Features digester and sample collection

The digester which were obtained samples consisted of 10 L. Initially carboy were mixed in 10 L of tap water, 5 kg of nopal and 0.5 kg of cow dung. The mixture was placed in a container and this was sealed. In the container, an exhaust valve and rubber bag was installed to detect gas generation. The day the initial mixture was made the first sample (T1) was taken; 50 ml of the mixture were taken and placed in a sterile bottle copro subsequently sealed and stored at -80°C. On the third day (48 hours), a second sample (T2), the fifth day (96 hours) a third (T3) was taken, and seven days (144 hours) in a final sample was taken was taken (T4). On the seventh day, the presence of methane by observing a flame valve in the digester by bringing a hillock to it was detected.

DNA extraction

The DNA extraction of the four samples was performed by two strategies, phenol-chloroform, and with a commercial kit (EZ-10 genomic DNA SPIN column mini-preps kit for bacteria, Biobasic mark). Extraction with phenol- chloroform was performed according to ^{Wilson (1990)} with some modifications. Briefly, sample was thawed and 1 ml was placed in an Eppendorf tube, centrifuged at 12 000 rpm for 10 min and the supernatant precipitate separated. 175 μl de TE 50:20 were added to the sample and vortex. Subsequently, 5 μl of proteinase K (20 mg mL^-1) and 20 μl of sodium dodecyl sulfate (SDS) at 10% were added. The sample was mixed slightly and incubated at 56 °C for 2 h. Then 500 μl TE were added 10: 1 and 20 μl NaCl 5M and stirred by inversion. A 500 μl of cold phenol (balanced) were added and continuously stirred for 10 minutes to homogenize. The sample was centrifuged at 12 000 rpm at 4 °C for 5 min and the supernatant was recovered in a new tube.

Subsequently, 500 μl of chloroform-isoamyl alcohol (24:1) were added, stirred gently by inversion, centrifuged at 12 000 rpm for 2 min at 4 °C. The supernatant was recovered in a new tube and the extraction was repeated chloroform-isoamyl alcohol. 500 μl of cold isopropoanol were added and samples were incubated at -20 °C overnight. The sample was centrifuged 12 000 rpm for 1 minute at 4 °C and the supernatant decanted. Finally the precipitate with 1 ml of cold 70% ethanol washed, centrifuge dat2000rpm for 11min at 4°C and the supernatant was removed. The DNA precipitate was allowed to dry at 65 °C for two hours and resuspended in 50 μl of sterile distilled water. The DNA extraction was performed using the kit according to the manufacturer's instructions. DNA quality was verified in an agarose gel 1.2% and chose to use only the DNA samples extracted by phenol-chloroform and from the supernatant.

Amplification hypervariable regions V3 and V6

The amplification of V3 and V6 hypervariable regions was performed with eight pairs of primers. The primers were synthesized according to the requirements of IonTorrent computer that samples sequenced. Each of the initiators initially consisted of: a) an adapter with CCATCTCATCCCTGCGTGTCTCCGACTCAG sequence (which binds to nanoperla sequencer), a recognition sequence for control sequencer with GAT nucleotides, a bar code 10 bp, and the region complementary to the hypervariable region (20 bp for the forward primer and the reverse 17 for). Four different bar codes, one for each sampled time, and two pairs of complementary regions, one for the V3 region and one for the V6 region were used. Table 1 shows the primers used.

Table 1 Primers used for amplification of V3 and V6 hypervariable regions of ribosomal gene 16 s. 

According to ^{Whiteley et al. (2012)}, the PCR reaction was performed in a volume of 50 μl containing 200 μM dNTPs, 0.5 μM of each primer, 2 units of Phusion High-Fidelity DNA Polymerase and Phusion HF Buffer 1X (including 1.5 μM MgCl₂). The PCR program used for amplification of hypervariable regions was as follows: 94°C for 5 min, followed by 25 cycles of 94°C for 40 s, 42°C for 1 min and 72°C for 2 min, with a final extension of 72°C for 4 min. The PCR products were separated on agarose gel 1.2% (P/V), using a horizontal electrophoresis chamber at 90V for 50 min.

Once confirmed the expected molecular weight of the hypervariable regions, samples were sent of each of the times and regions assessed the National Center for Genetic Resources (CE the National Institute of Forestry, Agriculture and Livestock (INIFAP), for sequencing.

Massive sequencing in IonTorrent

The output file IonTorrent sequencer (with extensión. bam) was loaded into a data structure of Matlab R2013a. The processing sequence was as follows. Sequences not containing the barcode is eliminated. By the structure of the primers used, the sequences obtained initially had the bar code (10 bp) and 20 bp corresponding to subsequently the complementary region of the hypervariable region (primer forward). Here, only sequences of at least 130 bp, for post- shaving selected sequence to remove the bar code and the complementary region, useful sequences of at least 100 bp were taken. Then the sequences according to the barcode were classified, in order to classify each of the sampled time. With the resulting sequences and separately for each of the sampled times, repeated sequences were pooled, they ordered based on the number of repetitions, and most represented 200 sequences were selected. End sequences were compared against the data base SILVA (SILVA, http://www.arb-silva.de/aligner) for obtaining taxonomic classification.

DNA extraction and amplification hypervariable regions

The DNA extraction of each of the samples obtained from the digester of nopal was performed by phenol- chloroform strategy and with a commercial kit. Extracted DNA quality was evaluated in an agarose gel 1.2%. Because a higher intense band was detected molecular weight and little sweep, he chose to use DNA samples obtained phenol-chloroform. In Figure 1, the first eight lanes (a-h) corresponding to the amplified fragments from DNA extracted using phenol-chloroform, and the last (i-p) to the fragments corresponding to extraction with the commercial kit. For each method of extraction have eight lanes as each time ran for two hypervariable regions; in this regard, lanes a and b correspond to the time T1 regions V3 and V6, respectively; c and d correspond to T2 of V3 and V6, respectively; e and f to T3, and g and h to, all for DNA extracted by phenol-chloroform methodology. This arrangement was maintained in the rest of the tracks (i-p), corresponding to DNA extracted using the commercial kit.

Figure 1 Agarose gel to measure the quality of DNA extracted by phenol-chloroform (lanes a-h) and a commercial kit (lanes i-p). 

Sequencing of V3 and V6 hypervariable regions

The concentration of PCR products amplifiers of V3 and V6 regions was adjusted to 20 picoMoles⋅μl^-1 and were sent to the National Center for Genetic Resources of the INIFAP for sequencing. Sequencing was performed on a computer IonTorrent, from Life Technologies. Each of the four times evaluated combined and two final samples for V3 and V6 regions were obtained. The Nanobeads filling each IonTorrent chips shown in Figure 2.

Figure 2 Filling chips for mass sequencing IonTorrent with nanobeads. 

For the hypervariable region V3 sequences 889 777 were obtained, and the region V6, 145 080. The longest sequences were of 293 and 281 bp for the V3 and V6 regions respectively. The median size for V3 sequence was 180 bp and 135 bp for the V6 region.

Sequence classification and filtering

As mentioned in the section of materials and methods, a different bar code for each of the sampled times was used. Since sequencing samples was performed with a mixture of all the samples obtained, the bar code was used to classify sequences. For this, a code in Matlab 2014b was written to classify sequences by bar code.

The number of end sequences used for further analysis obtained after classification and sorting sequences shown in Table 2.

Table 2 Number of sequences obtained (after filtering process) for each sampled time. 

Pooling of similar sequences reduced the total sequence analyzed as follows: for the hypervariable region V3, at T1, a unique sequence with a repetition T2, 25,207 unique sequences, T3, 37, 833 unique sequences and T4, 9.150 unique sequences. The sequences most represented were 717, 3647 and 4167 sequences for T2, T3 and T4 respectively. For the hypervariable region V6, in T1, eight, unique sequences in T2, 199 unique sequences, in T3 unique sequences 283 and T4 64 unique sequences. The most represented sequences were 1, 3, 7 and 10 sequences for T1, T2, T3 and T4 respectively.

Sequence comparison against SILVA based data and analysis of biodiversity

Comparison with the database SILVA 16s ribosomal gene was performed with the 200 unique sequences more repeated for each sampled time. Incremental SILVA parcel Aligner (SINA), in which 200 sequences for each of the sampled times used were loaded. Tables 3 and 4, the taxonomic group to which assigned each of the 200 sequences shown evaluated. Only taxonomic family and genus levels are presented. It was not possible to obtain the species to which each sequence belongs.

Table 3 Identification of families and genera based on comparison of the obtained sequences of the hypervariable region V3 microorganisms and SILVA data base. 

Table 4 Identification of families and genera based on comparison of the obtained sequences of the hypervariable region V6 microorganisms and SILVA data base. 

Of all genres shown in Tables 3 and 4, some are present only in some of the sampled time, or only one of the hypervariable regions. A general summary and list of different genres found in this metagenomic test only hypervariable region grouped together and shown in Table 5.

Table 5 Gender of bacteria found in each of the hypervariable regions evaluated. 

According to Table 5, the use of the hypervariable region V3 allowed the identification of 24 bacterial gender, using hypervariable region identified 28, V6 bacterial genera; together, in this trial they were able to identify 31 different genres of prokaryote domain.

As mentioned above, the methanogenesis process comprises two main stages, the first, degrade organic compounds and CO₂ necessary for development of the second generation stage methane. It has been reported that the first stage of methanogenesis is mediated by bacteria, especially of the phylum Firmicutes (^{Li et al., 2013}). In this work 205 were identified of V3 region and sequences 81 of V6 region sequences belonging to the group of the Firmicutes.

According to the results, it was not possible to find any kind of domain archaea, all the sequences obtained were assigned to various bacterial genera. Although it has been reported using the here tested for amplification of hypervariable regions in archaea initiators that have been allocated sequences to the domain of archaea be explained by PCR parameters used since these might not be the most efficient for amplification of V3 and V6 regions archaea. Another possible reason could be that the sampling was performed when internal conditions were dominantly aerobic digester.