SciELO - Scientific Electronic Library Online

 
vol.8 número2Propuesta de un sistema informático para la gestión de calidad educativa agrícola (SIGCEA)Evaluación de biofertilizantes y enraizador hormonal en jatropha (Jatropha curcas L.) índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Revista mexicana de ciencias agrícolas

versão impressa ISSN 2007-0934

Rev. Mex. Cienc. Agríc vol.8 no.2 Texcoco Fev./Mar. 2017

http://dx.doi.org/10.29312/remexca.v8i2.65 

Nota de investigación

Hongos asociados a la mancha de asfalto en el cultivo de maíz en México

Erika Natalia Ríos Herrera1 

Yisa María Ochoa Fuentes1  § 

Ernesto Cerna Chávez1 

Jerónimo Landeros Flores1 

Melchor Cepeda Siller1 

Raúl Rodríguez Guerra2 

1Posgrado en Parasitología Agrícola-Universidad Autónoma Agraria Antonio Narro. Saltillo, Coahuila. CP. 25315.

2Campo Experimental General Terán-INIFAP. Carretera Montemorelos-China, km 31. Exhacienda Las Anacuas, General Terán, Nuevo León, México. CP. 67400.

Resumen

El objetivo de este estudio fue identificar los hongos fitopatógenos asociados a la mancha de asfalto en maíz, en dos estados de la República Mexicana, Chiapas y Guerrero. Se realizaron muestreos dirigidos de hojas con síntomas de la enfermedad. La identificación preliminar de los patógenos asociados con los síntomas, se realizó mediante criterios morfológicos con claves dicotómicas y se corroboró mediante la amplificación de los espacios internos de transcripción (ITS) secuenciados y analizados en la base de datos del NCBI. En ambos estados se encontró a Phyllachora maydis, y Curvularia lunata como primer reporte de la asociación a este síndrome denominado mancha de asfalto.

Palabras clave: complejo mancha de asfalto; identificación tradicional; identificación molecular

El maíz es uno de los cultivos más importantes en México, siendo los estados de Chiapas, Guerrero, Jalisco y Campeche los que concentran más de 30% de la producción nacional (SAGARPA - SIAP, 2010). En la región subtropical que comprende los estados arriba mencionados, las principales enfermedades de importancia económica son de origen fungoso, en donde se ha reportado en los últimos cinco años al complejo mancha de asfalto (CMA). Entre los factores que favorecen el desarrollo de la enfermedad destacan: la temperatura, niveles altos de fertilización nitrogenada, genotipos susceptibles, baja luminosidad, virulencia de los patógenos involucrados, alta humedad relativa y altitud 1 300 a 2 300 m. La mancha de asfalto del maíz toma relevancia en el trópico de México, por su impacto en el rendimiento; el follaje puede ser atizonado en menos de ocho días, debido a coalescencia de lesiones inducidas por los distintos hongos y atribuido a la producción de una toxina (Hock et al., 1989).

La mancha de asfalto es causada por la interacción de Phyllachora maydis y Monographella maydis. Asimismo Coniothyrium phyllachorae, un micoparásito que se encuentra asociado a P. maydis, que siempre aparece por primera vez causando la mancha de asfalto. M. maydis es responsable del daño “ojo de pez”, este se asocia con la mancha necrótica en el centro de la lesión. Este complejo fue descrito por primera vez en 1904 en el maíz mexicano. Este se ha encontrado en Bolivia, Colombia, Costa Rica, República Dominicana, Guatemala, Panamá, Perú, Puerto Rico y Venezuela. También se sabe que se ha presentado en el Ecuador, El Salvador y Haití (Hock et al., 1992).

Entre 1985 y 1988 muestreos realizados en México, revelaron alta incidencia y severos daños al maíz en Jalisco, Michoacán, Hidalgo, Veracruz, Oaxaca y Chiapas, que afectaron aproximadamente 500 000 ha del cultivo y provocaron pérdidas hasta de 50% en infecciones previas a la floración (Hock et al., 1989). De 2001 a 2005, aproximadamente 40% de 3 100 ha de maíz establecidas en el valle de Mochitlán, Guerrero, fueron afectadas por la enfermedad con pérdidas severas en el rendimiento de grano en 2005, se reportó pérdida total en 600 ha en el municipio de Tixtla, Guerrero, y para 2007, la enfermedad se presentó en más de 10 municipios de Guerrero (González et al., 2008).

El CMA, se ha convertido en una limitante en diversas zonas productoras de maíz no solo en México, también en países como Guatemala, Nicaragua y Brasil, quien es el tercer productor de maíz a nivel mundial. Por tal motivo considerando la importancia que ha tomado la enfermedad en la zona productora de Chiapas, Guerrero el objetivo es: identificar los fitopatógenos asociados a la mancha de asfalto en Guerrero y Chiapas.

Se obtuvieron 150 muestras por localidad, de los estados de Chiapas en el Municipio de Villaflores, en el ciclo otoño- invierno 2013, el estado de Guerrero, de las localidades de Buenavista, municipio de Chilapancingo y Chichihualco, Chichihualco, en el ciclo otoño invierno de 2014. La recolección fue realizada, de cuatro a 10 días después de la aparición de los primeros síntomas en la planta. El muestreo se llevó acabo en forma dirigida en plantas con lesiones características del CMA, elevadas oscuras, estromáticas de aspecto liso y brillante, de forma oval a circular, con 0.5 a 2 mm de diámetro (Hamlin, 1999; Pereyda-Hernández et al., 2009).

Las muestras se conservaron en bolsas de papel, se prensaron y secaron para ser procesadas. Se colocó el material vegetal en cortes de medio centimetro cuadrado y para las camaras humedas cortes de 1cm por 3.5 cm y se colocaron en tubos falcon de 50 mL y se agregó 20 mL de una solución estéril de hipoclorito de sodio al 5% en agua-tween con 2 gotas de tween por cada 100 mL de agua. Estas se llevaron a vortex durante un minuto, se desechó el liquido, repitiendo el proceso en tres ocaciones. Aplicando un último lavado con agua esteril y se decanto. Finalmente se secó el tejido en campana de flujo laminar de 2 a 5 horas, en papel absorvente estéril.

Se procesaron las muestras por cada localidad; Villaflores del estado de Chiapas, Buenavista y Chichihualco del estado de Guerrero. Colocando muestras de medio centímetro cuadrado previamente desinfectadas, en medio de cultivo, agar agua lavado y PDA, se incubó a 25 ºC con un fotoperiodo de 18 horas luz, monitoreando cada 24 h. Realizando montajes de los hongos desarrollados en lacto fenol y agua-tween. La caracterización morfológica se realizó en base a las claves dicotómicas para géneros imperfectos (Barnett y Hunter 1972). Simultáneo a esto se colocaron igual número de muestras, cortes de tejido de 1 cm por 3.5 cm en cámaras húmedas, para inducir la esporulación en tejido foliar enfermo, y así poder aislar los patógenos presentes.

Las muestras se incubaron de 7 a 14 d a temperatura ambiente, realizando evaluaciones cada 24 h, con un fotoperiodo de 18 h. Se monitoreó su crecimiento y desarrollo de esctructuras fungicas en la muestra. Al presentarse estructuras de reproducción de los hongos en el tejido o desarrollo micelial, se obtuvieron muestras y se realizaron aislamientos por transferencia directa de conidios en medio de cultivo PDA, para posterior mente purificar y observar en agar agua, PDA, PDA + Gentamicina (100µg mL-1). Para la identificación en el caso del género Phyllachora, se realizaron cortes directos de las lesiones (Pereyda-Hernández et al., 2009), para buscar la ascas caracteristicas del género. Se cortarón y rasparón las lesiones estromaticas de Phyllachora y se colocaron en un portaobjetos con una gota de agua estéril.

Se maceró finamente el material con navaja Gillette®. Se agregaron de una a tres gotas de agua estéril para re suspender y recuperar el material macerado. Del material recuperado se colocó una gota en una caja petri con agar agua en un extremo de la caja, y se corrió al lado opuesto. Para observar las ascas y ascosporas se colocó un microscopio desinfectado, dentro de la campana de flujo laminar. En caso de observarse las ascas muy juntas, se extendió agregando de una a dos gotas de agua estéril y con ayuda de una varilla de vidrio estéril, para dejarla secar nuevamente por 15 min. Localizando las ascas y ascospora aisladas bajo el microscopio y se cortó la fracción del medio que las contuvo para transferirlas a una nueva caja petri utilizando agar agua y V8. Se incubaron a 25 º C y 18 h luz y se monitoreo su crecimiento.

La identificación molecular se llevó a cabo por la técnica ITS- PCR, La extracción de ADN se realizó por el método de Doyle y Doyle (1991). Se raspó el micelio de cada uno de los aislados, o en el caso de Phyllachora directo con el material vegetal de las lesiones. Se maceró 0.2 g del micelio, adicionando 500µL de tampón de extracción (Tris-HCl, pH 8 100 mM, EDTA pH 8.5 50 mM, NaCl 50 mM y SDS 2%). El macerado se colocó en el vortex durante 30 segundos, posteriormente reposó 15 min en hielo; transcurrido el tiempo se adicionó 500µL de cloroformo: alcohol isoamílico 24:1, nuevamente se agitó en el vortex, para centrifugar enseguida a 12 000 rpm durante 15 min; se recuperó el sobrenadante en un nuevo eppendorf para añadir igual volumen de isopropanol.

La mezcla reposó en hielo durante 15 min, al finalizar fue centrifugada a 12 000 rpm durante 10 min. Se descartó el sobrenadante, para recuperar la pastilla. Finalmente se adicionaron 50µL de agua desionizada estéril. La concentración y cuantificación del ADN extraído Se llevó a cabo por medio de dilución (198µL agua y 2 µL ADN) en un espectrofotómetro y su integridad se confirmó por electroforesis en gel de 1% de agarosa a 90V durante 90 min. Se amplificó mediante el método de reacción en cadena de la polimerasa (PCR) las regiones internas transcritas ITS1 e ITS4 entre los genes ribosomales (rDNA) 18S-5.8S y 5.8S-28S utilizando el par de iniciadores de secuencia ITS1 (TCCGTAGGTGAACCTGCGG)/ ITS4 (TCCTCCGCTTATTGATATGC) se colocó en cada muestra; ITS1 a 10µM, 0.5 μL; ITS4 10µM, 0.5 μL; Taq -& Go a 5X, 5 μL; DNA problema ajustado a 100 ng μL-1, 2 μL; y de 17μL de agua ultrapura estéril para ajustar un volumen final de 25μL.

Las condiciones de la reacción de PCR fueron: 1 ciclo de desnaturalización inicial a 95 °C por 30 s, 30 ciclos de desnaturalización a 95 °C por 30 s, 30 ciclos de alineamiento a 60 °C por 1 min, 30 ciclos de extensión a 68 °C por 1 min y 1 ciclo de extensión final a 68 °C por 5 min. La amplificación se visualizó en un gel de agarosa al 1% mediante electroforesis a 60V. Elución del gel: del producto de PCR se cortaron y eluyeron la bandas con el kit de purificación de bandas de in vitro gen (QuickClean II Gel Extraction Kit). Se compararon con las secuencias reportadas en la base de datos del banco de genes del National Center for Biotechnology Information (NCBI) http://www.ncbi.nih.gov) mediante el programa BLAST.

Se identificaron los géneros de Phyllachora sp. y Curvularia lunata en la muestras en el estado de Chiapas y Guerrero. Por medio de cortes directos de las lesiones estromáticas en hojas, con sintomatología de mancha de asfalto, y por técnica de gota en agar agua, se identificó la especie, Phyllachora maydis. Esta ha sido descrita como el protagonista de la enfermedad denominada mancha de asfalto produciendo lesiones elevadas oscuras, estromáticas de aspecto liso y brillante, de forma oval a circular, con 0.5 a 2 mm de diámetro y forma estrías hasta de 10 mm de longitud. Donde en el estudio más reciente, en el 2009, reportaron pérdidas de 55.1% en materiales híbridos (Hamlin, 1999; Pereyda-Hernández et al., 2009).

Los ascos son cilíndricos, cortopedicelados, alargados (180-100 x 8.1μ), conteniendo ocho ascosporas, más o menos elipsoidales, hialinas, sin septas, dispuestas en posición monoseriadas midiendo, en promedio 10.5 x 6 μ (Malaguti y Subero, 1972). Por otro lado Curvularia sp. representa uno de los principales problemas que afectan la producción del cultivo de maíz (Zea mays L.), podemos citar a las enfermedades, causadas por diferentes patógenos, entre ellos la mancha foliar de Curvularia. Donde Garcés (2011) menciona como el control de este patógeno la resistencia mediante el mejoramiento genético y utilización de variedades resistentes.Conidioforos cafés, principalmente simples, teniendo conidia apical obscura, y células claras, 3 a 5 células terminales, más o menos fusiformes, doblada típicamente, con una célula centran alargada; parasita o saprofìtica (Barnett and Hunter, 1972).

Los conidióforos son de color pardo, no ramificados, erectos, a veces filiformes, con la base ligeramente más delgada que el ápice; septadas más intensamente hacia el ápice que frecuentemente se presenta geniculado, algo torcido, y con pequeñas nudosidades. Los conidios son ovalados, cilíndricos, no sigmoides, a veces encorvados, de un color castaño claro; por lo general con tres septos transversales, siendo la segunda célula, de tamaño mayor que las restantes, siguiéndole, en tamaño, la tercera célula; quedando las dos de los extremos más pequeñas e hialinas.

A veces las dos células centrales son de igual tamaño, siendo de un color algo más oscuro que de las otras extremidades. El hilo esta bien visible; así como es evidente en el conidióforo de la cicatriz donde se ha desprendido o separado el conidio. El tamaño de los conidios (de las hojas, después de 24 h en cámara húmeda) es de 19-31 µ de largo X 9-13 µ ancho (media: 24.2 X 11 µ), (Malaguti y Subero, 1971). Se corroboró la identidad molecular de ambos fitopatógenos mediante ITS, en donde se encontró a Curvularia lunata (KJ404197.1) con 100% de similaridad; por otro lado respecto a Phyllachora sp (KC683439.1) con 95%.

Conclusiones

Phyllachora sp. y Curvularia lunata fueron identificados como los agentes asociados al CMA en la muestras presentes del estado de Chiapas y Guerrero. Este es el primer reporte de la presencia de Curvularia lunata asociada a la mancha de asfalto en el cultivo de maíz en las zona subtropical en México.

Literatura citada

Barnett, H. L and Hunter, B. B. 1972. Illustrated genera of imperfect fungi. 3th. Burgess Publishing Company. Minnesota, USA. 64(4):930-932. [ Links ]

Doyle, J. J and Doyle, J. L.1991. Isolation of plant DNA from fresh tissue. Focus. 1:13-15. [ Links ]

Garcés, F. F. R.; Aguirre, C. A. J.; Carbo, M. J. J y Liubá, D. G. A. 2011. Severidad de curvularia en 67 líneas autofecundadas S4 de maíz amarrillo. Ciencia y Tecnología. 4(2):39-44. [ Links ]

González, M.; Laguna, I.; Eyherabide, G y Muñoz, J. 2008. Caracterización de factores de resistencia y virulencia en la interacción Zea mays- Puccinia sorghi. HM-40. In: 1er Congreso Argentino de Fitopatología. 28-30 mayo. Córdoba, Argentina. [ Links ]

Hamlin, R. T. 1999. Combined keys to illustrated genera of ascomycetes. APS Press. St. Paul. Minnesota. Vol. I y II. 63-64 pp. [ Links ]

Hock, J.; Kranz, J. and Renfro, B. L. 1989. E1 complejo mancha de asfalto de maíz, su distribución geográfica, requisitos ambientales e importancia económica en México. Rev. Mex. Fitopatol. 7:129-135. [ Links ]

Hock, J.; Dittrich, U.; Renfro, B. L and Kranz, J. 1992. Sequential development of pathogens in the maize tarspot disease complex. Mycopathologia. 117:157-161. [ Links ]

Malaguti, G. y Subero, L. J. 1971. Manchas foliares del maíz causadas por Curvularia en Venezuela. Agronomía Tropical. Centro de Investigaciones Agronómicas, Maracay. 21(2):119-128. [ Links ]

Malaguti, G. y Subero, L. J. 1972. La mancha de asfalto del maíz. Centro de Investigaciones Agronómicas, Maracay. Agronomía Tropical. 22(4):443-445. [ Links ]

Pereyda, H. J.; Hernández, M. J.; Sandoval, I. J. S.; Aranda, O. S.; de León, C y Gómez, M. N. 2009. Etiología y manejo de la mancha de asfalto (Phyllachora maydis Maubl.) del maíz en Guerrero, México. Agrociencia. 43(5):511-519. [ Links ]

Servicio de Información Agroalimentaria y Pesquera SAGARPA-SIAP. 2010. Cierre de la producción agrícola por cultivo. http://www.siap.gob.mx/cierre-de-la-produccion-agricola-por-cultivo/. [ Links ]

Recebido: Janeiro de 2017; Aceito: Fevereiro de 2017

§Autor para correspondencia: yisa8a@yahoo.com.

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons