The maize is one of the most important crops in Mexico, with the states of Chiapas, Guerrero, Jalisco and Campeche concentrating more than 30% of the national production (^{SAGARPA-SIAP, 2010}). In the subtropical region comprising the above mentioned states, the main diseases of economic importance are of fungal origin, where has been reported in the last five years the complex tar spot (CMA). Among the factors favoring the development of the disease are: temperature, high levels of nitrogen fertilization, susceptible genotypes, low luminosity, virulence of the pathogens involved, high relative humidity and altitude 1 300 at 2 300 m. The maize tar spot becomes relevant in the tropics of Mexico because of its impact on crop yield; blighted foliage may be less than eight days due to coalescence lesions induced by various fungi and attributed to the production of a toxin (^{Hock et al., 1989}).

The tar spot is caused by the interaction of Phyllachora maydis and M. maydis. Also Coniothyrium phyllachoraea mycoparasite that is associated with P. maydis, which always appears for the first time causing tar spot. The M. maydis is liable for damage “fish eye”, this is associated with necrotic spot in the center of the lesion. This complex was first described in 1904 in mexican corn. This has been found in Bolivia, Colombia, Costa Rica, Dominican Republic, Guatemala, Panama, Peru, Puerto Rico and Venezuela. It is also known that has been presented in Ecuador, El Salvador and Haiti (^{Hock et al., 1992}).

Between 1985 and 1988, samples from Mexico showed high incidence and severe damage to maize in Jalisco, Michoacán, Hidalgo, Veracruz, Oaxaca and Chiapas, which affected approximately 500 000 ha of the crop and caused up to 50% losses in infections prior to bloom (^{Hock et al., 1989}). From 2001 to 2005, approximately 40% of 3 100 ha of maize established in the Mochitlan Valley, Guerrero, were affected by the disease with severe losses in grain yield in 2005, total loss was reported in 600 ha in the municipality of Tixtla, Guerrero, and by 2007, the disease appeared in more than 10 municipalities in Guerrero (^{González et al., 2008}).

The CMA has become a constraint in several maize producing areas not only in Mexico, but also in countries such as Guatemala, Nicaragua and Brazil, which is the third maize producer in the world. Considering the importance of the disease in the producing area Chiapas, Guerrero, the objective is to identify the phytopathogens associated with the tar spot in Guerrero and Chiapas.

A total of 150 samples were obtained by locality, from the states of Chiapas in the municipality of Villaflores, in the Autumn-Winter cycle 2013, the state of Guerrero, in the municipalities of Buenavista, Chilapancingo and Chichihualco, Chichihualco, in the Autumn Winter cycle of 2014. The collection was carried out, from four to 10 days after the appearance of the first symptoms in the plant. The sampling took place at a targeted manner in plants with lesions characteristic of the CMA, high dark stromal smooth and shiny appearance oval to circular, with 0.5 to 2 mm in diameter (^{Hamlin, 1999}; ^{Pereyda-Hernández et al., 2009}).

The samples were stored in paper bags, pressed and dried for processing. The plant material was placed in half-square centimeter sections and for the humidified sections cut 1 cm by 3.5 cm and placed in falcon tubes of 50 mL and 20 mL of a sterile solution of 5% sodium hypochlorite in water-tween with 2 drops of tween per 100 mL of water. These were vortexed for one minute, the liquid was discarded, repeating the process in three occasions. Apply a last wash with sterile water and decant. Finally, the tissue was dried in a laminar flow hood for 2 to 5 hours, on sterile absorbent paper.

The samples were processed by each locality; Villaflores of the state of Chiapas, Buenavista and Chichihualco of the state of Guerrero. Placing half-centimeter samples previously disinfected, in culture medium, washed water agar and PDA, incubated at 25 ºC with a photoperiod of 18 light hours, monitoring every 24 h. Making assemblages of fungi developed in lactophenol and water-tween. The morphological characterization was performed on the basis of dichotomous keys for imperfect genera (^{Barnett and Hunter 1972}). Simultaneous to this were placed an equal number of samples, tissue cuts of 1 cm by 3.5 cm in humid chambers, to induce sporulation in diseased leaf tissue, and thus to isolate the pathogens present.

The samples were incubated from 7 to 14 at room temperature, performing evaluations every 24 h with a photoperiod of 18 h. Its growth and development of fungic structures in the sample were monitored. When reproductive structures of the fungi were presented in the tissue or mycelial development, samples were obtained and isolates were made by direct transfer of conidia in PDA culture medium, later to purify and to observe in water agar, PDA, PDA + Gentamicin (100µg mL^-1). For identification in the case of gender Phyllachora, direct cuts lesions were performed (^{Pereyda-Hernández et al., 2009}), to find the characteristics asci of the genre. Were cut and scraped Phyllachora stromal lesions and placed on a slide with a drop of sterile water.

The material is finely macerated with Gillette^® knife. One to three drops of sterile water were added to suspend and recover the macerated material. From the recovered material a drop was placed in a petri dish with water agar at one end of the box, and it was run to the opposite side. In order to observe the asci and ascospores, a disinfected microscope was placed inside the laminar flow hood. If the asci were closely observed, it was extended by adding one to two drops of sterile water and using a sterile glass rod, to allow it to dry again for 15 min. Locating the asci and ascospores isolated under the microscope and cut the fraction of the medium that contained them to transfer them to a new petri dish using water agar and V8. They were incubated at 25 °C and 18 h light and monitored for growth.

The molecular identification was carried out by the ITS-PCR technique, DNA extraction was performed by the method of ^{Doyle and Doyle (1991)}. The mycelium each isolated, or in the case of direct Phyllachora with plant material scraped lesion. 0.2 g of the mycelium was macerated, adding 500µL of extraction buffer (Tris-HCl, pH 8 100 mM, EDTA pH 8.5 50 mM, NaCl 50 mM and SDS 2%). The macerate was placed in the vortex for 30 seconds, then rested for 15 min on ice; after the time was added 500μL of chloroform: 24:1 isoamyl alcohol, again vortexed, then centrifuged at 12 000 rpm for 15 min; the supernatant was recovered in a new eppendorf to add equal volume of isopropanol.

The mixture was rested on ice for 15 min, at the end it was centrifuged at 12 000 rpm for 10 min. The supernatant was discarded to recover the pellet. Finally, 50 µL of sterile deionized water was added. The concentration and quantification of the extracted DNA was carried out by means of dilution (198 µL water and 2 µL DNA) in a spectrophotometer and its integrity was confirmed by electrophoresis in 1% agarose gel at 90V for 90 min. The internal transcribed regions ITS1 and ITS4 were amplified by the polymerase chain reaction (PCR) method between the ribosomal genes (rDNA) 18S-5.8S and 5.8S-28S using the primer pair ITS1 (TCCGTAGGTGAACCTGCGG)/ ITS4 (TCCTCCGCTTATTGATATGC) was placed in each sample; ITS1 at 10μM, 0.5 µL; ITS4 10μM, 0.5 µL; Taq - & Go at 5X, 5 µL; problem DNA adjusted to 100 ng µL^-1 , 2 µL; and 17μL sterile ultrapure water to adjust a final volume of 25 µL.

The conditions of the PCR reaction were: 1 initial denaturation cycle at 95 °C for 30 s, 30 denaturation cycles at 95 °C for 30 s, 30 alignment cycles at 60 °C for 1 min, 30 extension cycles at 68 °C for 1 min and 1 final extension cycle at 68 °C for 5 min. The amplification was visualized on a 1% agarose gel by electrophoresis at 60V. Elution of gel: PCR product were cut and the bands eluted with purification kit bands in vitro gene (QuickClean II Gel Extraction Kit). They were compared to the sequences reported in the National Center for Biotechnology Information (NCBI) gene bank database (http://www.ncbi.nih.gov) using the BLAST program.

The Phyllachora sp. and Curvularia lunata genres were identified on samples in the state of Chiapas and Guerrero. By direct cuts stromal lesions on leaves with symptoms of tar spot, and drop technique in agar water, the species identified Phyllachora maydis. This has been described as the protagonist of the disease called tar spot producing dark, strommatic, high-gloss, stromal-like lesions of oval-to-circular shape, 0.5 to 2 mm in diameter and forming striations up to 10 mm in length. Where in the most recent study, in 2009, they reported losses of 55.1% in hybrid materials (^{Hamlin, 1999}; ^{Pereyda-Hernández et al., 2009}).

The ascis are cylindrical, shortpedicellate, elongated (180-100 x 8.1μ), containing eight ascospores, more or less ellipsoidal, hyaline, without septa, arranged in monoserial position measuring, on average 10.5 x 6 μ (^{Malaguti and Subero, 1972}). Furthermore, Curvularia sp. represents one of the main problems affecting the production of maize (Zea mays L.), we can mention the diseases caused by different pathogens, including leaf spot of Curvularia. Where ^{Garcés (2011)} mentions as the control of this pathogen the resistance through the genetic improvement and the use of resistant varieties. Brown conidiophores, mainly simple, having dark apical conidia, and clear cells, 3 to 5 terminal cells, more or less spindle-shaped, typically folded, with an elongated center cell; parasite or saprophytic (^{Barnett and Hunter, 1972}).

The conidiophores are brown, unbranched, erect, sometimes filiform, with the base slightly thinner than the apex; septated more intensely towards the apex, which frequently appears geniculate, somewhat crooked, and with small knots. The conidia are oval, cylindrical, non-sigmoid, sometimes curved, a light brown color; usually with three transverse septa, the second cell being of larger size than the others, followed in size by the third cell; leaving the two ends smaller and hyaline.

Sometimes the two central cells are of equal size, being of a color somewhat darker than those of the extremities. The thread is well visible; as is evident in the conidiophore, the scar from which the conidium has been detached. The size of the conidia (of the leaves, after 24 h in the humid chamber) is 19-31 μ long X 9-13 µ wide (mean: 24.2 X 11 µ), (^{Malaguti and Subero, 1971}). The molecular identity of both pathogens by ITS, where he found Curvularia lunata (KJ404197.1) with 100% similarity was confirmed; on the other hand, regarding Phyllachora sp. (KC683439.1) with 95%.