Mi SciELO
Servicios Personalizados
Artículo
Indicadores
Citado por SciELO
Accesos
Links relacionados
Similares en SciELO
Bookmark
Revista mexicana de biodiversidad
versión impresa ISSN 1870-3453
Rev. Mex. Biodiv. v.80 n.3 México dic. 2009
Nota científica
Morphological and molecular identification of Gnathostoma binucleatum (Nematoda: Gnathostomatidae) advanced third stage larvae (AdvL3) in the state of Colima, Mexico
Determinación morfológica y molecular de larvas del tercer estadio larvario (L3A) de Gnathostoma binucleatum (Nematoda: Gnathostomatidae) del estado de Colima, México
Luis Jorge GarcíaMárquez1, Rafael LamotheArgumedo2, David OsorioSarabia2, Luis GarcíaPrieto2 and Virginia LeónRègagnon3,*
1 Centro Universitario de Investigación y Desarrollo Agropecuario (CUIDA), Universidad de Colima, Av. Universidad #333 Col. de las Víboras 28040, Colima, México.
2 Laboratorio de Helmintología, Instituto de Biología, Universidad Nacional Autónoma de México. Apartado postal 70153, 04510, México, D.F.
3 Estación de Biología Chamela, Instituto de Biología, Universidad Nacional Autónoma de México. Apartado postal 21, 48980, San Patricio, Jalisco, México.
* Correspondent:
vleon@ibiologia.unam.mx
Recibido: 29 septiembre 2008
Aceptado: 20 febrero 2009
Abstract
As a part of an ongoing project to understand the current distribution of Gnathostoma species in Mexico, 22 species of vertebrates were examined for this nematode in the state of Colima. The fish species Dormitator latifrons ("chococo") and Sciades guatemalensis ("cuatete") from Cuyutlán Lagoon and the reptile Crocodylus acutus from the Amela Lagoon were positive for infection. Morphometric characteristics of the larvae collected in Colima were similar to those of G. binucleatum larvae collected from other regions and host species in Mexico. The low divergence of the ITS sequence obtained in this study from that of G. binucleatum (0.19%) indicates that our material belongs to this species. This is the first record of the AdvL3 of G. binucleatum in Colima, the tenth state in Mexico in which this species has been recorded in wild vertebrates.
Key words: gnathostomiasis, morphometrics, DNA sequences, ITS2, rDNA.
Resumen
Como parte de un proyecto para definir la distribución actual de las especies de Gnathostoma en México, examinamos 22 especies de vertebrados en el estado de Colima en busca de este nematodo. Las especies de peces Dormitator latifrons ("chococo") y Sciades guatemalensis ("cuatete") de la laguna de Cuyutlán y el reptil Crocodylus acutus de la laguna de Amela resultaron positivos a la infección. Las características morfométricas de las larvas encontradas en Colima son similares a las de las larvas de G. binucleatum recolectadas en otras regiones y especies de hospederos en México. La escasa divergencia entre las secuencias del ITS obtenidas en este estudio con aquella de G. binucleatum (0.19%) indica que nuestro material pertenece a esta especie. Este es el primer registro de la L3A de G. binucleatum en Colima, siendo éste el décimo estado en México en donde se ha registrado a esta especie en vertebrados silvestres.
Palabras clave: gnathostomiasis, morfometría, secuencias de ADN, ITS2, ADNr.
Three species of the genus Gnathostoma, Gnathostoma binucleatum AlmeydaArtigas, 1991, G. lamothei BertoniRuiz, GarcíaPrieto, OsorioSarabia and LeónRègagnon, 2005, and G. turgidum Stossich, 1902, have been recorded in Mexico (BertoniRuiz et al., 2005). However, knowledge of their geographic distribution is far from complete. To date, species of Gnathostoma have been observed parasitizing wild vertebrates in 82 localities in 14 states of Mexico (Pérez et al., 2008).
As a part of an ongoing project to establish the extent of the current distribution of Gnathostoma species in Mexico, we present the results of sampling wild vertebrates (fishes, amphibians, reptiles, and birds) in Colima state on the Pacific slope of Mexico. Likewise, we identify and describe the advanced third stage larvae (A3L) of G. binucleatum through morphological and molecular studies.
Between February 2001 and October 2007, several species of wild vertebrates were collected in 2 localities of Colima state, Mexico: Amela Lagoon (18°50'20"N, 103° 46'20"W) and Cuyutlán Lagoon (18°57'00"N, 103°57'00"W).
Fish were caught with seine nets, amphibians and reptiles were caught manually, and birds were shot by local hunters. Amphibians and reptiles were killed by an overdose of sodium pentobarbital. Host muscle was ground individually, compressed between 2 glass plates, and examined with the aid of a magnifying glass. Some larvae were fixed in hot 70% ethanol for morphometric study, cleared in Amann's lactophenol, and measured under a compound microscope. Means are expressed in mm, ranges are shown in parentheses. Other larvae were fixed in 100% ethanol for molecular analysis. Voucher specimens were deposited in the Colección Nacional de Helmintos (CNHE: 4813, 4814), Instituto de Biología, Universidad Nacional Autónoma de México (UNAM), México City.
Standard phenolchloroform extraction methods were used to recover DNA from the specimens. Laboratory protocols follow Palumbi (1996) and Hillis et al. (1996). The polymerase chain reaction (PCR) was used for amplifying the DNA sample; the parameters and settings followed manufacturer's recommendations and Palumbi (1996). Amplification and sequencing of the Internal Transcribed Spacer 2 (ITS2) of the ribosomal DNA was performed using the primers NEWS2 (forward) 5'TGTGTCGATGAAGAACGCAG and ITS2RIXO (reverse) 5'TTCTATGCTTAAATTCAGGGG (AlmeydaArtigas et al., 2000). The amplification conditions consisted of 1 min denaturation at 94° C, then 35 cycles of 30 sec at 92° C, 30 sec at 50° C, and 1 min at 72° C, followed by 4 min at 72° C for the final elongation. PCR products were sequenced directly on an ABI Prism 310 automated DNA sequencer. The obtained sequence (Genbank accession number FJ497054) was aligned with available sequences from American species of Gnathostoma: G. binucleatum (AY061741), G. lamothei (AY818004), G. miyazakii (FJ497055), and G. turgidum (Z97175) using the computer program ClustalW (Thompson et al., 1994), and a pairwise distance matrix was obtained using the computer program Bioedit (Hall, 2001). Gnathostoma spinigerum (AB181155) was also included in this comparison due to its morphological resemblance with G. binucleatum in the larval stage.
Twentytwo species of vertebrates, including 15 fish species, 2 amphibian species, 2 reptile species, and 3 bird species, were examined for Gnathostoma (Appendix 1). Three AdvL3 of Gnathostoma sp. were found in the skeletal muscle of 1 fish specimen, Dormitator latifrons ("chococo"), and 5 were found in 1 specimen of Sciades guatemalensis ("cuatete"); both specimens were from the Cuyutlán Lagoon. One specimen of Crocodylus acutus from the Amela Lagoon was infected with 4 larvae. All amphibians and birds were negative for infection (Appendix 1). Collected larvae were morphologically indistinguishable. Mean body length was 3.13 (3.123.14), maximum width 0.32 (0.310.32); cephalic bulb length 0.12 (0.110.13), width 0.24 (0.230.25); lip length 0.025 (0.0240.026), width 0.083 (0.0820.084); esophagus length 1.22 (1.221.23), width 0.20 (0.190.21); cervical sac length 0.7 (0.60.8), and width 0.087 (0.0850.088). The number of hooklet rows on the cephalic bulb and body, as well as the location of the cervical papilla and excretory pore, are listed in Table 1. We compared the morphometric characteristics of our larvae with G. binucleatum from other localities, G. procyonis and G. turgidum (the other American species for which larvae have been described) and G. spinigerum (originally confused with G. binucleatum in Mexico) (Table 1).
The morphometric characteristics of the Gnathostoma larvae collected in Colima are similar to those of G. binucleatum larvae collected from other regions and host species in Mexico, although they differ markedly from those of G. procyonis and G. spinigerum (Table 1). The minimum differences in the number of hooklets in the cephalic bulb, as well as the position of the cervical papillae, fall within the variation registered for the species (Akahane et al., 1994; Almeyda et al., 1994; Kifune et al., 2004; MartínezSalazar and LeónRègagnon, 2005).
One larva collected from S. guatemalensis was processed for DNA extraction. Analysis of the amplified ITS2 sequence showed 0.19% divergence with G. binucleatum, whereas the divergence with all other species was greater than 14.04% (Table 2). The low divergence of the obtained ITS sequence with that of G. binucleatum corresponds to intraspecific variation levels recorded previously for this species (AlmeydaArtigas et al., 2000; Kifune et al., 2004; LeónRègagnon et al., 2002; MartínezSalazar and LeónRègagnon, 2005), providing extra support for the morphological data.
This is the first record of the AdvL3 of G. binucleatum in Colima state, the tenth state in Mexico in which this species has been recorded in wild vertebrates (Pérez et al., 2008). Species of the fish families Eleotridae and Ariidae have been reported as etiological agents of human infections in the neighboring states of Guerrero, Nayarit, and Sinaloa (Álvarez and Alba, 2007; DíazCamacho et al., 2008; LeónRègagnon et al., 2000, 2002).
The fish species reported as intermediate hosts in this study (Dormitator latifrons and Sciades guatemalensis) belong to the Eleotridae and Ariidae families, indicating that there is a potential zoonotic problem in Colima as well. These fish species are occasionally consumed in the form of ceviche (raw fish meat with lime juice), making this dish a potential source of infection.
The presence of Adv3L in muscles of C. acutus is accidental. This host acquires the infection through the ingestion of parasitized fish; the position of crocodiles at the top of the food chain indicates that this infection represents a deadend in the life cycle of this nematode species, especially since crocodile meat is not eaten by people locally.
Our results clearly show that G. binucleatum is endemic to the state of Colima. Although no human cases of gnathostomosis have ever been reported in Colima (PerezÁlvarez et al., 2008), the risk of gnathostomosis through the ingestion of raw or undercooked fish should be extensively disseminated among the residents in this region to prevent human infection.
Acknowledgements
We thank Florencia Bertoni, Elizabeth Martínez, Rosario Mata, and Alejandro Oceguera for their help in field work and Laura Márquez Valdelamar for her help in the sequencing of samples. This study was partially supported by PAPIIT IN221307 to VLR and RLA.
Literature cited
Akahane, H., R. LamotheArgumedo, J. M. Martínez, D. OsorioSarabia and L. GarcíaPrieto. 1994. A morphological observation or the advanced thirdstage larvae of Mexican Gnathostoma. Japanese Journal of Parasitology 43:1822. [ Links ]
AlmeydaArtigas, R. J. 1991. Hallazgo de Gnathostoma binucleatum (Nematoda: Spirurida) en felinos silvestres y el papel de peces dulceacuículas y oligohalinos como vectores de la gnatostomiasis humana en la cuenca baja del río Papaloapan, Oaxaca Veracruz, México. Anales del Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México 18:137155. [ Links ]
AlmeydaArtigas, R. J., V. A. AcostaHernández, L. AlonzoDíaz, M. CastañedaSánchez and V. R. ZárateRamírez. 1994. First record of Gnathostoma procyonis Chandler, 1942 in Mexico, and a note on larval G. binucleatum AlmeydaArtigas, 1991 (Nematoda: Spirurida). Research and Reviews in Parasitology 54:9398. [ Links ]
AlmeydaArtigas R., D. M. Bargues and S. MasComa. 2000. ITS2 rDNA sequencing of Gnathostoma species (Nematoda) and elucidation of the species causing gnathostomiasis in the Americas. Journal of Parasitology 86:357544. [ Links ]
Álvarez, G. C. and H. F. Alba. 2007. Estuarine fish and turtles as intermediate and paratenic hosts of Gnathostoma binucleatum in Nayarit, Mexico. Parasitology Research 102:117122. [ Links ]
Ash, L. 1962. Development of Gnathostoma procyonis Chandler 1942, in the first and second intermediate host. Journal of Parasitology 48:298305. [ Links ]
BertoniRuiz, F., L. GarcíaPrieto, D. OsorioSarabia and V. LeónRègagnon. 2005. A new species of Gnathostoma (Nematoda: Gnathostomidae) in Procyon lotor hernandezii from Mexico. Journal of Parasitology 91:11431149. [ Links ]
DíazCamacho, S. P., M. C. CruzOtero, M. L. ZazuetaRamos, A. BojórquezContreras, J. SicairosFélix, S. CampistaLeón, R. GuzmánLoreto, F. DelgadoVargas, V. LeónRègagnon and Y. Nawa. 2008. Identification of estuarine fish Dormitator latifrons as an intermediate host and Eleotris picta as a paratenic host for Gnathostoma binucleatum in Sinaloa, Mexico. Parasitology Research 103:14211425. [ Links ]
Hillis, D.C., C. Mortiz and B. K. Mable. 1996. Molecular Systematics. Sinauer Associates, In. Publishers. Sunderland, Massachussets, 665 p. [ Links ]
Hall, T. 2001. Bioedit, version 5.0.6. North Carolina State University, Department of Microbiology, Raleigh, North Carolina, 192 p. [ Links ]
Kifune, T., R. LamotheArgumedo, L. GarcíaPrieto, A. OcegueraFigueroa and V. LeónRègagnon. 2004. Gnathostoma binucleatum (Spirurida: Gnathostomatidae) en peces dulceacuícolas de Tabasco, México. Revista de Biología Tropical 52: 371376. [ Links ]
LeónRègagnon, V., L. GarcíaPrieto, D. OsorioSarabia and A. JiménezRuiz. 2000. Gnatostomiasis in fish from Tres Palos Lagoon, Guerrero, Mexico. Emerging Infectious Diseases 6:429430. [ Links ]
LeónRègagnon, V., D. OsorioSarabia, L. GarcíaPrieto, H. Akahane, R. LamotheArgumedo, M. Koga, M. MessinaRobles and C. Álvarez. 2002. Study of the etiological agent of gnathostomosis in Nayarit, Mexico. Parasitology International 51:201204. [ Links ]
MartínezSalazar, E. and V. LeónRègagnon. 2005. Confirmation of Gnathostoma binucleatum AlmeydaArtigas, 1991, Advanced thirdstage larvae in Tres Palos lagoon, Mexico, by morphological and molecular data. Journal Parasitology 9:962965. [ Links ]
Miyazaki, I. 1954. Studies on Gnathostoma occurring in Japan (Nematoda: Gnathostomatidae) II Life history of Gnathostoma and morphological comparison of its larval forms. Kyushu Memory Medical Science 5:123139. [ Links ]
MosquedaCabrera, M. A., E. SánchezMiranda, L. CarranzaCalderón and H. E. OrtizNájera. 2009. Finding of the advanced thirdstage larvae of Gnathostoma turgidum Stossich, 1902 in Mexico from natural and experimental hosts and contributions to the life cycle description. Parasitology Research 104:12191225 [ Links ]
Palumbi, S. R. 1996. Nucleic acids II: The polymerase chain reaction. In Molecular Systematics, D. M. Hillis, C. Moritz and B. K. Mable (eds.). Sinauer, Sunderland. Massachusetts, p. 205247. [ Links ]
Pérez, A. Y., L. GarcíaPrieto, D. OsorioSarabia, R. LamotheArgumedo and V. LeónRègagnon. 2008. Present distribution of the genus Gnathostoma (Nematoda: Gnathostomatidae) in Mexico. Zootaxa 1930:3955. [ Links ]
Thompson, J. D., D. G. Higgins and T. J. Gibson. 1994. Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequences weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research 22:46734680. [ Links ]












