SciELO - Scientific Electronic Library Online

 
vol.83 número3Eventos de mortandad masiva y cambio climático en poblaciones invernales de la mariposa monarcaValor de conservación de una área natural protegida en Puebla, México índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • No hay artículos similaresSimilares en SciELO

Compartir


Revista mexicana de biodiversidad

versión On-line ISSN 2007-8706versión impresa ISSN 1870-3453

Rev. Mex. Biodiv. vol.83 no.3 México sep. 2012

http://dx.doi.org/10.7550/rmb.28663 

Conservación

 

Evidencias fotográfica, biológica y genética de la presencia actual de jaguaroundi (Puma yagouaroundi) en Michoacán, México

 

Photographic, biological and genetic evidences of the presence of jaguaroundi (Puma yagouaroundi) at the moment in Michoacán, Mexico

 

Tiberio C. Monterrubio–Rico1*, Juan Felipe Charre-Medellín1, María Guadalupe Zavala–Paramo2, Horacio Cano–Camacho2, Mario Quetzal Pureco–Rivera1 y Livia Leon–Paniagua3

 

1 Laboratorio de Ecología de Vertebrados Terrestres Prioritarios, Facultad de Biología, Universidad Michoacana de San Nicolás de Hidalgo, 58194 Morelia, Michoacán, México. *tmonter2002@yahoo.com.mx

2 Centro Multidisciplinario de Estudios en Biotecnología, Facultad de Medicina Veterinaria y Zootecnia, Universidad Michoacana de San Nicolás de Hidalgo, 58194 Morelia, Michoacán, México.

3 Museo de Zoología, Alfonso L. Herrera, Facultad de Ciencias, Universidad Nacional Autónoma de México. Apartado postal 70–399, 04510 México, D. F., México.

 

Recibido: 05 diciembre 2011.
Aceptado: 08 marzo 2012.

 

Resumen

El jaguaroundi, a pesar de su amplia distribución neotropical, es uno de los felinos menos estudiados del continente y se carece de estudios genéticos sobre la especie. Para el estado de Michoacán ha existido la sospecha de su presencia y no obstante que sólo se tenía un registro del año 1970, los mapas de distribución de la especie en México incluyen al estado. Combinando métodos de campo (trampas cámara, recolección de campo, transectos) y genotipificación molecular, obtuvimos evidencia fotográfica, biológica y genética que confirma la presencia actual de jaguaroundi (Puma yagouaroundi) en 3 regiones del estado de Michoacán, México. Se obtuvieron 11 registros fotográficos en 7 localidades con bosque tropical y 7 de estos registros, revelaron que la especie está activa principalmente por la tarde, que existen 2 fases de pelaje, predominando la fase clara y que se reproduce en el estado. Con base en las distancias e independencia entre registros de los municipios de Arteaga y Lázaro Cárdenas, se plantea la hipótesis de que la distribución continúa a lo largo de la sierra Madre del Sur y la costa del Pacífico de Michoacán, aunque se desconoce si hay conectividad hacia la depresión del Balsas. Se obtuvieron 2 secuencias de 1089 y 1096 pb del gen de citocromo b que actualmente son las más largas que se han obtenido para la especie en México y el norte del continente. Las secuencias indican que hay 2 haplotipos distintos. La presencia de la especie en 3 regiones y los 2 haplotipos permiten suponer que en Michoacán puede contar con importante diversidad genética, aunque hace falta ampliar el tamaño de muestra para confirmarlo. Las secuencias obtenidas permitirán la comparación con individuos de otras regiones del país para conocer mejor la variabilidad genética en la especie y auxiliarán en la identificación de poblaciones para conservación.

Palabras clave: distribución observada, Felidae, haplotipos, onza.

 

Abstract

The jaguaroundi is one of the least studied felids on the American continent, despite its wide neotropical distribution. Genetic studies concerning the species are also inexistent. For the state of Michoacán, it has always been assumed as present, since the distribution maps for the species in Mexico include the state, but only one record existed from 1970. Combining survey methods (camera traps, skulls and tissue found in the field, and transects) and molecular genotyping, we obtained photographic, biological and genetic evidence that confirms the actual presence of the jaguaroundi (Puma yagouaroundi) in 3 regions of Michoacán, Mexico. Eleven records were obtained from 7 localities that present tropical forests. Seven photographic records revealed that the species main activity period is during the afternoon, that both pelage phases occur in the state with a greater proportion in the clear pelage phase, and that breeding activity occurs in the state. Based on the distance and independence among Arteaga and Lázaro Cárdenas records, we hypothesize a continuous distribution of a population along the Sierra Madre del Sur and Pacific coast of Michoacán. We are unaware if a continuous distribution occurs as well along the Balsas basin. 1 089 and 1 096 pb cytochrome b gene sequences were obtained and constitute the longest sequences reported for the species in Mexico and to the north of the continent. The sequences also revealed the presence of 2 distinct haplotypes. The presence of species in 3 regions and the presence of 2 haplotypes allow us to hipothezise that in Michoacán the species may possess important genetic diversity, although a greater sample size is required for confirmation. The sequences obtained will allow the comparison with individuals from other regions of the country in order to increase the knowledge on the species genetic variability, and will provide support for the identification of populations of conservation interest.

Key words: observed distribution, Felidae, haplotypes, onza.

 

Introducción

El jaguaroundi, Puma yagouaroundi, es un felino de tamaño pequeño a mediano, destaca por poseer el menor número de rasgos felinos. El cráneo es plano, alargado y poco profundo, las orejas son pequeñas y redondas y las extremidades son proporcionalmente más cortas en relación con su longitud. Es de los pocos felinos que presenta 2 coloraciones de pelaje, una oscura (café, con matiz negro–grisáceo) y otra clara (canela rojiza; Oliveira, 1998). A pesar de su amplia distribución neotropical, el jaguaroundi está poco estudiado, hay únicamente 6 artículos de investigación in situ publicados entre 1986 y 2007 (Brodie, 2009) y sólo existen 2 estudios genético moleculares; el primero es una evaluación genética de los linajes de las especies de felinos modernos mediante fragmentos de genes nucleares y mitocondriales de un individuo recolectado en los Estados Unidos de América (Johnson et al., 2011); en el segundo se analizan 36 individuos de zoológicos de Brasil mediante la amplificación de 4 loci de microsatélites y únicamente se revisa el contenido de información polimórfica del número de alelos obtenidos mediante juegos de oligonucleótidos diseñados para Felis catus (Moreno et al., 2006).

Puma yagouaroundi pertenece al linaje de los pumas de origen neártico, que comparte con P concolor y Acinonix jubatus. Se estima que la divergencia ocurrió hace 4.17 millones de años, con base en una evaluación genética sobre la radiación de los felinos modernos que tuvo lugar en el Mioceno tardío (Johnson et al., 2011). Se estima que la especie migró de Norteamérica a Sudamérica hace aproximadamente 2.7 millones de años a través de la conexión que se estableció en lo que hoy es Panamá (Johnson et al., 2011). La distribución global contemporánea de P. yagouaroundi abarca desde el sur de Texas hasta el sur de Brasil, Paraguay, hasta las provincias de Buenos Aires y Río Negro en Argentina (Emmons y Feer, 1997; Reid, 1997; Oliveira, 1998). La especie presenta ámbito hogareño muy variable a lo largo del neotrópico; en machos fluctúa de 17.6 a 99.9 km2 y en hembras de 6.8 a 20.1 km2, dependiendo de la región y hábitat (Oliveira, 1998). Se desconoce el ámbito hogareño para México.

Su distribución histórica reconocida para el país abarca desde el norte de Tamaulipas a lo largo del golfo de México y desde el centro de Sonora hacia el sur, a lo largo de la costa del Pacífico y la península de Yucatán (Hall, 1981; Aranda, 2005). Habita en una extensa variedad de tipos de vegetación, incluyendo bosques tropicales perennifolios, subcaducifolios, caducifolios, bosques de niebla y bosques templados, desde el nivel del mar hasta los 2 000 m (Reid, 1997; Aranda, 2005; Charre–Medellín et al., 2012). No obstante lo amplio de su distribución, el jaguaroundi está considerado especie amenazada, según la norma oficial NOM–059–SEMARNAT–2010 (SEMARNAT, 2010), debido a la destrucción de hábitat y caza.

Como ya se indicó, son pocos los estudios y datos de campo recientes (Guerrero et al., 2002; Ramírez–Pulido et al., 2005; Coronado–Quibrera, 2011; Charre–Medellín et al., 2012). Destaca el de Guerrero et al. (2002) sobre la dieta del jaguaroundi en la costa de Jalisco; informan los autores que se alimenta de pequeños mamíferos, vegetales, insectos, aves, reptiles y peces, en orden de importancia; el jaguaroundi muestra el menor grado de amplitud de nicho alimentario con respecto a otros carnívoros simpátricos de la zona, como el coyote, el mapache y la zorra gris. Por su parte, Ramírez–Pulido et al. (2005) examinaron 96 ejemplares del orden Carnivora para el estado de Puebla, provenientes de 6 colecciones científicas con sólo 2 ejemplares de jaguaroundi, que se encuentran depositados en la colección de mamíferos de la UAM Iztapalapa (1) y en la Colección Nacional de Mamíferos del Instituto de Biología de la UNAM (1), lo cual ilustra la baja disponibilidad de registros para la especie. Con enfoque estatal, sólo existe el estudio de Coronado–Quibrera (2011) quien analizó la distribución geográfica y ecológica de la especie para el estado de San Luis Potosí a partir de entrevistas. El estudio revela que las regiones de mayor aptitud ecológica para el jaguaroundi en San Luis Potosí son las subprovincias de la Gran Sierra Plegada y del Carso Huasteco, donde selvas y pastizales aledaños constituyeron los tipos de vegetación más importantes. Por último, Charre–Medellín et al. (2012), mediante trampas cámara, registran al jaguaroundi por primera vez para el estado de Guanajuato en la Reserva de la Biosfera Sierra Gorda. Además de los referidos, otro de los escasos estudios de campo recientes lo constituye el reporte sobre la depredación de un jaguaroundi adulto por parte de una Boa constrictor en la sierra de Nanchititla en el Estado de México (Monroy–Vilchis et al., 2011).

Por lo que se refiere al aspecto genético molecular, lo que se conoce de la especie para México también es poco. La secuencia disponible de ADN en Gene Bank para genotipificación molecular es parcial, con sólo 165 pb del gen mitocondrial de citocromo b (número de acceso: FJ490208.1), de un ejemplar recolectado en Chiapas. Una búsqueda en la base de datos Mammalian barcode of life, reveló que no hay código de barras (bar code) registrado para la especie. Además no existe secuencia alguna para el centro, occidente, o norte de México.

En el occidente del país, el jaguaroundi se ha registrado en el estado de Jalisco para las áreas naturales protegidas de Chamela–Cuixmala y sierra de Manantlán (INE–SEMARNAP, 1999; Ceballos y Miranda, 2000; Guerrero et al., 2002). Para el estado de Guerrero existen 5 registros históricos de recolección; 4 ocurrieron en bosques tropicales caducifolios y 1 en bosque de encino a 1 200 m (Ávila–Nájera, 2006). Históricamente, ha existido la sospecha de su presencia en el estado de Michoacán y los mapas de distribución de la especie generalmente incluyen al estado; sin embargo, es poca la evidencia que la corrobore. Leopold (1959) señaló como área de distribución potencial de P. yagouaroundi gran porción del estado, pero no dispuso de localidades de registro. Hace poco más de 40 años se contó con el primer registro científico, no anecdótico, de jaguaroundi para Michoacán; se trata del ejemplar macho recolectado en el municipio de Apatzingán el 13 de agosto de 1970 por el personal de Occidental College, con número de catálogo MLZ 953 (López–Wilchis y López–Jardines, 1998). Desde entonces, no existían registros en colecciones científicas ni en estudios publicados o recolecciones científicas que confirmaran y delimitaran su presencia en el estado.

Debido a la falta de información sobre la situación actual del jaguaroundi en el oeste de México y particularmente para el estado de Michoacán, se planteó como objetivo reunir y analizar la evidencia disponible de varios registros inéditos obtenidos durante el periodo de 3 años de trabajo de campo (2007–2010) en Michoacán y obtener la genotificación molecular de ejemplares de la especie en el estado mediante secuencias del gen mitocondrial citocromo b a partir de muestras biológicas obtenidas en campo.

 

Materiales y métodos

Como parte de distintos proyectos de investigación del laboratorio de Ecología de Vertebrados Terrestres Prioritarios de la Universidad Michoacana, se realizaron muestreos en 7 localidades de 3 regiones fisiográficas que presentan vegetación de afinidad tropical en el estado de Michoacán: la cuenca del bajo Balsas (municipio de Gabriel Zamora), la sierra Madre del Sur (municipio de Arteaga) y la costa del Pacífico (municipio de Lázaro Cárdenas) (Fig. 1). La mayoría de las localidades se encuentran en zonas montañosas topográficamente complejas de la sierra Madre del Sur, corresponden a ecotonos entre vegetación de afinidades templadas y tropicales. La vegetación en el área de estudio está representada principalmente por 2 tipos con afinidades florísticas neotropicales, el bosque tropical caducifolio y el bosque tropical subcaducifolio. Sin embargo, en las partes más altas del área de estudio de Arteaga (>600 m) se pueden encontrar bosques templados de encino y pino (Charre–Medellín, 2009). Todas las comunidades vegetales de la región presentan disturbios antropogénicos, como pastoreo y agricultura, aunque todavía se pueden encontrar fragmentos grandes >1 000 ha de vegetación primaria, especialmente en el municipio de Arteaga, de acuerdo con el Inventario Nacional Forestal–2000 (SEMARNAT y IG–UNAM, 2002).

Trabajo de campo. La presencia de jaguaroundi se documentó mediante 3 métodos: 1) trampas cámara; 2) búsqueda de ejemplares muertos (cráneos y cuerpos) a lo largo de senderos en transectos diurnos y 3) observaciones directas de conteos de fauna obtenidas en transectos diurnos y nocturnos (Rudran et al., 1996). Los registros fotográficos se depositaron en la Colección Nacional de Fotocolecta Biológica, de acuerdo con Botello et al., (2007; Cuadro 2). Los registros provienen de diferentes proyectos de investigación, no se obtuvieron mediante diseños experimentales balanceados y varias de las localidades se visitaron durante un solo periodo, con limitaciones logísticas y condiciones de inseguridad.

El esfuerzo de captura con trampas cámara se evaluó como días/cámara (una cámara operada por 24 hrs) y los transectos diurnos y nocturnos, como kilómetros recorridos. Las trampas cámara utilizadas a lo largo del estudio fueron (Moultrie Game Spy, 4.0 megapixels, Moultrie Products, Alabaster, Alabama; Wildview Xtreme 4, 4.0 megapixeles, Wildview Co., Grand Prairie, Texas). Se realizaron transectos diurnos y nocturnos a pie con una distancia de 5 y 2.5 km respectivamente; 60% de los transectos fueron diurnos (al amanecer) y 40% en el crepúsculo vespertino y al anochecer, en los diferentes años y regiones (Cuadro 1). Los cráneos y restos de jaguaroundi y las muestras de tejido y sangre que se obtuvieron en los transectos se enviaron a colecciones científicas para validación taxonómica y catalogación (Cuadro 2). Análisis genético. Para la extracción de ADN y sus análisis, las muestras biológicas de tejido del cráneo del ejemplar de Barranca Blanca en Arteaga quedaron registradas con clave Heya02 y las de pelo y sangre provenientes del ejemplar hembra de Gabriel Zamora, con la clave Heya03, ambas en la colección de muestras de ADN de fauna silvestre del Centro Multidisciplinario de Estudios en Biotecnología (CMEB) de la Universidad Michoacana de San Nicolás de Hidalgo (Cuadro 2).

El ADN genómico se extrajo de las muestras de tejido y sangre mediante el método libre de fenol de FitzSimmons (1997). Para la amplificación por PCR del gen citocromo b de ADN mitocondrial (cytb), se utilizó el juego de oligonucleótidos L14724 (5 '–CGAAGCTTGATATGAAAAACCATCGTTG–3 ') y H15149 (5'– AAACTGCAGCCCCTCAGAATGA–TATTTGTCCTCA–3') (Irwin et al., 1991). Las reacciones de PCR se realizaron en un volumen total de 25^l como sigue: Tris–HCl 20 mM pH 8.4, KCl 50 mM, MgCl2 1.5 mM, 200 mM de cada dNTP, 10 pmol de cada oligonucleótido, Platinum Taq polymerasa 1.5 U (Invitrogene) y 50 ng de ADN. Las mezclas de reacción se colocaron en un termociclador (Gene Amp. 2700, Applied Biosystems) bajo las siguientes condiciones; desnaturalización a 95° C por 5 min, seguida de 30 ciclos de desnaturalización a 93° C por 1 min., alineamiento a 50° C por 1 min., polimerización a 72° C por 1 min y una extensión final a 72° C por 5 min. La secuenciación de ambas cadenas del ADN se realizó por el método de dideoxy (Sanger et al. 1977) mediante el sistema comercial DNA Sequencing (BigDye ver.3.1 Terminator Cycle Sequencing Ready Reaction, Applied Biosystems), en un secuenciador automático (ABI PRISM 310; Applied Biosystems, Foster City, California). Para el análisis de la secuencia de ADN, se comparó con la base de datos internacional BLAST GeneBank (NCBI).

Los cráneos se depositaron en la colección de mamíferos de la Facultad de Biología de la Universidad Michoacana de San Nicolás de Hidalgo (1) y en la colección de mamíferos del Museo de Zoología de la Facultad de Ciencias en la Universidad Nacional Autónoma de México (1). En cada registro se determinó la coordenada geográfica, elevación y tipo de vegetación predominante. Para determinar la localidad precisa de los registros, medir la distancia entre registros y límites municipales y evaluar la vegetación en torno a los sitios de los registros se utilizó ArcGis ver. 9.3, ESRI Inc., Redlands, California.

 

Resultados

Se obtuvo un total de 11 registros de jaguaroundi (Cuadro 2), incluyendo los fotorregistros (Fig. 2), cráneos, muestras de ADN de tejido y pelo, y observaciones directas. Las trampas cámara proporcionaron 7 registros, el resto correspondió a observaciones directas, 2 cráneos depositados (8890MZFC, 3413 UMSNH) y muestras de pelo o tejido, todos los registros correspondieron a 7 localidades y 11 coordenadas únicas (Cuadro 2). El intervalo de elevación en el que se registró la especie fue de 139 a 1 063 m. La distancia media de los registros de P. yagouaroundi entre las localidades de los municipios de Arteaga y Lázaro Cárdenas fue de 16.9 km (intervalo 5.9–16.4 km). Se dio por hecho que 6 registros corresponden a individuos diferentes, 2 cráneos (localidades 1 y 3), 1 macho y 1 hembra fase oscura; (localidades 1 y 5), 1 hembra fase clara (localidad 6) y 1 cría hembra fase oscura (localidad 7) (Cuadro 2). Jaguaroundi presenta las 2 fases de pelaje (Fig. 2), 7 registros corresponden a individuos con fase clara, incluyendo los encontrados muertos y al que se le extrajo sangre y 4 registros corresponden a individuos de fase oscura, incluyendo 1 hembra con 2 crías de la localidad de Jaujilla (Cuadro 2).

El mayor número de registros se obtuvo en el bosque tropical subcaducifolio (n= 7), 3 en bosque tropical caducifolio y 1 en bosque de encino, este último representa el primero de la especie en bosques templados del estado. Con respecto al nivel de perturbación de la vegetación de las áreas con presencia de jaguaroundi, los 7 registros (63%) que provienen de 5 localidades de Arteaga fueron en zonas con vegetación conservada y continua en fragmentos >1 000 ha y los provenientes del municipio costero de Lázaro Cárdenas y de Gabriel Zamora en la depresión del Balsas, en áreas fragmentadas sin que existieran fragmentos mayores a 1 000 has de vegetación primaria continua. Todas las observaciones directas y fotorregistros de P. yagouaroundi fueron diurnos, observándose actividad del jaguaroundi desde las 11:30 hasta las 17:57 horas, presentándose mayor actividad entre las 14:00 y las 18:00 horas, con 6 fotorregistros en ese intervalo vespertino.

A partir de las muestras de tejido y sangre de los 2 ejemplares (Cuadro 2), se obtuvieron 2 secuencias de 1 089 y 1 096 pb de cytb (números de acceso en GeneBank: JF519764 y JQ743624). El análisis de comparación con la base de datos internacional mostró 100% de identidad con 2 secuencias de cytb antes citadas y registradas para Herpailurus yagoaurondi (Johnson et al., 2006), una de 165 pb para 1 ejemplar recolectado en Chiapas, México (número de acceso: FJ490208.1) y otra de 307 pb para un ejemplar recolectado en Brasil (número de acceso: AY886751.1). Desafortunadamente, una secuencia algo más larga, de 402 pb, utilizada por Johnson et al.(2011) no está disponible en la base de datos, razón por la cual no pudo compararse con las obtenidas en este estudio. La comparación entre las 2 secuencias de este estudio mostró 99% de identidad, observándose además la presencia de 2 haplotipos o líneas maternas diferentes. En la comparación y contraste con las secuencias registradas para la especie hermana en el linaje, que es Puma concolor, se observó 90% de identidad con 2 secuencias completas de cytb (1 140 pb) (números de acceso: JN999997.1 y AY598487.1).

 

Discusión

Los resultados de este estudio constituyen el mayor conjunto de registros recientes sobre la presencia de P. yagouaroundi para el estado de Michoacán y quizás para cualquier otro estado del occidente de México. Estos resultados incluyen fotorregistros, cráneos depositados y catalogados, además de muestras biológicas y de ADN.

Con base en la distribución observada, puede afirmarse que la especie está presente al menos en 3 regiones fisiográficas de Michoacán (Bajo Balsas, Sierra Madre del Sur y Costa del Pacífico, donde el registro de la localidad de Gabriel Zamora constituye la zona de distribución más interior del jaguaroundi en el occidente de México (Fig. 1). La proporción de individuos con pelaje en fase clara fue mayor que la de los individuos en fase oscura, lo que difiere con lo registrado por Reid (1997), quien sugiere que la fase oscura predomina para América central y sureste de México, lo que podría ser evidencia de adaptación críptica local. En algunos mamíferos se ha demostrado que la variación en la coloración del pelaje está asociada a la coloración del entorno, proporcionando ventajas antidepredatorias en roedores al incrementar la cripsis (Majerus y Mundy, 2003). Los ambientes tropicales del sur de México y Centroamérica son más húmedos, lo que podría favorecer la coloración de pelaje oscuro; por el contrario, los ambientes tropicales de Michoacán, donde predominan un clima seco, podría favorecer la coloración clara (Majerus y Mundy 2003; Feldhamer et al. 2007). Este fenómeno es reflejo del polimorfismo melánico que ocurre en varias especies de felinos incluyendo el jaguaroundi (Majerus y Mundy, 2003). En el caso del jagurundi, hipotetizamos que la cripsis puede beneficiarle facilitando su ocultamiento al cazar y como medida antidepredatoria; porque no obstante que es un depredador, por su tamaño también es presa (Monroy–Vilchis et al., 2011).

El intervalo de elevación y los tipos de vegetación donde el jaguaroundi fue registrado corresponden de manera general a los descritos para la especie en el país (Aranda, 2005) y es similar a lo que se registra en Guerrero (Ávila–Nájera 2006). Con base en los resultados de trampas cámara, se evidencia actividad reproductiva de la especie en la región de la costa y cuenca del bajo Balsas, ya que se observaron hembras con crías en mayo de 2008 y noviembre de 2009 respectivamente (Cuadro 2). El registro de crías en mayo y noviembre, coincide con lo que se ha publicado, donde se considera actividad reproductora durante todo el año (Oliveira, 1998) o 2 periodos de crianza para la especie (Leopold, 1959; Aranda, 2005).

Por otra parte, los fotorregistros revelaron mayor actividad durante la tarde, pero se desconoce si este patrón coincide con el de otras partes de México. La corta distancia entre las localidades de 5 individuos identificados en las colindancias de los municipios de Arteaga y Lázaro Cárdenas y los amplios ámbitos hogareños registrados para la especie por Oliveira (1998), permite suponer que el jaguaroundi presenta una población o metapoblación distribuida a lo largo de la sierra Madre del Sur y la costa del Pacífico en Michoacán.

Respecto al ADN, las secuencias de cytb correspondieron a 2 haplotipos (2 haplo grupos de diferente ascendencia matrilineal) y son las más largas y más norteñas registradas en GeneBank para individuos de la especie, en especial para México. Además, las 2 secuencias registradas son de mayor utilidad para futuras comparaciones en estudios de toda índole, que la secuencia más corta registrada para Chiapas con 165 pb. Además, por su ubicación, estas secuencias son las primeras para el trópico seco y el occidente de México; las disponibles en bases de datos (n= 2) provienen de ejemplares de otras regiones que corresponden al trópico húmedo (Chiapas) o a una zona ecológicamente diferente y lejana de México, como es Brasil. No se analizaron comparativamente las secuencias obtenidas y las disponibles en Gene Bank, debido a lo relativamente cortas y queda pendiente una comparación detallada de la similitud entre secuencias de individuos del trópico húmedo y del trópico seco de México, al que corresponden las secuencias de Michoacán. La presencia de 2 haplotipos que provienen de 2 regiones distintas podría indicar que la especie en el estado presenta diversidad importante, lo cual debe de corroborarse mediante mayores tamaños de muestras y estudios poblacionales. Las secuencias obtenidas permitirán la comparación con individuos de otras regiones, lo que ampliará el conocimiento sobre la variabilidad genética de la especie en México. También permitirán identificar unidades de conservación de poblaciones, lo que proporcionará bases para la toma de decisiones con propósitos de que permanezca la mayor diversidad genética posible en esta especie amenazada.

Sin duda, la combinación de metodologías de campo proporcionará mejores resultados que el empleo de una sola para estudiar al jaguaroundi, el cual es sigiloso y difícil de registrar (Brodie, 2009). Las trampas cámara (7) y los transectos (4, incluyendo cráneos) fueron eficientes en la obtención de registros de P. yagouaroundi, al comparar el tipo y cantidad de registros obtenidos respecto a los registros en otros estudios. Se obtuvo una cantidad similar de fotorregistros, comparable a los 5 confiables que Coronado–Quibrera (2011) registró para San Luis Potosí. Los registros de cráneo y ADN de este estudio son comparables a los 3 registros obtenidos para el estado de Puebla por Ramírez–Pulido et al. (2005). La combinación proporcionó un conjunto más robusto de datos e información relevante para el conocimiento de la especie.

Adicionalmente, las muestras biológicas (pelo y tejido) fueron obtenidas gracias a esfuerzos de campo en transectos. Este estudio proporciona información básica para el monitoreo de la especie en el estado, ya que en la actualidad es poca la disponible, particularmente en México (Brodie, 2009). Michoacán puede constituir un área importante para realizar estudios de la especie, con base en la amplia gama de condiciones en las que se le encuentra (desde bosque templado hasta bosque tropical caducifolio y áreas perturbadas). La evidencia de la presencia del jaguaroundi en 3 regiones del estado que presentan un gradiente de distintas condiciones ambientales ofrece también la oportunidad de realizar estudios de genética de poblacionales de la especie. Los registros presentados permiten confirmar la presencia del jaguaroundi en amplias áreas del estado. Para delimitar y cuantificar con precisión su distribución hace falta investigación en el centro y norte de la costa de Michoacán, el norte de la sierra Madre del Sur y al interior de las cuencas de los ríos Tepalcatepec y Balsas. También es vital evaluar la conectividad con áreas de distribución de la especie en estados vecinos; en especial si se obtienen nuevas muestras biológicas de recolecciones en campo, lo que permitirá conocer el nivel de diversidad, conectividad y las posibles relaciones genéticas entre poblaciones, útiles para el desarrollo de programas de conservación de la especie.

 

Agradecimientos

A L. Téllez–García, I. Carrillo–Acevedo, K. Noguez, M. Álvarez–Jara, C. Colín–Soto, A. Villanueva y L. Farias, por el apoyo en campo y a G. Padilla Jacobo y A. Fabila–Blanco, por el apoyo en laboratorio. A la familia Camorlinga–Torres y a M. Barragán, por su apoyo en el trabajo de campo. Al Laboratory of Zoology, por la información proporcionada. F. Charre–Medellín agradece a CONACYT la beca otorgada (239248). Este trabajo fue financiado por la Coordinación de Investigación Científica, Universidad Michoacana de San Nicolás de Hidalgo (UMSNH) y Fondos Mixtos CONACYT–Estado de Michoacán (Proyecto 41168). SEMARNAT proporcionó el permiso para recolección científica (FAUT–0170) a nombre de Livia León Paniagua y la Facultad de Biología de la UMSNH otorgó las facilidades para la preparación del manuscrito.

 

Literatura citada

Aranda, M. 2005. Herpailurusyagouaroundi. In Los mamíferos silvestres de México, G. Ceballos y G. Oliva (eds.). Comisión Nacional para el Conocimiento y Uso de la Biodiversidad y Fondo de Cultura Económica, México. p. 358–359.         [ Links ]

Ávila–Nájera, D. M. 2006. Patrones de distribución de la mastofauna del estado de Guerrero, Mexico. Tesis, Facultad de Ciencias, Universidad Nacional Autónoma de México, D. F. 303 p.         [ Links ]

Botello, F., G. Monroy, P. Illoldi–Rangel, I. Trajillo–Bolio y V. Sánchez–Cordero. 2007. Sistematización de imágenes obtenidas en fototrampeo, una propuesta de ficha. Revista Mexicana de Biodiversidad 78:207–210.         [ Links ]

Brodie, J. 2009. Is research effort allocated efficiently for conservation? Felidae as a global case study. Biodiversity and Conservation 18:2927–2939.         [ Links ]

Ceballos, G. y A. Miranda. 2000. Guía de campo de los mamíferos de la costa de Jalisco, México. Fundación Ecológica de Cuixmala, Universidad Nacional Autónoma de México, México, D. F. 502 p.         [ Links ]

Coronado–Quibrera, W. P. 2011. Distribución geográfica y ecológica del jaguaroundi (Puma yagouaroundi) en el estado de San Luis Potosí, México. Tesis, Colegio de Postgraduados, Instituto de Enseñanzas e Investigación en Ciencias Agrícolas. San Luis Potosí, San Luis Potosí. 69 p.         [ Links ]

Charre–Medellín, J. F. 2009. Distribución y diversidad de mamíferos medianos y grandes en el municipio de Arteaga, Michoacán. Tesis, Facultad de Biología, Universidad Michoacana de San Nicolás de Hidalgo, Morelia, Michoacán. 119 p.         [ Links ]

Charre–Medellín, J. F., V. Sánchez–Cordero, G. Magaña–Cota, M. Álvarez–Jara y F. Botello. 2012. Jaguaroundi (Puma yagouaroundi) in Guanajuato, Mexico. The Southwestern Naturalist 57:117–118.         [ Links ]

Emmons, L. H. y F. Feer. 1997. Neotropical rainforest mammals, a field guide, segunda edición. The University of Chicago Press, Illinois. 307 p.         [ Links ]

Feldhamer, G. A., L. C. Drickamer, S. H. Vessey, J. F. Merrit y C. Krajewski. 2007. Mammalogy: Adaptation, Diversity, Ecology. Third edition. The Johns Hopkins University Press, Baltimore, Maryland. 643 p.         [ Links ]

FitzSimmons, N. 1997. Male marine turtles: gene flow, philopatry and matting systems of green turtles Chelonia mydas. Tesis, University of Queensland. 2241 p.         [ Links ]

Guerrero, S., M. H. Badii, S. S. Zalapa y A. E. Flores. 2002. Dieta y nicho de alimentación del coyote, zorra gris, mapache y j aguaroundi en un bo sque tropical caducifolio de la costa sur del estado de Jalisco, México. Acta Zoológica Mexicana 86:119–137.         [ Links ]

Hall, E. R. 1981. The mammals of North America, vol. 1., segunda edición. Wiley, Hoboken, New Jersey. 600 p. + 90.         [ Links ]

INE–SEMARNAP (Instituto Nacional de Ecología–Secretaría del Medio Ambiente, Recursos Naturales y de Pesca) .1999. Programa de manejo Reserva de la Biosfera Sierra de Manantlán, México, D. F. 204 p.         [ Links ]

Irwin, D. M., T. D. Kocher y A. C. Wilson. 1991. Evolution of the cytochrome b gene of mammals. Journal of Molecular Evolution 32:128–144.         [ Links ]

Johnson, W. E., E. Eizirik, J. Pecon–Slatteri, W. J. Murphy, A. Antunes, E. Teeling y S. J. O'Brien. 2006. The late mioscene radiation of modern felidae: A genetic assessment. Science 311:73–77.         [ Links ]

Leopold, A. S. 1959. Fauna silvestre de México. Instituto Mexicano de Recursos Naturales Renovables, México, D. F. 600 p.         [ Links ]

López–Wilchis, R. y J. L. López–Jardines. 1998. Los mamíferos de México depositados en colecciones de Estados Unidos y Canadá. Universidad Autónoma Metropolitana, Unidad Iztapalapa, México, D. F. 323 p.         [ Links ]

Majerus, M. E. N. y N. I. Mundy. 2003. Mammalian melanism:natural selction in black and white. Trends in Genetics 19:585–588.         [ Links ]

Monroy–Vilchis, O., O. Sánchez y V. Urios. 2011. Consumption of an adult Puma yagouaroundi (Felidae) by the snake Boa constrictor (Boidae) in central México. Revista Mexicana de Biodiversidad 82:319–321.         [ Links ]

Moreno, V. R., A. Barufatti–Grisolia, F. Campagnari, M. Milazzotto, C. Harumi–Adania, J. F. García y E. Barreiros de Souza. 2006. Genetic variability of Herpailurusyagouaroundi, Puma concolor and Panthera onca (Mammalia, Felidae) studied using Felis catus microsatellites. Genetics and Molecular Biology 29:290–293.         [ Links ]

Oliveira, T. 1998. Herpailurus yagouaroundi. Mammalian Species 578:1–6.         [ Links ]

Patterson, B. D., G. Ceballos, W. Sechrest, M. F. Tognelli, T. Brooks, L. Luna, P. Ortega, I. Salazar y B. E. Young. 2007. Digital distribution maps of the mammals of the western hemisphere, ver. 3.0. NatureServe, Arlington, Virginia.         [ Links ]

Ramírez–Pulido, J., N. González–Ruiz y H. H. Genoways. 2005. Carnivores from the Mexican state of Puebla: distribution, taxonomy, and conservation. Mastozoología Neotropical 12:37–52.         [ Links ]

Reid, F. 1997. A field guide to the mammals of Central America and southeast México. Oxford University Press, New York. 334 p.         [ Links ]

Rudran, R., T. H. Kunz, C. Southwell, P. Jarman y A. P. Smith. 1996. Observational techniques for non–volant mammals. In Measuring and monitoring biological diversity: standard methods for mammals, D. E. Wilson, F. R. Cole, R. Rudran y M. Foster (eds.). Smithsonian Institution Press, Washington, D.C. p. 81–104.         [ Links ]

Sanger, F., S. Nicklen y A. R. Coulson. 1977. DNA sequencing with chain–terminatinginhibitors. Proceedings of the National Academy of Sciences. 74:5463–5467.         [ Links ]

SEMARNAT (Secretaría de Medio Ambiente y Recursos Naturales). 2010. Norma Oficial Mexicana NOM–059–ECOL–2010. Protección ambiental– Especies nativas de México de flora y fauna silvestre– Categorías de riesgo y especificaciones para su inclusión exclusión o cambio–Lista de especies en riesgo. Diario Oficial de la Federación, segunda sección, 30 de diciembre de 2010.         [ Links ]

SEMARNAT e IG–UNAM (Secretaría de Medio Ambiente y Recursos Naturales e Instituto de Geografía, UNAM). 2002. Inventario Nacional Forestal. Mapa digitalizado. Secretaría del Medio Ambiente y Recursos Naturales, México D. F. http//infoteca.semarnat.gob.mx/sitios_interes.htm; última consulta:15.I.2012.         [ Links ]

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons