidence of flies and other insect bites during the summer has been suggested as a conditioning factor of this seasonal variation19,24. However, the scant experimental evidence related to this factor does not come from natural contexts but from challenge studies with flies artificially infected with Salmonella.
The efforts made so far to prevent asymptomatic Salmonella infection in cattle have been unsuccessful. The use of vaccines based on genes involved in the uptake of iron, a mineral with a central role in the infectious process, had no effect on the frequency of contamination in the lymph nodes of fattening cattle25. This is not an unexpected finding, considering the functional redundancy of Salmonella, which has multiple genes for the uptake and transport of iron (iroBCDE, fepBCDEG, fhuBCD, exbBD, sitD, and tonB)26.
Moreover, the intracellular survival of the bacterium, internalized in eukaryotic cells vacuoles27, such as macrophages, suggests that antibiotics are an unlikely strategy. Thus, the administration of increasing concentrations of tylosin in the diet of Holstein cattle, previously inoculated with the pathogen, did not show any effect, as Salmonella was still recovered from the lymph nodes of treated animals28.
Apparently, the functional redundancy of Salmonella and its intracellular survival mechanisms indicate that the eventual pathogen elimination will ultimately depend on the immune system of the host. In animals experimentally inoculated with strains of the Montevideo serovar, the total elimination of the bacteria took about a month29. In this context, the screening of Salmonella subclinical infections in feedlots, a poorly applied measure, could function as a method to segregate carrier animals and limit the spread of the pathogen. Additionally, the presence of strains of the same serovar and ST in ground beef and lymph nodes, observed in this study, suggests removal of lymph nodes could be a good strategy to drastically reduce the frequency of contamination with Salmonella in ground beef. This measure is relatively easy to perform at slaughterhouses, although only for peripheral lymph nodes, not for the deep lymph nodes. However, it is precisely the peripheral lymph nodes that are of the greatest epidemiological relevance. Therefore, establishing this measure as mandatory in national regulations could function as a strategy to mitigate the risks associated with the presence of Salmonella in ground beef.
Moreover, it is interesting to analyze why some serovars were only present in meat samples (e.g., Typhimurium), while others were detected in all matrices (e.g., Anatum and Reading). Notably, the Anatum serovar was previously reported as a predominant strain in non-clinical samples, especially in lymph nodes19,20. These evidences suggest the possibility that some Salmonella strains are better adapted to colonize and survive in particular ecological niches. However, in the context of the present study, it is difficult to determine whether the relative representation of serovars in lymph nodes depends on specific genetic factors. It is also necessary to use analyses with greater discriminatory power than MLST to explore more precisely the intra- and interserovar phylogenetic relationships, and the evolutionary dynamics of these populations. This will be the focus of future contributions in the comparative genomics field.
Conclusions and implications
The study shows that the lymph nodes and ground beef from animals approved for slaughter are reservoirs of Salmonella enterica strains of clinical importance in humans. Therefore, it is necessary to establish control measures to prevent the spread of this pathogen throughout the production chain.
Acknowledgments and conflicts of interest
This research was financed by the Universidad Nacional Autónoma de México, through the PAPIIT IN212817 project. We appreciate the collaboration of the Centro Nacional de Referencia de Plaguicidas y Contaminantes for its support in the sequencing of the isolates and in the preliminary bioinformatic analyses. We also appreciate the collaboration of the students Tavata Meneses, Rosaurora Medina, and Abril Viridiana García, as well as Professor Francisco Ruíz, from the Facultad de Medicina Veterinaria y Zootecnia of the UNAM, for their support in sampling and laboratory analysis activities. None of the authors has a conflict of interest regarding this publication.
REFERENCES
1. WHO. WHO estimates of the global burden of foodborne diseases. Foodborne disease burden epidemiology reference group 2007-2015. World Health Organization. http://www.who.int/foodsafety/areas_work/foodborne-diseases/ferg/en/ . Accessed Oct 25, 2018. [ Links ]
2. Wilhelm BJ, Young I, Cahill S, Desmarchelier P, Nakagawa R, Rajic A. Interventions to reduce non-typhoidal Salmonella in pigs during transport to slaughter and lairage: Systematic review, meta-analysis, and research synthesis based infection models in support of assessment of effectiveness. Prev Vet Med 2017;145:133-144. [ Links ]
3. CDC. Outbreak of Salmonella Infections Linked to Ground Beef. Centers for Disease Control and Prevention (CDC) Centers for Disease Control and Prevention (CDC) https://www.cdc.gov/salmonella/newport-10-18/index.html . Accessed Feb 25, 2019. [ Links ]
4. Cabrera-Diaz E, Barbosa-Cardenas CM, Perez-Montano JA, Gonzalez-Aguilar D, Pacheco-Gallardo C, Barba J. Occurrence, serotype diversity, and antimicrobial resistance of Salmonella in ground beef at retail stores in Jalisco state, Mexico. J Food Prot 2013;76(12):2004-2010. [ Links ]
5. Ballesteros-Nova N, Rubio-Lozano MS, Delgado-Suárez EJ, Méndez-Medina RD, Braña-Varela D, Rodas Suárez O. Perfil de resistencia a antibióticos de serotipos Salmonella spp. aislados de carne de res molida en la Ciudad de México. Salud Pública México 2016;58(3):1-7. [ Links ]
6. Gragg SE, Loneragan GH, Nightingale KK, Brichta-Harhay DM, Ruiz H, Elder JR, et al. Substantial within-animal diversity of Salmonella isolates from lymph nodes, feces, and hides of cattle at slaughter. Appl Environ Microbiol 2013;79(15):4744-4750. [ Links ]
7. Webb HE, Brichta-Harhay DM, Brashears MM, Nightingale KK, Arthur TM, Bosilevac JM, et al. Salmonella in peripheral lymph nodes of healthy cattle at slaughter. Front Microbiol 2017;8:2214. [ Links ]
8. Gragg SE, Loneragan GH, Brashears MM, Arthur TM, Bosilevac JM, Kalchayanand N, et al. Cross-sectional study examining Salmonella enterica carriage in subiliac lymph nodes of cull and feedlot cattle at harvest. Foodborne Pathog Dis 2013;10(4):368-374. [ Links ]
9. Koohmaraie M, Scanga JA, De La Zerda MJ, Koohmaraie B, Tapay L, Beskhlebnaya V, et al. Tracking the sources of Salmonella in ground beef produced from nonfed cattle. J Food Prot 2012;75(8):1464-1468. [ Links ]
10. Jekel JF, Katz DL, Elmore JG. Epidemiology, biostatistics, and preventive medicine. Third ed. Philadelphia, PA, United States of America: Saunders Elsevier; 2007. [ Links ]
11. Brichta-Harhay DM, Arthur TM, Bosilevac JM, Kalchayanand N, Schmidt JW, Wang R, et al. Microbiological analysis of bovine lymph nodes for the detection of Salmonella enterica. J Food Prot 2012;75(5):854-858. [ Links ]
12. SSA. NORMA Oficial Mexicana NOM-210-SSA1-2014, Productos y servicios. Métodos de prueba microbiológicos. Determinación de microorganismos indicadores. Determinación de microorganismos patógenos. http://www.dof.gob.mx/nota_detalle.php?codigo=5398468&fecha=26/06/2015 . Consultado 25 Feb, 2019. [ Links ]
13. Rahn K, De Grandis SA, Clarke RC, Curtiss R, Gyles CL. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes 1992;6:271-279. [ Links ]
14. Zhang S, Yin Y, Jones MB, Zhang Z, Deatherage Kaiser BL, Dinsmore BA, Fitzgerald C, Fields PI, Deng X. Salmonella serotype determination utilizing high-throughput genome sequencing data. J Clin Microbiol 2015;53(5):1685-1692. [ Links ]
15. Achtman M, Wain J, Weill FX, Nair S, Zhou Z, Sangal V, et al, Group SEMS. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathog 2012;8(6):e1002776. [ Links ]
16. Larsen MV, Cosentino S, Rasmussen S, Friis C, Hasman H, Marvig RL, et al. Multilocus Sequence Typing of Total Genome Sequenced Bacteria. J Clin Microbiol 2012;50(4):1355-1361. [ Links ]
17. Alikhan NF, Zhou Z, Sergeant MJ, Achtman M. A genomic overview of the population structure of Salmonella. PLoS Genet 2018;14(4):e1007261. [ Links ]
18. Zhou Z, Alikhan NF, Sergeant MJ, Luhmann N, Vaz C, Francisco AP, et al. GrapeTree: visualization of core genomic relationships among 100,000 bacterial pathogens. Genome Res 2018;28(9):1395-1404. [ Links ]
19. Belk AD, Arnold AN, Sawyer JE, Griffin DB, Taylor TM, Savell JW, Gehring KB. Comparison of Salmonella Prevalence Rates in Bovine Lymph Nodes across Feeding Stages. J Food Prot 2018;81(4):549-553. [ Links ]
20. Nickelson KJ, Taylor TM, Griffin DB, Savell JW, Gehring KB, Arnold AN. Assessment of Salmonella prevalence in lymph nodes of U.S. and Mexican cattle presented for slaughter in Texas. J Food Prot 2019;82(2):310-315. [ Links ]
21. Cetin E, Serbetcioglu T, Temelli S, Eyigor A. Nontyphoid Salmonella carriage, serovar profile and antimicrobial resistance phenotypes in slaughter cattle. J Food Safety 2018;39(2). [ Links ]
22. Balleste-Delpierre C, Sole M, Domenech O, Borrell J, Vila J, Fabrega A. Molecular study of quinolone resistance mechanisms and clonal relationship of Salmonella enterica clinical isolates. Int J Antimicrob Agents 2014;43(2):121-125. [ Links ]
23. Haley BJ, Kim SW, Pettengill J, Luo Y, Karns JS, Van Kessel JA. Genomic and evolutionary analysis of two Salmonella enterica Serovar Kentucky sequence types Isolated from bovine and poultry sources in North America. PLoS One 2016;11(10):e0161225. [ Links ]
24. Olafson PU, Brown TR, Lohmeyer KH, Harvey RB, Nisbet DJ, Loneragan GH, Edrington TS. Assessing transmission of Salmonella to bovine peripheral lymph nodes upon horn fly feeding. J Food Prot 2016;79(7):1135-1142. [ Links ]
25. Cernicchiaro N, Ives SE, Edrington TS, Nagaraja TG, Renter DG. Efficacy of a Salmonella siderophore receptor protein vaccine on fecal shedding and lymph node carriage of Salmonella in commercial feedlot cattle. Foodborne Pathog Dis 2016;13(9):517-525. [ Links ]
26. Delgado-Suárez EJ, Selem-Mojica N, Ortiz-López R, Gebreyes WA, Allard MW, Barona-Gómez F, Rubio-Lozano MS. Whole genome sequencing reveals widespread distribution of typhoidal toxin genes and VirB/D4 plasmids in bovine-associated nontyphoidal Salmonella. Sci Rep 2018;8(1):9864. [ Links ]
27. Fabrega A, Vila J. Salmonella enterica serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin Microbiol Rev 2013;26(2):308-341. [ Links ]
28. Holzer K, Weissend C, Huebner K, Metcalf J, Geornaras I, Belk K, Morley P, Martin J. Presence and characteristics of Salmonella enterica recovered from subiliac lymph nodes of beef feedlot cattle enrolled in a randomized clinical trial of dietary additives. Meat Muscle Biol 2017;1(3):131. [ Links ]
29. Edrington TS, Loneragan GH, Genovese K, Hanson DL, Nisbet DJ. Salmonella persistence within the peripheral lymph nodes of cattle following experimental inoculation. J Food Prot 2016;79(6):1032-1035. [ Links ]
Received: September 21, 2019; Accepted: November 25, 2019
Este es un artículo publicado en acceso abierto bajo una licencia
Creative Commons
