SciELO - Scientific Electronic Library Online

 
vol.83 número3Nuevos registros estatales y nacionales de escarabajos (Coleoptera: Scarabaeoidea) y comentarios sobre su distribuciónDistribución geográfica y ecológica de Ipomoea (Convolvulaceae) en el estado de Michoacán, México índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • No hay artículos similaresSimilares en SciELO

Compartir


Revista mexicana de biodiversidad

versión On-line ISSN 2007-8706versión impresa ISSN 1870-3453

Rev. Mex. Biodiv. vol.83 no.3 México sep. 2012

http://dx.doi.org/10.7550/rmb.17897 

Ecología

 

Microorganismos asociados a la rizosfera de jitomate en un agroecosistema del valle de Guasave, Sinaloa, México

 

Rhizosphere microorganisms associated to tomato in an agroecosystem from Guasave Valley, Sinaloa, Mexico

 

Jesús Damián Cordero–Ramírez, Raquel López–Rivera, Carlos Ligne Calderón–Vázquez, Alejandro Miguel Figueroa–López, Juan Carlos Martínez–Álvarez, Karla Yeriana Leyva–Madrigal, Rocío Guadalupe Cervantes–Gámez e Ignacio Eduardo Maldonado–Mendoza*

 

Departamento de Biotecnología Agrícola, CIIDIR–IPN Unidad Sinaloa, Instituto Politécnico Nacional. 81101 Guasave, Sinaloa, México. *imaldona@ipn.mx

 

Recibido: 19 mayo 2010.
Aceptado: 05 marzo 2012.

 

Resumen

La diversidad de los microorganismos asociados a la rizosfera de diferentes especies vegetales en los suelos, en México se ha estudiado poco y se ha abordado de manera convencional, con técnicas microbiológicas limitadas debido al elevado porcentaje de microorganismos no–cultivables (95–99%). En el presente trabajo se empleó el análisis por secuenciación del ADN ribosomal (ADNr) para evitar esa limitante y explorar mejor la diversidad de los microorganismos cultivables y no–cultivables asociados al jitomate (Solanum lycopersicum L.) en un agroecosistema en Sinaloa. Se empleó ADN genómico extraído del suelo rizosférico para amplificar una región hipervariable en el ADNr empleando oligonucleótidos universales para ADNr procariota y eucariota. El análisis de 194 y 384 secuencias de ADNr de origen procariota y eucariota, respectivamente, mostró que los phyla eucariotes más abundantes fueron Ascomycota (59%), Chlorophyta (21%) y Basidiomycota (12%), y los más abundantes de origen procariote fueron Firmicutes (45%), Proteobacteria (14.7%) y Gemmatimonadetes (13.1%). El presente trabajo representa a la fecha la caracterización más completa de la diversidad de microorganismos de la rizosfera del jitomate. Se discute el papel que especies identificadas en este trabajo, pertenecientes a géneros procariotas (Bacillus y Paenibacillus) y eucariotas (Alternaría), pudieran desempeñar en la rizosfera del jitomate y en el control biológico de fitopatogénos en esta especie.

Palabras clave: rizosfera, ITS, ADN ribosomal, jitomate cultivado.

 

Abstract

Rhizosphere microorganism diversity associated to different plant species in Mexican soils has been understudied. Most of those studies have been done using conventional microbiological techniques, which present an important limitation due to their incapacity to detect unculturable microorganisms, which represent 95–99% of the total microorganisms in soils. The present work employs ribosomal DNA (rDNA) sequencing to overcome this limitation and to improve exploration of the diversity of culturable and non–culturable microorganisms associated to tomato (Solanum lycopersicum L.) in an agroecosystem from Sinaloa. Genomic DNA from rhizospheric soil was extracted and a hypervariable region on the rDNA was amplified using universal oligonucletides directed to amplify prokaryotic and eukaryotic rDNA. Sequence analysis of 194 and 384 rDNA clones of prokaryotic and eukaryotic origin respectively showed that for eukaryotes, the most abundant phylum was Ascomycota (59%), followed by Chlorophyta (21%) and Basidiomycota (12%), while for Prokaryotes, the phylum Firmicutes (45%) was the most abundant followed by Proteobacteria (14.7%) and Gemmatimonadetes (13.1%). This contribution represents the most complete characterization of the microorganism diversity associated to tomato rhizosphere. The work discusses the role that species belonging to genera from prokaryotic (Bacillus and Paenibacillus) or eukaryotic origin (Alternaria) identified on this work, could play in the rhizosphere of tomato and the biological control of phytopathogens in this species.

Key words: rhizosphere, ITS, ribosomal DNA, cultivated tomato.

 

Introducción 

En los ecosistemas agronómicos, los microorganismos que habitan los suelos son elementos importantes en el funcionamiento de los mismos. Muchos microorganismos en los diferentes ecosistemas no pueden cultivarse, y se calcula que representan el mayor porcentaje de los organismos presentes (99%) (Handelsman, 2004). Este hecho representa una gran limitación en el estudio de la diversidad biológica de la rizosfera. Sin embargo, los recientes avances en los métodos moleculares y metagenómicos permiten analizar los mecanismos de interacción entre las plantas y los microorganismos presentes en la rizosfera, así como entender el papel de los microorganismos en procesos edáficos y ecológicos importantes en el suelo (Sessitsch et al., 2001; Rajendhran y Gunasekaran, 2008; van Elsas et al., 2008; Mendes et al., 2011 ), tales como la participación de taxones específicos en la supresión de enfermedades (Mendes et al., 2011), o bien, el efecto sistémico en plantas inoculadas con hongos micorrízicos arbusculares contra patógenos de la parte aérea (Liu et al., 2007). Mediante la técnica de reasociación del ADN, Torsvik et al. (1990) demostraron la gran diversidad genética bacteriana presente en un suelo forestal, identificando cerca de 4 000 genomas bacterianos; mientras que el número de bacterias aisladas en cultivo a partir de la misma muestra fue 200 veces menor.

El monitoreo de ADN ribosomal (ADNr) es otra técnica que se utiliza con estos fines; se basa en la amplificación por la reacción en cadena de la polimerasa (o PCR, por sus siglas en inglés) de una región hipervariable del ADNr y la secuenciación de un gran número de clonas representando diferentes organismos cada una. Esta técnica permite el estudio de organismos que pueden o no cultivarse en el laboratorio, lo que ha revolucionado la manera de estudiar hoy en día estos grupos de microorganismos (revisado en Maldonado–Mendoza et al., 2009). Al obtener cientos de secuencias de ADNr y combinarse éste con un análisis de diversidad, como el del uso de curvas de rarefacción, puede obtenerse información acerca de la complejidad de la microbiota del suelo. Los análisis de rarefacción basados en unidades taxonómicas operativas (OTUs, por sus siglas del inglés operational taxonomic units) permiten estimar si el número de secuencias obtenidas representa una fracción significativa de las muestras, así como realizar comparaciones de la diversidad entre muestras de diferente tamaño (Acinas, 2007).

El jitomate (Solanum lycopersicum L.) representa el cultivo hortícola con mayor importancia económica en el estado de Sinaloa (SIAP, 2009). Sin embargo, esta especie se produce en agroecosistemas totalmente alterados por el monocultivo y manejo intensivo. Recientemente, Kim et al. (2006) estudiaron la diversidad procariótica en la rizosfera de jitomate mediante la exploración de la región 16S del ADN ribosomal, e identificaron los phyla Proteobacteria (α–, β–, γ– y δ–) y Cytophaga–Flavobacterium–Bacteroides (CFB) como los mayoritarios. En otro estudio, Wu et al. (2008) combinaron diferentes estrategias, tales como PCR de longitud heterogénea y la secuenciación de 30 amplificaciones del gen 16S del ADNr, identificando con secuencias en las bases de datos 8 de éstos con homología en los niveles de género y especie: Bacillus sp., B. megaterium, Chelatococcus sp., Luteibacter rhizovicina, Nitrospira sp., Nordella ologomobilis y Xanthomonas sp.

En el presente trabajo, utilizando una estrategia similar a la de Wu et al. (2008), se obtuvieron y clonaron 194 y 384 fragmentos de PCR de origen procariótico y eucariótico, respectivamente, a partir de ADN genómico extraído de suelo rizosférico de jitomate cultivado en el valle de Guasave. Mediante esta estrategia es factible obtener una panorámica más representativa de los microorganismos independientemente de su capacidad para crecer en medios de cultivo (Rappe y Giovannoni, 2003). El objetivo del trabajo es conocer la diversidad de la microbiota asociada a la rizosfera del jitomate en cultivo. Este estudio es a la fecha el más completo sobre la diversidad de la microbiota asociada a la rizosfera de jitomate en cultivo. Los hallazgos en cuanto a la abundancia de microorganismos, tanto procariotas como eucariotas, con potencial en el control biológico de enfermedades de cultivos agrícolas se discuten con detalle.

 

Materiales y métodos

Sitio de estudio. Las muestras de suelo fueron tomadas el día 22 de marzo del 2006 de un lote comercial de jitomate variedad Gabriela sembrado el 20 de octubre del 2005, cuyo cultivo estaba en la etapa de inicio de la senescencia. El método de irrigación utilizado en el cultivo fue por goteo. El lote pertenece a Agrícola del Rancho S.A. de C.V, ubicada en el Campo Díaz en Guasave, Sinaloa, México. El muestreo se realizó trazando un cuadrante (20 × 20 m) tomando 5 muestras equidistantes. La distancia entre cada punto de muestreo fue de 5 surcos de siembra (1.8 m de distancia entre cada surco).

Se tomaron columnas de suelo de aproximadamente 50 cm de profundidad y 10 cm de diámetro con un nucleador de acero inoxidable, lo más cerca posible del tallo principal de la planta de jitomate. El suelo rizosférico bien adherido a la raíz se recogió y se dejó secar a temperatura ambiente por una semana. Análisis de suelo. Se tomó con el nucleador una submuestra del homogenizado (100 g), conteniendo tanto suelo rizosférico como suelo muestreado y se entregó al laboratorio de Nutrición Vegetal del CIIDIR–IPN, Unidad Sinaloa, para el análisis de los parámetros físicos y químicos del suelo, tales como nitrógeno, fósforo y potasio (NPK) y otros nutrientes, como calcio (Ca2+), magnesio (Mg2+), pH, conductividad eléctrica y materia orgánica disponible (MOD).

Extracción del ADN directamente del suelo. Una vez secas, de cada una de las 5 muestras de suelo se tomó 1 g y se homogenizaron para constituir una muestra integrada (O'Brien et al., 2005). Se tomaron 2 alícuotas de 0.25 g cada una y se procedió a aislar el ADN de las muestras (siguiendo las indicaciones del proveedor) con el Power Soil DNA isolation kit de la compañía MoBio (Cat. No. 12888–50; Carlsbold, CA, USA). Se tomaron 10 ng del ADN eluido y se combinó con la mezcla de reacción para PCR que contenía H2O destilada estéril, 0.5 µM de cada uno de los oligonucleótidos, 1 × de buffer para PCR, 1 mM de MgCl2; 500 µM de cada uno de los dNTPs y 0.5 U de Taq ADN polimerasa en un volumen final de 30 µL (Cat. No. 10966–030. Lot. TPKB1d, Invitrogen, EUA). Amplificación por la técnica de reacción en cadena de la polimerasa (PCR). Para amplificar las secuencias internas transcritas (ITS) eucariotas se emplearon los oligonucleótidos ITS1 (5' TCCGTAGGTGAACCTGCGG 3') e ITS4 (5'TCCTCCGCTTATTGATATGC 3') (White et al., 1990) para obtener un producto de aproximadamente 600 pb. Estos oligonucleótidos amplifican las regiones hipervariables itsl e its2 del ADN ribosomal. Las condiciones del programa fueron las siguientes: desnaturalización 4 min a 95° C, 1 min a 95° C, anillamiento 1 min a 60° C, elongación 2 min a 72° C, por 29 ciclos y un paso final de 5 min a 72° C. La amplificación se llevó a cabo en un termociclador MyCycler de BioRad (Cat. No. 580BR–2592, CA, EUA). Para el caso de los procariotas los oligonucleótidos seleccionados fueron: 1 (5'CTCTGTGTGCCTAGGTATCC 3') y U1 (5' CCAG–CAGCCGCGGTAATACG 3') (Lu et al., 2000; Boyer et al., 2001) los cuales amplifican una región parcial de la subunidad 16S, la región ISR y parte de la región 23S del ADNr. Las condiciones del programa de PCR para amplificar el ADNr de procariotas fueron: 4 min a 95° C, 1 min a 95° C, anillamiento 1 min a 55° C, elongación 2 min a 72° C, por 29 ciclos y un paso final de elongación de 5 min a 72° C. Los productos de PCR fueron clonados en el vector de clonación pGEM–T Easy Vector System (Promega, Cat. No. 157348, EUA), 194 y 384 clonas de origen procariótico y eucariótico respectivamente fueron recogidas y su ADN plasmídico purificado y enviado a secuenciar a LANGEBIO (IPN. CINVESTAV–Irapuato).

La secuenciación se llevó a cabo unidireccionalmente y debido al empleo del primer T7 del vector se obtuvieron clonas en ambas direcciones, lo cual se debe a que cuando el producto de la amplificación del ADNr se liga dentro del vector, la posibilidad de ligarse en cualquier dirección es aproximadamente del 50%. Para el análisis de las secuencias se emplearon todas las registradas en el Genbank sin importar su direccionalidad, y para los análisis filogenéticos se emplearon secuencias dentro de las registradas al Genbank en la misma dirección.

Análisis de las secuencias. Los electroferogramas obtenidos, así como las secuencias resultantes fueron filtrados por calidad y vector, utilizando los algoritmos Phred y Cross–match (Ewing y Green, 1998a, 1998b). De las secuencias de alta calidad resultantes, sólo fueron seleccionadas para su posterior análisis aquellas con al menos 200 nucleótidos de longitud. Posteriormente, las secuencias obtenidas se analizaron y alinearon para descartar la posible formación de secuencias quiméricas con la base de datos prealineada Silva Database (http://www.mothur.org/wiki/Silva_reference_files), la cual se usó como referencia, y el análisis se realizó en el programa Chimera Slayer del Broad Institute (Hass et al., 2011). Para confirmar la ausencia de quimeras, las secuencias obtenidas también fueron comparadas con la base de datos pública del Centro Nacional de Información Biotecnológica (NCBI) empleando el programa BLAST–N y el algoritmo megablast (http://www.ncbi.nlm.nih.gov/) (Wheeler et al., 2000), descartándose las que tuvieran hit significativo en más de un organismo dentro de la misma secuencia. Para la anotación de las secuencias e identificación de los organismos respectivos también se utilizó el programa BLAST–N. Como referencia se tomó la base de datos no–redundante y la anotación se heredó para el mejor hit, al menos con 95% de homología y 90% de la longitud total de la secuencia de nucleótidos. Las secuencias se sometieron como lote al Genbank y están registradas con los números JN590759–JN590909, JN607166–JN607208 (clonas procariotas) y JN660401–JN660590, JN660592–JN660754, JN660762–JN660792 (clonas eucariotas).

Análisis filogenético. El análisis filogenético de las secuencias se realizó con el software MEGA 5 Beta (Tamura et al., 2011). Las secuencias se alinearon usando el software de alineamiento de secuencias múltiple MUSCLE (Edgar, 2004) implementado en MEGA 5. Los árboles filogenéticos se construyeron con el método de neighbor–joining (NJ) (Saitou y Nei, 1987) y el modelo de sustitución de Tamura–Nei. La tasa de variación fue modelada por una distribución gamma, con 4 categorías. Los gaps se trataron con la opción pairwise deletion en MEGA. La solidez de la topología de NJ se evaluó mediante la prueba de bootstrap, usando 1000 réplicas. Para generar el árbol filogenético de los procariotas, se emplearon 14 de las 194 secuencias enviadas al Genbank, número que resultó después de eliminar las secuencias de organismos no cultivables no identificados taxonómicamente y considerar sólo secuencias orientadas en la dirección 16S23S. Se seleccionó sólo 1 secuencia representativa para incluir una cobertura total de los diferentes grupos y además se incluyeron 11 secuencias previamente registradas en el Ribosomal Database Project (RDP) (http://rdp.cme.msu.edu/index.jsp) y NCBI para mostrar que las secuencias obtenidas en el presente trabajo son homólogas a secuencias de organismos ya caracterizados. Los fragmentos de las secuencias utilizadas fueron de 284–782 nt. Para eucariotas se emplearon 56 secuencias del gen 5.8S ADNr incluyendo solamente una secuencia representativa de cada grupo taxonómico identificado en el análisis. A diferencia del árbol de procariotas, para este árbol solamente se utilizaron secuencias obtenidas en el presente trabajo.

Análisis de rarefacción. Los análisis de rarefacción basados en OTUs, para estimar si el número de secuencias obtenidas representa una fracción significativa de las muestras totales, se realizaron empleando únicamente aquellas secuencias que pasaron diferentes criterios de calidad, como las mayores a 200 nucleótidos, las no quiméricas y orientadas en la misma dirección (16S 23S rARN para procariotas o 18S 28S rARN para eucariotas). Las secuencias se alinearon con el programa Clustal–W (Higgins et al., 1994). La matriz de distancia se calculó con el programa Dnadist de Phylip versión 3.69 (Felsenstein, 2009), usando el modelo de sustitución Jukes–Cantor. Las secuencias se agruparon en OTUs con el programa Cluster, usando el algoritmo average neighbor; el análisis de rarefacción se realizó con el programa Mothur versión 1.20.1 disponible en http://www.mothur.org (Schloss et al., 2009). Se analizaron 149 secuencias de origen procariota en dirección 16S 23S, ya que se descartaron algunas de las 194 secuencias enviadas al Genbank que estaban en la orientación 23S 16S, y para el análisis con secuencias de origen eucariota se analizaron 362; estos números resultaron de eliminar algunas secuencias de origen vegetal.

 

Resultados

Análisis de suelos. De acuerdo con el triángulo de textura aprobado por el Departamento de Agricultura de los Estados Unidos de América, la del suelo muestreado es franco–limo–arcillosa (% arena/arcilla/limo 17.45/37.55/45). El suelo mostró acidez moderada (5.88 ± 0.56), con una conductividad eléctrica de baja a media (1.41 ± 1 mS/cm), contenido bajo de materia orgánica (1.37 ± 0.1%) y de N (10 ± 5.55 mg/kg), concentración media de Ca2+ y Mg2+ (8.56 ± 2.9 y 1.84 ± 0.9 Cmol/kg, respectivamente) y elevada de K+ (3.18 ± 0.3 Cmol/kg) y de fósforo (56.2 ± 10 mg/kg).

Biblioteca de origen procariótico. El análisis de las 194 secuencias registradas en el Genbank encontró que 72 clonas tuvieron homología con organismos procariotas no cultivables sin clasificar [bacteria no cultivable (48), Bacteroidetes no cultivable (2), candidata a bacteria no cultivable (1), bacteria de cráter de un lago no cultivable (1), Firmicutes no cultivable (2), organismo no cultivable (3), bacteria del suelo no cultivable (13) y las secuencias de un eucariota que fue clasificado como diatomea no cultivable (2)] y se encontraron 122 organismos que sí tuvieron homología con secuencias previamente publicadas y por consiguiente éstas fueron empleadas para el estudio taxonómico.

En el análisis de diversidad de estas 122 clonas se encontró que pertenecen a 8 diferentes phyla, dentro de los cuales se encontraron 9 diferentes clases, 2 subclases, 10 órdenes, 3 subórdenes, 14 familias, 20 géneros y un total de 30 especies (Cuadro 1). El orden de abundancia de los phyla encontrados en esta biblioteca fue el siguiente: Firmicutes (55 clonas, 45%), Proteobacteria (18 clonas, 15%), Gemmatimonadetes (16 clonas, 13%), Actinobacteria (13 clonas, 11%), Acidobacteria (12 clonas, 10%), Cianobacteria (5 clonas, 4%), Chloroflexi (2 clonas, 1.6%) y Bacteroidetes (1 clonas, 1%) (Fig. 1). Los géneros más abundantes en esta biblioteca fueron: Paenibacillus con 32 clonas, Acidobacteria con 12 clonas, Bacillus con 13 clonas y Patulibacter con 8 clonas (Fig. 2).

La abundancia de las especies (OTUs) de esta biblioteca mostró 5 que fueron las más representadas: Gemmatimo–nadales no cultivables con 16 clonas (13%), Paenibacillus sp. con 12 clonas (9.8%), Acidobacteria no cultivable con 10 clonas (8%), Patulibacter minatonensis con 8 clonas (6.5%) y los organismos P. chondroitinus, P. popilliae y Delta Proteobacterium no cultivable con 7 clonas cada una (Cuadro 1).

Para conocer la relación filogenética existente entre cada una de las clonas de origen procariótico identificadas, se realizó un estudio filogenético de la región 16S del ADNr en el cual sólo se incluyó una secuencia por cada especie identificada (Fig. 3). En el árbol filogenético se incluyeron secuencias propias de este trabajo y algunas de referencias tomadas del Genbank y del RDP para cubrir cada uno de los grupos taxonómicos representados en el análisis filogenético. La inclusión de secuencias de referencia en el análisis filogenético permite corroborar la identidad de las clonas y organizarlas en clusters o grupos correspondientes al phylum al que pertenecen (p. ej., Cianobacteria, Actinobacteria) tal como se muestra en el árbol filogenético (Fig. 3). Inicialmente se distinguen 2 ramas; la primera representada por el phylum Gemmatimonadetes y la segunda por los phyla Chloroflexi, Cianobacteria, Actinobacteria, Firmicutes y Proteobacteria. El phylum Firmicutes se desprende de la segunda rama y forma un cluster independiente conformado por las especies Paenibacillus fujiensis, Enteroccocus avium, Bacillus sp. y Bacillus sp. no cultivable, dejando a los representantes del género Brevibacillus agrupados en otro cluster dentro de la rama conformada por el resto de los phyla. El phylum Proteobacteria se agrupa en una rama que incluye miembros del phylum Actinobacteria, formando éstos una subrama que incluye miembros de Proteobacteria: Anaeromyxobacter dehalogenans, Myxococcales no cultivable y Delta proteobacteria, filogenéticamente más cercanas a la rama del phylum Actinobacteria, conformada por Mycobacterium gordonae y Patulibacter minatonensis, que a Sphingosinicella, la cual se agrupa con esta rama del árbol. El phylum que se separó de la rama del árbol conformada por los 5 phyla diferentes, antes mencionados, fue el de Gemmatimonadetes.

Biblioteca de origen eucariótico. De un total de 384 clonas de esta biblioteca que se enviaron a secuenciar, 53 mostraron homología de organismos que no podían clasificarse [Agaricaceae no cultivable (1), hongo micorrízico arbuscular (HMA) no cultivable (1), hongo no cultivable (5), hongo del suelo no cultivable (26), endófito fúngico (15), hongo sp. (5)] y 21 clonas que aunque de origen eucariota no se consideraron ya que eran de origen vegetal y mostraron homología con la solanácea Lycium ruthenicum y 1 clona de la briofita Plagiomnium medium, por lo que se realizó el análisis de las 309 clonas restantes, las cuales presentaban homología a organismos conocidos y registrados en el NCBI. Se identificaron en total 9 phyla, 4 subphyla, 13 clases, 10 subclases, 23 órdenes, 26 familias, 45 géneros y 71 especies (Cuadro 2). El orden de abundancia de los phyla encontrados en esta biblioteca fue: Ascomycota con 183 clonas (59%), Chlorophyta con 63 clonas (21%), Basidiomycota con 38 clonas (12%), Nematoda con 11 clonas (4%), Streptophyta con 4 clonas (1%), Ciliophora con 4 clonas (1%), Zygomicota con 3 clonas (1%), Chytridiomycota con 2 clonas (0.6%) y Glomeromycota con 1 clona (0.3%) (Fig. 4). Los géneros más abundantes de esta biblioteca fueron: Alternaria con 62 clonas, Scenedesmus con 59 clonas, Emmonsia con 30 clonas, Cladosporium y Acremonium con 27 y 11 clonas de manera respectiva (Fig. 5).

Las 5 especies más abundantes fueron las siguientes: Scenedesmus sp. (Chlorophyta) con 52 clonas (15%), Emmonsia parva (Ascomycota) con 29 clonas (9%), Alternaría alternata (Ascomycota) con 21 clonas (6.7%), Cladosporium oxysporum (Ascomycota) con 17 clonas (5.5%) y Alternaria tenuissima (Ascomycota) con 12 clonas (3.8%) (Cuadro 2).

Para conocer la relación filogenética existente entre las clonas de origen eucariota se elaboró un árbol filogenético de la región 5.8S del ADNr, lo cual permitió hacer un análisis completo de los diferentes grupos taxonómicos identificados (Fig. 6). El árbol filogenético resultante muestra la ubicación de las diferentes especies pertenecientes a la misma clase o phylum en ramas cercanas. En el árbol se ubicó una primera rama que incluye representantes de los phyla Chlorophyta, Basidiomycota, Chytridiomycota, Zygomycota y Streptophyta. Esta rama se ubica cercanamente a los grupos de origen animal Ciliophora y Nematoda, éste último ramificando con un miembro de las Chlorophytas (un alga verde filamentosa del género Oedogonium). Dentro de esta rama formando un agrupamiento cercano se encuentran miembros de los phyla Basidiomycota, Chytridiomycota, Zygomycota, Chlorophyta y un representante del grupo Basidiomycota.

Un segundo grupo de ramas incluye miembros de diferentes clases pertenecientes al phylum Ascomycota, y dentro de este subgrupo se localiza una subrama de la clase Dothideomycetes agrupado con miembros del phylum Basidiomycota. Esta rama del árbol a su vez se agrupa con un miembro del phylum Zygomicota, Absidia corymbifera. Este grupo de miembros de estos 3 phyla, Ascomycota, Zygomycota y Basidiomycota, a su vez es el que se encuentra más cercano filogenéticamente a la rama más divergente del árbol conformada por miembros de los phyla Glomeromycota y Chlorophyta.

La curva de rarefacción se calculó para OTUs de secuencias únicas y con diferencias del 3%, 6% y 10% (Fig. 7A). Para las muestras de procariotas puede observarse que la curva, tanto para secuencias únicas como para los diferentes niveles de diferencia entre las secuencias, no alcanza la fase de plateau, incluso a diferencias relativamente grandes del 10%, por lo tanto, los valores no se vuelven constantes, lo que indica que sería necesario un mayor número de secuencias para un análisis más completo de la diversidad del sitio muestreado. En la curva de rarefacción para eucariotas, la curva de secuencias únicas se observa casi lineal, mientras que para diferencias de 3%, 6% y 10% se vuelve casi paralela al eje de las X y no se observa mucha diferencia entre ellas, lo que indica que el número de secuencias obtenidas para la muestra de eucariotas es representativa de la diversidad de eucariotas de la rizosfera del jitomate (Fig. 7B).

Cuando se comparan las curvas de rarefacción para las muestras de procariotas (149 secuencias) y eucariotas (362 secuencias) para OTUs con un nivel de diferencia de las secuencias del 10%, se puede observar que la de procariotas es más elevada que la de eucariotas, lo que indica que la diversidad de procariotas en la rizosfera de tomate muestreada es mayor que la diversidad esperada de eucariotas (Fig. 8).

 

Discusión

Identificación de la diversidad de especies de origen procariota. El grupo más abundante en la biblioteca de ADN ribosomal de origen procariota fue el phylum Firmicutes, representando el 45% de todos los organismos secuenciados y analizados. La diversidad mostrada por este grupo fue también la más grande entre los phyla de origen procariota ya que está representada por 16 diferentes especies siendo los géneros Bacillus y Paenibacillus los más abundantes (48 clonas), representando el 39% del total de las secuencias analizadas (Cuadro 1). De Angelis et al.(2009), al estudiar la dinámica de las poblaciones bacterianas presentes en las distintas zonas de la raíz y del suelo, encontraron resultados concordantes con este trabajo y anotan que uno de los phyla más dinámicos y más representativos es el de los Firmicutes. Mendes et al. (2011), al estudiar el microbioma de un suelo supresivo de Rhizoctonia solani, a partir de muestras de rizosfera de remolacha, y empleando microarreglos (Phylochips) del 16S ADNr encontró que en esta rizosfera los Firmicutes junto con Proteobacteria son los phyla más abundantes. Esto difiere de lo que Kim et al. (2006) encontraron en un análisis de rizosfera de jitomate en Michenmyeon, Jinja, en la provincia de Gyeongsang, Corea del Sur, en el cual los phyla más abundantes fueron Proteobacteria (α–, β–, γ– y δ–) y Cytophaga–Flavobacterium–Bacteroides. La diferencia de los phyla registrados en ambos trabajos podría verse influenciada por el elevado porcentaje de materia orgánica presente en los suelos estudiados (>2.6%) el cual es mayor que el de los suelos del presente trabajo (1.37 ± 0.1%). Adicionalmente, el hecho de que se analizara un número menor de clonas sugiere que por probabilidad éstos sean los grupos más abundantes en la rizosfera de esta variedad de jitomate. Sin embargo, debe tomarse en cuenta que la diferencia puede estar influida por diferencias en el tipo de suelo, condiciones y manejo de los cultivos (Marilley y Arango, 1999; Papatheodorou et al., 2008), variedades empleadas, condiciones climatológicas y poblaciones microbianas endémicas en cada región edafogeográfica estudiada (Chiarini et al., 2005).

Los Firmicutes constituyen un grupo filogenético interesante por su potencial para ser empleados como agentes de biocontrol en hábitats tan alterados como las tierras de cultivo agrícola en Sinaloa. Algunos miembros de este phylum, como B. subtilis, B. licheniformis o B. amyloliquefaciens, se han registrado como antagonistas importantes de fitopatógenos de jitomate, como Botrytis cinerea (Lee et al 2006; Nagórska et al., 2007), Fusarium oxysporum, Pythium aphanidermatum (Nagorska et al., 2007) y Ralstonia solanacearum (Wei et al., 2011).

El interés de los autores del presente trabajo es aprovechar el potencial biotecnológico que presentan algunos de los grupos de microorganismos estudiados como es el caso específico de Bacillus, contra enfermedades que afectan los cultivos de mayor importancia económica en el estado de Sinaloa (SIAP, 2011). Actualmente se prueba su potencial como agentes de biocontrol de microorganismos aislados de la rizosfera de jitomate y maíz (Cordero–Ramírez et al., 2012) contra enfermedades de raíz y tallo, como son la pudrición de la corona de la raíz del jitomate (PCRT), la marchitez vascular en jitomate y la pudrición de raíz, tallo y mazorca en maíz. Paralelamente a este trabajo se creó un banco de 705 microorganismos aislados de una muestra compuesta derivada de rizosfera de jitomate. El 30% de estos aislados fueron probados in vitro contra Fusarium oxysporum f. sp. radicislycopersici (Forl), encontrándose que 27 de éstos, pertenecientes a los phyla Firmicutes y Proteobacteria, poseen capacidad de inhibición micelial a este fitopatógeno (Cordero–Ramírez et al., 2012). Así como también se evalúan antagonistas provenientes de rizosfera de maíz contra la pudrición de raíz, tallo y mazorca en maíz.

El segundo phylum en importancia fue el de Proteobacteria con el 14.7% (18 clonas), representado por miembros de los grupos α–, β–, γ– y δ–Proteobacteria, 3 de los 4 grupos previamente registrados como presentes en la rizosfera de jitomate (Kim et al., 2006), exceptuando el grupo de las P–Proteobacterias que no estuvo presente en este trabajo. Mendes et al. (2011), demostraron que el phylum Proteobacteria es el más abundante en la rizosfera de remolacha en un suelo supresivo para R. solani y que miembros del género Pseudomonas (Validov et al., 2009) desempeñan un papel importante en la supresión.

El tercer phylum en abundancia fue el de Gemmatimonadetes (13%); estas bacterias se detectan frecuentemente en muestras ambientales de bibliotecas de 16S ARNr y se han identificado como uno de los 9 phyla más encontrados en los suelos, comprendiendo casi el 2% de las comunidades bacterianas (Janssen, 2006). Estos estimados por secuenciación masiva (>500 secuencias) se han mantenido en 0.2 a 6.65% con un promedio de 2.2%. Es interesante que a pesar del bajo esfuerzo de secuenciación (122 clonas) un 13% de las clonas pertenezcan a este phylum muy por encima de los estimados en otros suelos. Su importancia es difícil de entender, dado lo poco que se conoce de este grupo en particular. A pesar de su frecuencia y persistente abundancia en suelos, de este phylum sólo se ha aislado y caracterizado Gemmatimonas auriantica cepa T–27, una bacteria acumuladora de polifosfato aislada de aguas de desecho (Zhang et al., 2003). Algunas otras cepas están registradas como aisladas pero aún no se han caracterizado. Su presencia está ligada a suelos áridos, sugiriendo una adaptación de este grupo bacteriano a ambientes de poca humedad, por lo que un ambiente edáfico como el persistente en Sinaloa explicaría su elevada abundancia, misma que parece no estar relacionada con el manejo del suelo, ya que en diferentes tipos de suelo, incluyendo agricultura convencional, orgánica, sucesión temprana y media, no existen diferencias en su abundancia (DeBruyn et al., 2011). Con base en la elevada abundancia de este grupo en la rizosfera del jitomate, el hallazgo de este trabajo resulta interesante, ya que comparado con otros estudios de suelo no rizosférico se puede sugerir que la población de estas bacterias aumenta en la zona rizosférica.

El cuarto phylum en importancia con el 11% de las clonas fue el de Actinobacteria representado por los géneros Patulibacter y Mycobacterium con 8 y 3 clonas de manera respectiva. De estos géneros se conoce muy poco acerca de su función en el suelo. Dentro del phylum Actinobac–teria, se encuentra el género Streptomyces conocido por la capacidad de sus miembros de producir un amplio espectro de compuestos antifúngicos (Bacon et al., 2001). Una formulación basada en Streptomyces sp. Di–944 aislada de rizosfera de tomate demostró ser tan efectiva como el fungicida comercial benzoato de oxina en invernadero para el control del damping–off, enfermedad producida por Rhizoctonia (Sabaratnam y Traquair, 2001); otros aislados, como Streptomyces spp. DAUFPE 11470 y DAUFPE 14632 son efectivos en el biocontrol e incidencia de la enfermedad causada por Fusarium moniliforme en maíz (Bressan et al., 2008). Aún cuando no se identificaron miembros de este género, resulta atractivo sugerir que este phyla, representado de manera abundante en la rizosfera del jitomate, pudiera estar involucrado en el control de fitopatógenos de origen fúngico en raíz.

El quinto phylum en importancia numérica, que representa el 10% de las clonas, fue el de Acidobacteria, del cual se conoce muy poco en cuanto a su función en la rizosfera (Kuske et al., 1997; Ludwig et al., 1997). Probablemente, la abundancia relativa de este grupo en las muestras de suelo estudiadas esté relacionada con la condición moderadamente ácida de los mismos (pH 5.8). Los miembros de este grupo filogenético no habían sido cultivados sino hasta muy recientemente (Kielak et al., 2009), en parte, por nuestro desconocimiento de los requerimientos necesarios para su cultivo en el laboratorio. Otros estudios donde se secuenciaron clonas de ARN y ADN ribosomal en suelos de cultivo muestran que este phylum se encuentra representado de manera abundante en la rizosfera (más del 50% de las clonas) y se sugiere que puede tener un papel metabólico muy activo y ser importante partícipe de los diferentes ciclos biogeoquímicos en el suelo (Lee et al., 2008).

Identificación de la diversidad de especies de origen eucariótico. El phylum Ascomycota fue el más abundante (59%) y también el más diverso con 27 especies registradas. Dentro de este phylum se encuentran 2 de los géneros mejor representados en este estudio, Alternaria y Emmonsia con 62 y 30 clonas, respectivamente (Cuadro 2). Las enfermedades causadas por Alternaria se encuentran entre las más comunes de muchos tipos de plantas en todo el mundo, en el jitomate afecta principalmente las hojas y los frutos (Agrios, 2005). En el género Alternaria, es importante el hecho de que la mayoría de sus especies sean principalmente saprofitas, es decir, no pueden infectar tejido vivo y sólo se desarrollan sobre tejido vegetal muerto en proceso de descomposición, o bien, sobre tejido viejo o senescente (Agrios, 2005), lo que coincide con el muestreo de suelo utilizado en este estudio, el cual se realizó en la etapa de senescencia del cultivo de jitomate; además, está documentado que dependiendo de la etapa fenológica de la planta, los metabolitos secretados cambian en su composición (Bais et al., 2006).

Un factor que sin duda repercute en la diversidad de las especies de Alternaria y en todos los grupos filogenéticos encontrados, sean de origen procariótico o eucariótico es que el campo muestreado fue utilizado para la siembra del jitomate aproximadamente durante 6 años consecutivos, por lo que las especies detectadas en la rizosfera debieron de ser producto de una selección propia del monocultivo. Otro patógeno dentro de este phylum de suma importancia en esta región agrícola de Sinaloa, es el de Fusarium, también detectado con 2 clonas pertenecientes a Fusarium sp. y 1 clona perteneciente a Forl, el cual es un patógeno que en los últimos años ha venido incrementando su incidencia y para el cual se han estudiado estrategias de biocontrol en laboratorio, las cuales pudieran ser más amigables con el medio ambiente, sin afectar la producción agrícola (datos no publicados).

Emmonsia, el otro género importante encontrado en Ascomycota, está representado por E. crescens y E. parva, especies que en realidad pertenecen a una sola, actualmente denominada Ajellomyces crescens Sigler 1996. El género Ajellomyces pertenece al orden de los Onygenales. Estos hongos son los agentes causales de la adiaspiromi–cosis, principal enfermedad respiratoria en ratones y en ocasiones en humanos (Peterson y Sigler, 1998) y está cercanamente relacionado con otros patógenos causantes de dermatitis en animales. Su función en la rizosfera no es clara. Otros géneros miembros de este orden: Chrysosporium y Eurotium fueron encontrados en este trabajo. Chrysosporium está conformado por especies de hongos saprofíticos degradadores de madera. Si este grupo de hongos, (4 clonas, 1.3%) tienen un papel similar, es algo que aún necesita elucidarse. En este phylum se encuentran también miembros del género Cladosporium al cual representan 2 especies identificadas como C. cladosporoides y C. oxysporum con 6 y 17 clonas de manera respectiva. Cladosporium es uno de los hongos imperfectos más comunes, que producen principalmente síntomas foliares en una amplia variedad de plantas hospederas, como el jitomate. Una de estas enfermedades es la de la mancha foliar del jitomate producida por C. fulvum (Agrios, 2005). Algunos miembros de este género se comportan como endófitos que producen ácido giberélico (Hamayun et al., 2009, Khan et al., 2008). En un aislado denominado Cladosporium sp. MH–6 se ha demostrado que posee la capacidad de producir ácido giberélico y actuar como un hongo promotor del crecimiento vegetal (Hamayun et al., 2010)

El segundo phylum eucariota de importancia en cuanto a abundancia, representando el 21% de las clonas, y el tercero en cuanto a diversidad fue el Chlorophyta, representado por 62 clonas y 6 distintas especies. Este phylum está representado por 3 especies de algas pertenecientes al género Scenedesmus: Scenedesmus sp. con 52 clonas, S. naegelii con 6 clonas, y S. obliquus, y por otras especies como Dunaliella sp , Oedogonium tenerum, Pseudochlorella pyrenoidosa y Chlorosarcinopsis, cada una con 1 clona. El alto número de clonas pertenecientes a este phylum representa un hallazgo interesante, pues generalmente las poblaciones de algas son menores que las de bacterias y hongos en los suelos (Pelczar, 1998). El elevado número de clonas del phylum Chlorophyta presentes en la biblioteca pudiera deberse a diversos factores: la proliferación de estos organismos en la superficie del suelo, el sistema de riego por goteo, asegurando una alta humedad en el suelo, lo cual, aunado a la alta irradiación solar de la región, pudo haber favorecido el crecimiento de estas poblaciones. El ambiente rizosférico es particularmente húmedo en cultivos de jitomate con irrigación por goteo. Este hecho aunado al gran número de algas y bacterias que es común encontrar en los emisores de los sistemas de irrigación por goteo, (Adin y Sacks, 1991; Dehghanisanij et al., 2004) pudiera explicar por qué se encuentra una elevada proporción de clonas pertenecientes a este grupo en particular. La naturaleza fotosintética de los miembros de este phylum influye para que predominen en la superficie del suelo o justamente debajo de la capa superficial, que fue la zona donde se tomó la muestra. En un suelo pobre en materia orgánica, la acumulación, crecimiento y actividad metabólica de las algas y bacterias iniciales facilitan el desarrollo de otras bacterias y hongos, y juegan un papel clave en las interacciones microrganismo–microrganismo que se requieren para transformar rocas a tierra (Pelczar, 1998). En suelos perturbados como lo son los de las zonas de cultivos y con niveles bajos de materia orgánica es posible que las algas desempeñen un papel ecológico importante en el establecimiento de otras poblaciones de microorganismos, favoreciendo finalmente el desarrollo vegetal.

El tercer phylum de importancia en cuanto a abundancia (12%) y segundo en cuanto a diversidad fue Basidiomycota con 14 diferentes especies distribuidas en 38 clonas. Dentro de este phylum se encontró una posible ectomicorriza como el representante más abundante (basidiomiceto micorrízico) con 11 clonas. Las ectomicorrizas forman asociaciones simbióticas importantes en ecosistemas boscosos (Frey–Klett et al., 2005) principalmente con árboles de importancia maderable. Su presencia en la rizosfera de jitomate pudiera sugerir una posible asociación con jitomate, la cual, aun cuando no está documentada, pudiera presentarse en sistemas agronómicos de monocultivo donde estos hongos no tuvieran más posibilidad de interacción que con la única especie vegetal presente, o bien, pudiera ser que su presencia sea artificial, pues para el cultivo de jitomate se utilizan estacones (tallos de otras especies vegetales empleadas para mantener erguida la planta), los cuales provienen de zonas serranas donde aún se puede encontrar vegetación nativa de tipo selva baja caducifolia. El organismo pudiera encontrarse como parte de la microbiota nativa que ha quedado en el suelo sobreviviendo saprofíticamente en los estacones. Las ectomicorrizas son importantes ya que permiten reclutar grupos de bacterias benéficas como las bacterias auxiliares de las micorrizas, las cuales estimulan el crecimiento micelial de estos hongos (Garbaye, 1994), esto incrementa la abundancia de microorganismos en el ambiente rizosférico favoreciendo el metabolismo de las comunidades microbianas en general. El espacio de suelo afectado por las hifas de estos hongos se conoce como la micosfera (Linderman, 1994), como analogía del término rizosfera. Un gran número de bacterias y hongos pueden estar asociados con las estructuras formadas por hongos ectomicorrízicos (Bedini et al., 1999; Frey–Klett et al., 2005) así como de hongos micorrízicos arbusculares (Budi et al., 1999), que también se detectaron en este trabajo.

El estudio de las comunidades microbianas en suelo es un tema poco estudiado en México (Souza et al., 2006; Marquez–Santacruz et al., 2010), por lo que desconocemos mucho de la diversidad y abundancia de las comunidades fúngicas y bacterianas presentes en nuestros suelos. Este estudio representa en México, el primer reporte de las comunidades tanto eucariotas como procariotas presentes en la rizosfera de jitomate. Además, se propone que pudiera servir como punto de comparación para contrastar las poblaciones presentes en rizosferas de otras solanáceas de interés comercial o con características similares a las de este estudio. En la actualidad, los datos aquí obtenidos se comparan con los de una solanácea (Datura stramonium, L.) presente en la única zona relictual que conserva la vegetación endémica de la región (selva baja caducifolia), para entender los cambios sufridos, no sólo por diferentes especies de solanáceas, sino en la diversidad de las comunidades fúngicas y bacterianas, comparando las poblaciones en suelos conservados con las de los que han sido severamente afectados por la agricultura intensiva que se desarrolla en esta zona del país (López–Rivera, datos no publicados). Conocer la distribución de estas comunidades y sus miembros permitirá elucidar cuál es la función de cada grupo dentro de un sistema complejo como la rizosfera, así como identificar aquellos que pudieran ser aprovechados para el desarrollo de nuevas estrategias de producción y control biológico encaminados a reducir la dependencia en el uso de los pesticidas (Lugtenberg et al., 2002; Smith et al., 1999; Mendes et al., 2011).

El estudio de las comunidades microbianas en zonas agrícolas y preservadas es de importancia para el control de las especies fitopatógenas y para la sustentabilidad en el uso del suelo. La diversidad y abundancia de hongos fitópatógenos del jitomate (Alternaria y Fusarium), así como la ausencia de detección de otros hongos comunes en el suelo (Penicillium y Trichoderma) pudiera deberse al tipo de muestreo empleado en este trabajo, ya que solamente se consideró el suelo fuertemente adherido a la raíz del jitomate (suelo rizosférico). En esa zona se crean microambientes con base en el tipo de compuestos presentes en los exudados de las raíces, lo que favorece el reclutamiento de cierto tipo de especies de algunos géneros, como pudiera ser el caso de Alternaria,y que no sucede en el suelo circundante a la rizosfera (bulk soil), fracción del suelo más heterogénea, y por consiguiente, que favorece la presencia de un mayor número de especies generalistas de hongos y bacterias.

En nuestro país, la diversidad de la microbiota del suelo ha sido estudiada principalmente de manera tradicional. Las técnicas tradicionales evalúan la diversidad mediante conteos directos en placas, con medios selectivos; sin embargo, a diferencia del trabajo con el ADN, esas técnicas presentan ciertas dificultades, como son: el sesgo ocasionado por favorecer solamente el crecimiento de cierto tipo de bacterias u hongos que se benefician por las características o componentes del medio; la dificultad que representa el separar las esporas del tejido vegetal; la capacidad de algunos microorganismos de formar biopelículas y permanecer fuertemente adheridos a las partículas de suelo o raíz (Tabacchioni et al., 2000); las condiciones de crecimiento (tales como temperatura, pH, luz, etc.); la incapacidad de cultivar un gran número de especies de hongos y bacterias con los medios que se tienen, y la inhibición de colonia a colonia por difusión en el medio de metabolitos (Trevors, 1998).

Además, con las técnicas de conteo en placa se favorece el conteo de microorganismos de rápido crecimiento, o bien, el de aquellos que producen una gran cantidad de esporas (Kirk et al., 2004). Por el contrario, el uso de técnicas moleculares, como la utilizada en este trabajo, permite la detección de microorganismos que no son fáciles de cultivar e, incluso, permite detectar grupos que no son cultivables (Buckley y Schmidt, 2003).

En el futuro cercano, el presente estudio servirá de punto de comparación entre zonas altamente afectadas en comunidades microbianas (como los suelos de Sinaloa por efecto de la actividad agrícola), con respecto a las de rizosferas en zonas preservadas. La perturbación de un suelo puede ser medida con base en la abundancia de las poblaciones presentes en éste, ya sea en una escala de tiempo o por efecto del manejo del mismo suelo (McCaig et al., 2001; Buckley y Schmidt, 2003). Actualmente, se estudia la zona de preservación de población, conocida como la Uva, del ejido La Cofradía en el municipio de Guasave, Sinaloa, única zona relictual que conserva la vegetación endémica de la región (selva baja caducifolia). Su riqueza y diversidad están siendo estudiadas y preservadas en la solanácea Datura stramonium, L. Existen esfuerzos para evitar la creación de nuevas tierras de cultivo y provocar la deforestación por parte de particulares. Además, se está organizando el ingreso de personas a la zona por medio de visitas guiadas y de esta manera promover la protección y conservación de la flora y fauna endémica.

Para determinar la eficiencia del muestreo, se realizaron curvas de rarefacción (Fig. 7). Se encontró que el esfuerzo para procariotas (149 secuencias) de la rizosfera de jitomate no representa toda la diversidad de procariotas presente en los sitio muestreados. Sin embargo, otros estudios en los que se emplearon bibliotecas de clonas de ADN ribosomal, microorganismos procariotas en ambientes naturales, con un número mayor de secuencias que en este estudio (con esfuerzos 3 a 5 veces mayores), coinciden en que en el análisis de rarefacción, la curva no alcanza una fase de plateau, lo que indica una gran complejidad de la diversidad de procariotas en ambientes naturales tan complejos como el suelo, sedimentos y ambientes marinos (Sogin et al., 2006; Lasher et al., 2009; Peressutti, 2010). Por otro lado, con la curva de rarefacción para eucariotas se pudo determinar que el número de secuencias obtenidas para eucariotas (362) (Fig. 8) sí es representativo de la diversidad de eucariotas de la rizosfera de jitomate muestreada, e indicando, con base en la comparación de la diversidad de OTUs obtenida entre las curvas de rarefacción para las 2 muestras en un nivel de diferencia del 10%, que la diversidad de los eucariotas es menor que la de la microbiota procariota.

En una zona agrícola, como la del norte de Sinaloa, con un elevado potencial en la producción de cultivos de interés comercial, incluyendo el jitomate, resulta importante conocer la distribución, abundancia e identidad de los microorganismos presentes en la rizosfera para tratar de establecer medidas para su aprovechamiento y manejo integral en el control de enfermedades y diversos usos biotecnológicos.

En conclusión, los métodos moleculares, como los empleados en este estudio, ofrecen una buena herramienta en el estudio de la diversidad y abundancia de las comunidades microbianas de la rizosfera del jitomate. El phylum Ascomycota fue el más abundante de la biblioteca eucariota con el género Alternaria como el más abundante, esto pudo ser favorecido por el largo periodo (más de 10 años) durante el cual se ha llevado a cabo la siembra del jitomate de manera reiterativa en el sitio muestreado. El phylum Firmicutes fue el más abundante de la biblioteca procariota con el género Bacillus el cual tiene la capacidad de producir endosporas y de esta manera asegura su alta incidencia en los suelos favorecido por su persistencia en condiciones adversas, además posee una rápida capacidad de crecimiento en condiciones favorables, lo cual probablemente le permite establecerse y desplazar efectivamente a miembros de otros géneros.

 

Agradecimientos

Este estudio fue financiado por Fundación Produce Sinaloa (2005–2006), el Instituto Politécnico Nacional (IPI; SIP 20060317, SIP 20091542), y CECyT Sinaloa 2006 y 2009. Jesús Damián Cordero–Ramírez , Alejandro Miguel Figueroa–López y Raquel López Rivera han sido becarios del programa PIFI del IPN y de CONACYT; Jesús Damián Cordero–Ramírez del posgrado del IPN. Los autores agradecen los valiosos comentarios al presente manuscrito de la Dra. Teresa Leticia Espinosa Carreón y de Melina López Meyer de los Departamentos de Medio Ambiente y de Biotecnología Agrícola, respectivamente, del CIIDIR–IPN Unidad Sinaloa.

 

Literatura citada

Acinas, S. G. 2007. Diversidad y estructura de una comunidad microbiana. Actualidad SEM – Boletín Informativo de la Sociedad Española de Microbiología 44:24–9.         [ Links ]

Adin, A. y M. Sacks.1991. Dripper clogging factors in wastewater irrigation (Abstract). Journal of Irrigation and Drainage Division, ASCE. 117:813–825.         [ Links ]

Agrios, G. N. 2005. Plant Pathology. Fifth Edition. Academic Press, San Diego, California. 952 p.         [ Links ]

Bacon, C. W., I. E. Yates, D. M. Hilton y F. Meredith. 2001. Biological control of Fusarium moniliforme in maize. Environmental Health Perspectives 109:325–332.         [ Links ]

Bais, H. P., T. L. Weir, L. G. Perry, S. Gilroy y J. M. Vivanco. 2006. The role of root exudates in rhizosphere interactions with plants and other organisms. Annual Review of Plant Biology 57:233–266.         [ Links ]

Bedini, S., G. Bagnoli, C, Sbrana, C. Leporini, E. Tola, C. Dunne, C. Filippi, F. D'Andrea, F. O'Gara y M. P. Nuti. 1999. Pseudomonads isolated from within fruit bodies of Tuber borchii are capable of producing biological control or phytostimulatory compounds in pure culture. Symbiosis 26:223–236.         [ Links ]

Boyer, S. L., V. R. Flechtner y J. R. Johansen. 2001. Is the 16S–23S rRNA internal transcribed spacer region a good tool for use in molecular systematics and population genetics? A case study in Cyanobacteria. Molecular Biology and Evolution 18:1057–1069.         [ Links ]

Bressan, W. y J. E. Fontes–Figueiredo. 2008. Efficacy and dose–response relationship in biocontrol of Fusarium disease in maize by Streptomyces spp. European Journal of Plant Pathology 120:311–316.         [ Links ]

Buckley, D. H. y T. M. Schmidt. 2003. Diversity and dynamics of microbial communities in soils from agro–ecosystems. Environmental Microbiology 5:441–452.         [ Links ]

Budi S.W., D. Van Tuinen, G. Martinotti y S. Gianinazzi. 1999. Isolation from Sorghum bicolor mycorrhizosphere of a bacterium compatible with arbuscular mycorrhiza development and antagonistic towards soil–borne fungal pathogens. Applied and Environmental Microbiology 65:5148–5150.         [ Links ]

Cordero–Ramírez, J. D., R. López–Rivera, A. M. Figueroa–Lopez, M. E. Mancera–López, J. C. Martínez–Álvarez, M. A. Apodaca–Sánchez e I. E. Maldonado–Mendoza. 2012. Native soil bacteria isolates in Mexico exhibit a promising antagonistic effect against Fusarium oxysporum f. sp. radicis lycopersici. Journal of Basic Microbiology 52:1–10.         [ Links ]

Chiarini, L., A. Bevivino, C. Dalmastri, C. Nacamulli y S. Tabacchioni. 2005. Influence of plant development, cultivar and soil type on microbial colonization of maize roots. Applied Soil Ecology 8:11–18.         [ Links ]

De Angelis, K. M., E. L. Brodie, T. Z. DeSantis, G. L. Andersen, S. E. Lindow y M. K. Firestone. 2009. Selective progressive response of soil microbial community to wild oat roots. The ISME Journal 3:168–178.         [ Links ]

Dehghanisanij, H., T. Yamamoto, V. Rasiah, J. Utsunomiya y M. Inous. 2004. Impact of biological clogging agents on filter and emitter discharge characteristics of microirrigation systems (Abstract). Irrigation and Drainage 53:363–373.         [ Links ]

Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792–1797.         [ Links ]

Ewing, B., L. D. Hillier, M. C. Wendl y P. Green. 1998a. Base–Calling of Automated Sequencer Traces Using Phred. I. Accuracy Assessment. Genome Research 8:175–185.         [ Links ]

Ewing, B. y P. Green. 1998b. Base–calling of automated sequencer traces using phred. II. Error probabilities. Genome Research 8:186–194.         [ Links ]

Felsenstein, J. 2009. PHYLIP (Phylogeny inference package) ver. 3.6. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle.         [ Links ]

Frey–Klett, P., M. Chavatte, M. L. Clausse, S. Courrier, C. Le Roux, J. Raaijmakers, M. G. Martinotti, J. C. Pierrat y J. Garbaye. 2005. Ectomycorrhizal symbiosis affects functional diversity of rhizosphere fluorescent pseudomonads. New Phytologist 165:317–328.         [ Links ]

Garbaye, J. 1994. Helper bacteria: a new dimension to the mycorrhizal symbiosis. New Phytologist 128:197–10.         [ Links ]

Handelsman, J. 2004. Metagenomics: application of genomics to uncultured microorganisms. Microbiology and Molecular Biology Reviews. 68:669–685.         [ Links ]

Hass, B. J., D. Gevers, A. Earl, M. Feldgarden, D. V. Ward, G. Giannokous, D. Ciulla, D. Tabaa, S. K. Highlander, E. Sodergren, B. Methe, T. Z. Desantis, J. F. Petrosino, R. Knight y B. W. Birren. 2011. Chimeric 16S rRNA sequence formation and detection in sanger and 454–pyrosequenced PCR amplicons. Genome Research 21:494–504.         [ Links ]

Higgins D., J. Thompson, T. Gibson, J. D. Thompson, D. G. Higgins y T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position–specific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673–4680.         [ Links ]

Kielak, A., A. S. Pijl, J. A. van Veen y G. A. Kowalchuk. 2009. Phylogenetic diversity of Acidobacteria in a former agricultural soil. The International Society for Microbial Ecology Journal 3:378–382.         [ Links ]

Kim, J. S., R. S. Dungan, S. W. Kwon y H. Y. Weon. 2006. The community composition of root–associated bacteria of the tomato plant. World Journal of Microbiology and Biotechnology 22:1267–1273.         [ Links ]

Kirk, J. L., L. A. Beaudette, M. Hart, P. Moutoglis, J. N. Klironomos, H. Lee y J. T. Trevors. 2004. Methods of studying soil microbial diversity. Journal of Microbiological Methods 58:169–188.         [ Links ]

Kuske, C. R., S. M. Barns y J. D. Busch. 1997. Diverse uncultivated bacterial from soils of the arid southwestern united states that are present in many geographic regions. Applied and Environmental Microbiology 63:3614–3621.         [ Links ]

Lasher, C., G. Dyszynski, K. Everett, J. Edmonds, W. Ye, W. Sheldon, S. Wang, S. B. Joye, A. M. Moran y W. B. Whitman. 2009. The diverse bacterial community in intertidal, anaerobic sediments at Sapelo Island, Georgia. Microbial Ecology 58:244–261.         [ Links ]

Lee, J. P., S. W. Lee, C. S. Kim, J. H. Son, J. H. Song, K. Y Lee, H. J. Kim, S. J. Jung y B. J. Moon. 2006. Evaluation of formulations of Bacillus licheniformis for the biological control of tomato gray mold caused by Botrytis cinerea. Biological control 37:329–337.         [ Links ]

Lee, S. H., J. O. Ka y J. C. Cho. 2008. Members of the phylum Acidobacteria are dominant 63–and metabolically active in rhizosphere soil. FEMS Microbiology Letters 285:2269.         [ Links ]

Linderman, R. G. 1994. Role of VAM fungi in biocontrol. In Mycorrhizae and plant health. F. L. Pfleger y R. G. Linderman (eds.). APS, St Paul, Minnesota. p. 360        [ Links ]

Liu, J., I. E. Maldonado–Mendoza, M. López–Meyer, F. Cheung, D. C. Town y J. M. Harrison. 2007. Arbuscular mycorrhizal symbiosis is accompanied by local and systemic alterations in gene expression and increase in disease resistance in the shoots. The Plant Journal 50:529–544.         [ Links ]

Lu, J. J., C. L. Perng, S. Y. Lee y C. C. Wan. 2000. Use of PCR with universal primers and restriction endonuclease digestions for detection and identification of common bacterial pathogens in cerebrospinal fluid. Journal of Clinical Microbiology 38:2076–2080.         [ Links ]

Ludwig, W., S. H. Bauer, M. Bauer, I. Held, G. Kirchhoff, R. Schulze, I. Huber, S. Spring, A. Hartmann y K. H. Schleifer. 1997. Detection and in situ identification of representatives of a widely distributed new bacterial phylum. FEMS Microbiology Letters 153:181–190.         [ Links ]

Lugtenberg, B. J. J., T. F. C. Chin–A–Woeng y G. V. Bloemberg. 2002. Microbe–plant interactions: principles and mechanisms. Antonie van Leeuwenhoek 81:373–383.         [ Links ]

McCaig, A. E., L. A. Glover y J. I. Prosser. 2001. Numerical analysis of grassland bacterial community structure under different land management regimens by using 16S ribosomal ADN sequence data and denaturing gradient gel electrophoresis banding patterns. Applied and Environmental Microbiology 67:4554–4559.         [ Links ]

Maldonado–Mendoza, I. E., H. Galindo–Flores y M. López–Meyer. 2009. An introduction to metagenomics. In Molecular biotechnology, A. K. Chauhan y A. Varma (eds.). I.K. International Publishing House Pvt. Ltd., New Delhi. p. 319–341.         [ Links ]

Márquez–Santacruz, H. A., R. Hernández–León, M. C. Orozco–Mosqueda, I. Velázquez–Sepúlveda y G. Santoyo. 2010. Diversity of bacterial endophytes in roots of Mexican husk tomato plants (Physalis ixocarpa) and their detection in the rhizosphere. Genetics and Molecular Research 9:2372-2380.         [ Links ]

Marilley, L. y M. Arango. 1999. Phylogenetic diversity of bacterial communities differing in degree of proximity of Lolium perenne and Trifolium repens roots. Applied Soil Ecology 13:127–136.         [ Links ]

Mendes, R., M. Kruijt, I. Bruijn, E. Dekkers, M. van der Voort, J. H. M. Schneider, Y. M. Piceno, T. Z. DeSantis, G. L. Andersen, P. A. H. M. Bakker y M. Raaijmakers. 2011. Deciphering the rhizosphere microbiome for disease–suppressive bacteria. Science 332:1097–1100.         [ Links ]

Nagórska, K., M. Bikowski y M. Obuchowski. 2007. Multicellular behaviour and production of a wide variety of toxic substances support usage of Bacillus subtilis as a powerful biocontrol agent. Acta Biochimica Polonica 54:495–508.         [ Links ]

O'Brien, H. E., J. L. Parrent, J. A. Jackson, J. M. Moncalvo y R. Vilgalys. 2005. Fungal community analysis by large–scale sequencing of enviromental samples. Applied and Environmental Microbiology 71:5544–5550.         [ Links ]

Papatheodorou, E. M., E. Efthimiadou y G. P. Stamou. 2008. Functional diversity of soil bacteria as affected by management practices and phenological stage of Phaseolus vulgaris. European Journal of Soil Biology 44:429–436.         [ Links ]

Pelczar, M. J., E. C. S. Chan y R. D. Reid. 1998. Microbiology, quinta edición. McGraw–Hill, Baton Rouge, Louisiana. 826 p.         [ Links ]

Peressutti S. R., M. Costagliola, L. F. Artigas y C. Hozbor. 2010. Estudio comparativo de la estructura del bacterioplancton en aguas del mar Argentino mediante el método de pirosecuenciación 454 tag. Revista Argentina de Microbiología 42:288–297.         [ Links ]

Peterson, S. W. y L. Sigler. 1998. Molecular genetic variation in Emmonsia crescens and Emmonsiaparva, ethiologic agents of adiaspiromycosis, and their phylogenetic relationship to Blastomyces dermatiditis (Ajellomyces dermatitidis) and other systemic fungal pathogens. Journal of Clinical Microbiology 30:2918–2925.         [ Links ]

Rajendhran, J. y P. Gunasekaran. 2008. Strategies for accessing soil metagenome for desired applications. Biotechnology Advances 26:576–590.         [ Links ]

Rappe, M. S. y S. J. Giovannoni. 2003 The uncultured microbial majority. Annual Review of Microbiology 57:369–394.         [ Links ]

Sabaratnam, S. y J. A. Traquair. 2001. Formulation of Streptomyces biocontrol agent for the suppression of Rhizoctonia damping–off in tomato transplants. Biological Control 23:245–253.         [ Links ]

Saitou N. y M. Nei. (1987) The neighbor–joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406–425.         [ Links ]

Schloss, P. D., S. L. Westcott, T. Ryabin, J. R. Hall, M. Hartmann, E. B. Hollister, R. A. Lesniewski, B. B. Oakley, D. H. Parks, C. J. Robinson, J. W. Sahl, B. Stres, G. G. Thallinger, D. J. Van Horn y C. F. Weder. 2009. Introducing mothur: open–source, platform–independent, community–supported software for describing and comparing microbial communities. Applied and Environmental Microbiology 75:7537–41.         [ Links ]

Sessitsch, A., A.Weilharter, M. H. Gerzabek, H. Kirchmann y E. Kandeler. 2001. Microbial population structures in soil particle size fractions of a long–term fertilizer field experiment. Applied and Enviromental Microbiology 67:4215–4224.         [ Links ]

SIAP (Servicio de Información Agroalimentaria y Pesquera). Anuario estadístico. Sistema producto tomate. Datos de producción anual. Secretaría de Agricultura Ganadería, Desarrollo Rural, Pesca y Alimentación, México, D. F. 2009. http://www.siap.gob.mx/; última consulta: 10.I.2012.         [ Links ]

Smith, K. P., J. Handelsman y R. M. Goodman. 1999. Genetic basis in plants for interactions with disease. Proceedings of National Academy of Sciences of the United States of America 96:4786–4790.         [ Links ]

Sogin, M. L., H. G. Morrison, J. A. Huber, D. M. Welch, S. M. Huse, P. R. Neal, J. M. Arrieta y G. J. Herndl. 2006. Microbial diversity in the deep sea and the underexplored ''rare biosphere''. Proceedings of the National Academy of Sciences of the United States ofAmerica 103:12115–12120.         [ Links ]

Souza, V., L. Espinoza–Asuar, A. E. Escalante, L. E. Eguiarte, J. Farmer, L. Forney, L. Lloret, J. M. Rodríguez–Martínez, X. Soberón, R. Dirzo y J. Elser. 2006. An endangered oasis of aquatic microbial biodiversity in the Chihuahuan desert. Proceedings of the National Academy of Sciences of the United States ofAmerica 103:6565–6570.         [ Links ]

Tamura K., D. Peterson, N. Peterson, G. Stecher, M. Nei y S. Kumar. 2011. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28:2731–2739.         [ Links ]

Tabacchioni, S., L. Chiarini, A. Bevivino, C. Cantale y C. Dalmastri. 2000. Bias caused by using different isolation media for assessing the genetic diversity of a natural microbial population. Microbial Ecology 40:169–176.         [ Links ]

Torsvik, V., J. Goksoyr y F. L. Daae. 1990. High diversity in DNA of soil bacteria. Applied Environmental Microbiology 56:782–787.         [ Links ]

Trevors, J.T. 1998. Bacterial biodiversity in soil with an emphasis on chemically contaminated soils. Water Air Soil Pollution 101:45–67.         [ Links ]

Validov, S. Z., F. Kamilova y B. J. J. Lugtenberg. 2009. Pseudomonas putida strain PCL1760 control tomato foot and root rot in stonewool under industrial conditions in a certified greenhouse. Biological Control 48:6–11.         [ Links ]

van Elsas, J. D., R. Costa, J. Jansson, S. Sjoling, M. Bailey., R. Nalin, T. M. Vogel y L. van Overbeek. 2008. The metagenomics of disease–suppressive soils– experiences from the Metacontrol project. Trends in Biotechnology 26:591–601.         [ Links ]

Wei, Z., X. Yang, S. Yin, Q. Shen, W. Ran y Y. Xu. 2011. Efficacy of Bacillus–fortified organic fertiliser in controlling bacterial wilt of tomato in the field. Applied Soil Ecology 48:152–159.         [ Links ]

Wheeler, D. L., C. Chappey, A. E. Lash, D. D. Leipe, T. L. Madden, G. D. Schuler, T. A. Tatusova y B. A. Rapp. 2000. Database resources of the National Center for Biotechnology Information. Nucleic Acids Research 28:10–14.         [ Links ]

White, T. J., T. Bruns, S. Lee y J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR protocols: a guide to methods and applications, M. A. Innis, D. H. Gelfand, J. J. Sninsky y T. J. White (eds.). Academic, San Diego, California. p. 315–322.         [ Links ]

Zhang, H., Y. Sekiguchi, S. Hanada, P. Hugenholtz, H. Kim, Y. Kamagata y K. Nakamura. 2003. Gemmatimonas aurantiaca gen. nov., sp. nov., a gram–negative, aerobic, polyphosphate–accumulating microorganism, the first cultured representative of the new bacterial phylum Gemmatimonadetes phyl. nov. International Journal of Systematic and Evolutionary Microbiology 53:1155–1163.         [ Links ]

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons