SciELO - Scientific Electronic Library Online

 
vol.10 número2Efecto de la termoterapia sobre la emergencia y características vegetativas de genotipos de ajoLeticia: nueva variedad mexicana de nochebuena para interiores índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Revista mexicana de ciencias agrícolas

versão impressa ISSN 2007-0934

Rev. Mex. Cienc. Agríc vol.10 no.2 Texcoco Fev./Mar. 2019

http://dx.doi.org/10.29312/remexca.v10i2.392 

Nota de investigación

Identificación y distribución de Meloidogyne spp. en tomate de Sinaloa México

José Ángel Martínez-Gallardo1 

Tomás Díaz-Valdés1 

Raúl Allende-Molar2 

Jesús Enrique Retes-Manjarrez3 

José Armando Carrillo-Fasio4  § 

1Facultad de Agronomía-Universidad Autónoma de Sinaloa. Culiacán, Sinaloa, México. (jose-angel-13@hotmail.com; tdiaz10@hotmail.com).

2Universidad Veracruzana-Facultad de Ciencias Biológicas y Agropecuarias. Tuxpan, Veracruz. (raallende@uv.mx).

3Vilmorin de México. Culiacán, Sinaloa, México. (enrique.retes@vilmorin.com).

4Centro de Investigación en Alimentación y Desarrollo AC-Unidad Culiacán. Campo El Diez, Culiacán, Sinaloa, México. (acarrillo@ciad.mx).

Resumen

A nivel mundial el género de nematodos fitoparásitos de mayor importancia es Meloidogyne, ya que afecta más de 3 000 especies de plantas y su infección se caracteriza por la formación de agallas en la raíz de la planta infectada. En Sinaloa se desconoce la distribución actual de Meloidogyne, debido a que los reportes más recientes son del año 2000 y 2001, identificando a las especies M. incognita, M. arenaria, M. hapla y M. javanica, distribuidas en el estado. En el presente trabajo de investigación los objetivos fueron identificar morfológicamente y molecularmente las especies del nematodo agallador (Meloidogyne spp.), así como, determinar su distribución en el cultivo de tomate (Solanum lycopersicum L), en Sinaloa, México. Se muestrearon lotes cultivados con tomate en las distintas zonas hortícolas de Sinaloa, México, durante los ciclos agrícolas 2013-2014, 2014-2015, 2015-2016 y 2016-2017, en campo abierto, malla sombra e invernaderos, donde se colectaron muestras de suelo y raíces agalladas, para realizar identificación morfológica y molecular. Las especies identificadas en las muestras colectadas fueron M. enterolobii, M. incognita y M. arenaria con 88, 10 y 2% de incidencia respectivamente. Estos resultados indican que M. enterolobii, M. incognita y M. arenaria se encuentran distribuidos en el estado de Sinaloa en el cultivo de tomate, siendo M. enterolobii la especie predominante.

Palabras clave: Solanum lycopersicum; horticultura; nematodo agallador

El tomate es el principal producto agroalimentario de exportación en México, su producción en el año 2013, fue de 3.2 millones de t (SIAP, 2017). En la temporada 2013-2014 se cultivaron en Sinaloa 47 136 ha de hortalizas, produciendo alrededor de 1 millón de t de tomate, exportándose de ese total 313 914 t con un valor de 303.2 millones de dólares (CIDH, 2014). Las especies de nematodos del género Meloidogyne constituyen uno de los fitopatógenos más nocivos del cultivo del tomate a nivel mundial, ya que dañan severamente el sistema radicular del cultivo. Meloidogyne se distingue de otros géneros por tener un amplio rango de hospedantes, esto ha hecho que sea catalogado como el género de nematodos fitoparásitos de mayor importancia económica en el mundo (Salazar-Antón y Guzmán-Hernández, 2013).

En México, Meloidogyne spp., es el género de nematodos fitoparásitos más importante que ataca al cultivo de tomate, debido al porcentaje de pérdidas que ocasiona y en diferentes estados productores se reporta la presencia de cuatro especies: M. incognita, M. arenaria, M. javanica y M. hapla (Carrillo et al., 2000; Cid del Prado et al., 2001); sin embargo, en la temporada 2012-2013, Martínez et al. (2015), realizaron el primer reporte de la presencia de la especie M. enterolobii atacando plantas de tomate portadoras del gen Mi (altamente resistentes a M. incognita, M. javanica y M. arenaria) en condiciones de cultivo bajo malla sombra en Culiacán, Sinaloa. Entre los reportes de Carrillo et al. (2000); Cid del Prado et al. (2001); Martínez et al. (2015), utilizaron como herramienta de biología molecular la reacción en cadena de la polimerasa (PCR), ya que ha proporcionado un enfoque alternativo y sensible para la detección e identificación de nematodos agalladores y muchos organismos patógenos presentes en el suelo que antes se dificultaba su identificación (Hu et al., 2011).

Los objetivos del presente estudio fueron identificar morfológicamente y molecularmente a Meloidogyne spp., así como conocer su distribución en el cultivo de tomate, en Sinaloa, México.

El muestreo se realizó durante la etapa reproductiva de 160 lotes cultivados con tomate, en condiciones de campo abierto, malla sombra e invernadero en cuatro de las principales zonas de producción de Sinaloa: (Los Mochis, Culiacán, La Cruz de Elota y Escuinapa), durante los ciclos agrícolas 2013-2014, 2014-2015, 2015-2016 y 2016-2017, cada punto de muestreo se georreferenció (Cuadro 1).

Cuadro 1 Localización de muestras en cultivo de tomate, en Sinaloa. 

Municipio Latitud Longitud Altitud (m)
Los Mochis 25°43'51.56'' 108°45'42.67'' 19
Los Mochis 25°55'43.13'' 108°50'11.68'' 30
Los Mochis 25°51'16.28'' 108°54'36.75'' 22
Los Mochis 25°47'17.75'' 108°44'32.27'' 24
Los Mochis 25°39'55.11'' 108°45'37.99'' 12
Culiacán 24°53'22.86'' 107°39'54.45'' 26
Culiacán 24°52'27.97'' 107°41'41.41'' 18
Culiacán 24°48'53.58'' 107°48'11.44'' 7
Culiacán 24°43'31.98'' 107°36'26.59'' 14
Culiacán 24°39'07.41'' 107°28'37.93'' 15
Culiacán 24°38'45.56'' 107°30'18.54'' 15
Culiacán 24°36'19.72'' 107°34'37.05'' 7
Culiacán 24°45'54.16'' 107°31'03.34'' 27
Culiacán 24°56'41.70'' 107°28'13.01'' 109
Culiacán 24°55'59.57'' 107°26'36.05'' 72
Culiacán 24°32'49.77'' 107°26'12.75'' 17
Culiacán 24°32'19.36'' 107°26'18.25'' 15
Culiacán 24°31'18.36'' 107°27'45.30'' 10
Elota 24°01'55.38'' 107°00'32.72'' 7
Elota 24°00'23.13'' 107°01'27.80'' 10
Elota 24°00'20.38'' 106°59'41.17'' 7
Elota 23°57'24.13'' 106°52'37.48'' 54
Elota 23°57'17.58'' 106°51'42.45'' 67
Elota 23°54'04.78'' 106°53'53.99'' 10
Elota 23°54'10.31'' 106°52'26.60'' 15
Elota 23°53'40.45'' 106°52'29.58'' 20
Escuinapa 23°06'49.21'' 106°01'54.69'' 91
Escuinapa 23°01'21.33'' 105°55'10.96'' 31
Escuinapa 22°55'55.85'' 106°06'31.24'' 7
Escuinapa 24°44'25.53'' 105°50'22.38'' 5
Escuinapa 22°43'40.57'' 105°50'16.49'' 4
Escuinapa 22°40'49.13'' 105°47'57.83'' 5

La toma de muestra de suelo se realizó entre los 5 y 30 cm de profundidad, cercano a la zona de crecimiento radical (rizósfera) de las plantas, debido a que es donde se encuentra la mayor densidad poblacional de nematodos fitoparásitos. También se incluyó la colecta de raíces agalladas para su respectivo análisis. Cada muestra de suelo estuvo constituida por 2 kg (8 a 10 submuestras) y 5 raíces agalladas (tomadas completamente al azar), se etiquetaron y se almacenó a 4 °C hasta la extracción de nematodos.

Las muestras compuestas de suelo y raíces de cada muestreo, se analizaron en el laboratorio de nematología del CIAD, Culiacán. La identificación de los especímenes se realizó con base en sus características morfológicas (región cefálica, tipo de estilete, tipo de nódulos basales y la distancia de la desembocadura de la glándula esofágica dorsal [DGED]) y patrones perineales de las hembras, apoyándose con claves taxonómicas de Eisenback et al. (1981); EPPO (2011).

Para la confirmación de la identidad de Meloidogyne a nivel especie, las raíces agalladas se lavaron con agua destilada para remover el suelo, se seleccionaron agallas individuales, de donde se extrajeron 50 hembras con una aguja de disección y se depositaron en un tubo de microcentrífuga de 1.5 mL, posteriormente, se añadió una alícuota de 45 μL de buffer de lisis (NaOH 50mM), se sometió a lisis por calor a 95 °C por 10 min, se agregó una alícuota de 45 μL de Tris-HCl (pH 8) y se centrifugó por 3 min a 10 000 rpm (Hu et al., 2011), se recuperó el sobrenadante, para proceder con la PCR utilizando los iniciadores específicos Me-F y Me-R (Meloidogyne enterolobii), F-jav y R-jav (Meloidogyne javanica), Ma-F y Ma-R (Meloidogyne arenaria), Mi-F y Mi-R (Meloidogyne incognita), Mha-F y Mha-R (Meloidogyne hapla), que codifican para la región 28S ARNr (Cuadro 2) (Hu et al., 2011).

Cuadro 2 Secuencia de primers específicos de Meloidogyne. 

Primer Secuencia de primer (5'-3') Especie específica
F: Me AACTTTTGTGAAAGTGCCGCTG M. enterolobii
R: Me TCAGTTCAGGCAGGATCAACC
F: Jav GGTGCGCGATTGAACTGAGC M. javanica
R: Jav CAGGCCCTTCAGTGGAACTATAC
F: Ma TCGAGGGCATCTAATAAAGG M. arenaria
R: Ma GGGCTGAATATTCAAAGGAA
F: Mi GTGAGGATTCAGCTCCCCAG M. incognita
R: Mi ACGAGGAACATACTTCTCCGTCC
F: Mha TCGAGGGCATCTAATAAAGG M. hapla
R: Mha GGGCTGAATATTCAAAGGAA

Las reacciones de PCR se realizaron utilizando el sistema de PCR core Systems 1 (Promega). El volumen total de la mezcla de reacción fue de 25 μL para todas las reacciones. El contenido de la mezcla de reacción fue: 10 ng de ADN genómico, 5 μL de buffer de PCR 10x, 3 μL de MgCl2 (25 mM), 0.5 μL de cada dNTP (10mM), 1 μL de cada iniciador, 0.2 μL de Taq polimerasa (5u µL-1) y el resto de agua nanopura estéril. La amplificación del ADN se llevó a cabo en un termociclador (BIO-RAD T100), bajo las siguientes condiciones de amplificación: 94 °C por 2 min, 35 ciclos de 94 °C por 30 s, 64 °C por 30 s, 68 °C por 1 min, seguidos de una extensión final a 72 °C por 5 min.

Una alícuota del producto de PCR se visualizó, en un gel de agarosa al 1%, teñido con 1 µL de bromuro de etidio (10 mg mL-1), en un transiluminador (Benchtop UV). Se consideró como respuesta positiva una banda visible de ±250 pb. (M. enterolobii), ±750 pb. (M. javanica), ±950 pb. (M. arenaria), ±1 000 pb. (M. incognita) y ±1 500 pb. (M. hapla).

Del total de poblaciones obtenidas, al analizar su caracterización morfológica, morfométrica y molecular, se registró una frecuencia de 88% para M. enterolobii, 10% para M. incognita y 2% para M. arenaria (Figura 1).

Figura 1 Porcentaje poblacional de especies de Meloidogyne en el cultivo de tomate en Sinaloa 

De acuerdo a lo reportado por EPPO (2011); Ramírez-Suárez et al. (2014; 2016), Cuaen consideración los patrones perineales de las hembras colectadas en la presente investigación, las características de la región cefálica, tipo de estilete, tipo de nódulos basales y la distancia de la DGED las muestras se identificaron como M. enterolobii: hembras anilladas con campos laterales blancos y de forma piriforme, de tamaño variable, la relación entre la distancia de la cabeza al poro excretor corta, ubicándose a nivel del metacorpus.

Estilete robusto y los patrones perineales fueron de ovoides a redondeados, con el arco moderadamente alto y redondeado. M. incognita presentó dos anillos en la región cefálica anillada y la parte anterior del estilete en forma de ‘remo’ con punta roma, nódulos basales redondeados y la distancia de la base de los nódulos a la DGED muy corta (1.8-3.3 µm), además en los cortes perineales presentaron el arco dorsal alto formado por estrías que variaron de lisas a onduladas, sin líneas laterales claramente visibles. M. arenaria tuvo la característica de tres anillos en la región cefálica y la DGED larga (3.2-4.9 µm); además, en los modelos perineales mostró presencia del arco dorsal con ‘hombreras’, formadas por ondulaciones pronunciadas de las estrías dorsales (Figura 2).

Figura 2 Patrones perineales de: A) M. incognita, B) M. arenaria y C) M. enterolobii, obtenido de hembras de raíces de cultivo de tomate de Sinaloa 

La PCR amplificó fragmentos de ± 250 pb. (M. enterolobii), ± 950 pb. (M. arenaria) y ±1 000 pb. (M. incognita) respectivamente, lo que confirma los resultados obtenidos por morfología y biología molecular.

La especie M. enterolobii se identificó en las cuatro zonas de producción de Sinaloa, mientras que M. arenaria se presentó en Los Mochis, La Cruz de Elota y Escuinapa, y M. incognita sólo se encontró en las zonas de Culiacán y La Cruz de Elota (Figura 3).

Figura 3 Distribución de especies de Meloidogyne en cultivo de tomate en Sinaloa 

En cinco lotes de muestreo (3% de las muestras) se encontraron especies mezcladas, en una se presentó M. enterolobii y M. incognita y en cuatro se encontró la mezcla poblacional de M. arenaria y M. enterolobii.

Los resultados de la identificación de las especies de Meloidogyne y su relación con la georreferenciación, coinciden con los reportes de otros investigadores (Castro et al., 1990; Cid del Prado et al., 1998; Carrillo et al., 2000; Cid del Prado et al., 2001; Martínez et al., 2015), ya que reportan que los intervalos de distribución se rigen con base en los rangos de variación de cada una de las especies.

El presente estudio contribuye al conocimiento de la distribución actual de Meloidogyne spp., en Sinaloa y se considera una base para futuras herramientas de control.

Conclusiones

El nematodo agallador (Meloidogyne), se encuentra distribuido en todas las zonas de producción de tomate en Sinaloa analizadas en el presente estudio, siendo la especie M. enterolobii la que se encontró con mayor frecuencia y distribución en las cuatro zonas muestreadas, M. incognita sólo se encontró en dos, mientras que M. arenaria se encontró en tres de las cuatro zonas muestreadas.

Literatura citada

Carrillo, F. J. A.; García, E. R. S.; Allende, M. R.; Márquez, Z. I. y Cruz, O. J. E. 2000. Identificación y distribución de especies del nematodo nodulador (Meloidogyne spp.) en hortalizas en Sinaloa, México. Rev. Mex. Fitopatol. 18(2):115-119. [ Links ]

Castro, A. A. E.; Zavaleta-Mejía, E.; Cid del Prado, V. I. y Zamudio, G. V. 1990. Rotación e incorporación de Tagetes erecta L. para el manejo de Meloidogyne incognita (Kofoid & white) Chitwood en el cultivo de tomate (Lycopersicon esculentum Mill.) en Tecamachalco, Puebla. Revista Mexicana de Fitopatología. 8:173-180. [ Links ]

Cid del Prado, V. I.; Hernández, J. A.; Espinoza, V.; Tovar, S. A. y Torres, R. 1998. Distribución geográfica y frecuencia de especies de Meloidogyne en la República Mexicana. En avances en la investigación. Instituto de Fitosanidad. Colegio de Posgraduados, Montecillo Estado de México. 114-115 pp. [ Links ]

Cid del Prado, V. I.; Hernández, J. A. y Tovar, S. A. 2001. Distribución de especies y razas de Meloidogyne en México. Rev. Mex. Fitopatol. 19(01):32-39. [ Links ]

CIDH. 2014. Comisión para la investigación y defensa de las hortalizas. Cierre de ciclo de hortalizas temporada 2013-2014. Culiacán, Sinaloa. 113 p. [ Links ]

Eisenback, J. D.; Hirschmann, H.; Sasser, J. N. and Triantaphyllou, A. C. 1981. A guide to four most common species of root-knot nematodes (Meloidogyne spp.) with a pictorial key. A cooperative publication of the Departments of Plant Pathology and Genetics. North Carolina State University and the United States Agency for International Development. Raleigh, North Carolina. 48 p. [ Links ]

EPPO. 2011. EPPO Standard PM 7/103 Meloidogyne enterolobii. Bulletin OEPP/EPPO Bulletin 41:329-339. [ Links ]

Hu, M.; Zhuo, K. and Liao, J. 2011. Multiplex PCR for the simultaneous identification and detection of Meloidogyne incognita, M. enterolobii and M. javanica using DNA extracted directly from individual Galls. Phytopathology. 101:1270-1277. [ Links ]

Martínez, G. J.A.; Díaz, V. T.; Allende, M. R.; García, E. R.S. y Carrillo, F. J.A. 2015. Primer reporte de Meloidogyne enterolobii parasitando tomate en Culiacán, Sinaloa México. Rev. Mex. Cienc. Agríc. Pub. Esp. 11:2165-2168. [ Links ]

Ramírez-Suárez, A.; Alcasio-Rangel, S.; Rosas-Hernández, L. and López-Buenfil, J. A. 2016. First report of Meloidogyne enterolobii infecting columnar cacti Stenocereus queretaroensis in Jalisco, Mexico. Plant Dis. 100(7):1506-1511. [ Links ]

Ramírez-Suárez, A.; Rosas-Hernández, L.; Alcasio-Rangel, S. and Powers, T. O. 2014. First report of the root-knot nematode Meloidogyne enterolobii parasitizing watermelon from Veracruz, Mexico. Plant Dis. 98:428-434. [ Links ]

Salazar-Antón, W. y Guzmán-Hernández, T. 2013. Efecto de las poblaciones de Meloidogyne sp. en el desarrollo y rendimiento del tomate. Agron. Mesoam. 24(2):419-426. [ Links ]

SIAP. 2017. Servicio de Información Agroalimentaria y Pesquera. http://www.siap.gob.mx/agricultura-produccion-anual/. [ Links ]

Recebido: Fevereiro de 2019; Aceito: Março de 2019

§ Autor para correspondencia: acarrillo@ciad.mx

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons