SciELO - Scientific Electronic Library Online

 
vol.22 issue3Evaluation of occlusal faceting in deciduous dentition in 6 year-old children in a rural community of YucatanInfluence of silane and universal adhesives on adhesion during the repair of a ceromer author indexsubject indexsearch form
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • Have no similar articlesSimilars in SciELO

Share


Revista odontológica mexicana

Print version ISSN 1870-199X

Rev. Odont. Mex vol.22 n.3 México Jul./Sep. 2018

 

Trabajos originales

Determinación de la frecuencia de PNUs en una población heterogénea cerrada y su utilidad como marcadores para estudios de asociación genética en casos de labio y paladar hendido no sindrómico

Determination of frequency of SNP’s in a population of mixed genetic origin and its use as genetic markers for association studies in cases of not syndromic cleft lip and palate

Miguel Francisco Javier Lloret Rivas* 

Aidé Terán Alcocer* 

Viridiana Sotomayor Villezcas* 

Guadalupe Ortega Ramírez* 

Gabriela Martínez López López* 

Roberto Valenzuela Martínez* 

María José Hernández Moreno* 

Alejandro Lloret Sandoval*  ** 

*Facultad de Medicina, Universidad Autónoma de Querétaro. Querétaro, Querétaro. México.

**Weill Cornell Medical College, Brain and Mind Research Institute.


RESUMEN

El labio y paladar hendido es una de las patologías congénitas con mayor prevalencia en el mundo. En el presente trabajo se hace un análisis de 12 PNU localizados en las secuencias genómicas de ABCA4, BMP4, MSX1, SUMO1, VAX1 y IRF6, bajo una perspectiva epidemiológica, de genética molecular, genómica y de genética de poblaciones; todo lo anterior aplicado a una población de Querétaro, México, de origen genético mixto. Material y métodos: Se realizó un estudio observacional, analítico y descriptivo a partir de muestras de 93 tríadas (sujetos de estudio y sus padres). Al seleccionar PNU que puedan ser diferenciados por medio de RFLP esperamos distinguir entre marcadores genéticos que: 1) cumplan con la ecuación de equilibrio de Hardy-Weinberg y 2) validarlos como potenciales marcadores genéticos para ser empleados en estudios de asociación en poblaciones cerradas de origen genético mixto con labio y paladar hendido (Amealco, Querétaro, México). De ser así, posteriormente se plantea probar las frecuencias obtenidas con una población seleccionada genéticamente cerrada de Amealco, Querétaro. Resultados: Después de realizar el análisis RFLP de 12 PNU localizados en la secuencia de genes ABCA4, BMP4, MSX1, SUMO1, VAX1 y IRF6, hallamos el mismo alelo para PNU analizado, el cual se encuentra en el 100% de la población. Conclusión: De los 12 PNU analizados, en este reporte, por primera vez se menciona la frecuencia de cinco de ellos. Los restantes siete presentaron la misma frecuencia reportada en la literatura. Aunque los PNU seleccionados no fueron de utilidad como marcadores genéticos debido a que el mismo alelo está presente en el 100% de la población general. El hecho de haberlos encontrado en el mismo genotipo de todas las muestras indica que la población de la ciudad de Querétaro es genéticamente cerrada y con base en esto extremadamente útil para futuras validaciones de otros PNU como posibles marcadores genéticos.

Palabras clave: CLP (labio leporino y paladar hendido); asociación genética; PNUs (polimorfismos de nucleótido único)

ABSTRACT

The cleft lip and palate is one of the congenital pathologies with greater prevalence in the world. In the present work, there is an analysis of 12 SNP's located in genomic sequences of ABCA4, BMP4, MSX1, SUMO1, VAX1 andIRF6, under an epidemiological perspective, molecular genetics, genomics and population genetics. All of the above applied to a population of Queretaro, Mexico, of mixed genetic origin. Material and methods: A study was conducted of observation, analytic and descriptive study with samples from 93 triads (study subjects and their parents). When you select SNP's that can be differentiated by RFLP (Restriction Fragment Length Polymorphism)we hope to distinguish between genetic markers that: 1)comply with the equation of balance of Hardy-Weiner and 2) Validate them as potential genetic markers to be used in studies of association in closed populations of genetic origin mixed with cleft lip and palate in Amealco, Queretaro, Mexico. If so subsequently raises test the frequencies obtained with a selected population genetically closed in Amealco, Queretaro. Results: After performing the RFLP analysis of 12 SNP's located in the sequence of genes ABCA4, BMP4, MSX1, SUMO1, VAX1 and IRF6, we find the same allele for SNP analyzed which is located in the 100% of the population. Conclusion: Of the 12 SNP's analyzed in this report, for the fi rst time 5 of them are mentioned their frequency. The rest of them had the same frequency reported in the literature. Although the SNP's selected were not useful as a genetic markers due to the same allele is present in 100% of the general population. The fact of having found in the same genotype of all samples indicates that the population of the city of Queretaro is genetically closed and on the basis of this extremely useful for future validations of other SNP's as potential genetic markers.

Key words: CLP (cleft lip and palate); genetic association; SNP's (single nucleotide polymorphisms)

INTRODUCCIÓN

El labio y paladar hendido (LPH) es una patología de distribución mundial y se considera la más frecuente de las malformaciones congénitas.1 Su frecuencia varía entre las poblaciones debido a su fondo genético y a cuestiones ambientales.

Los tratamientos que reciben los pacientes con LPH pueden representar erogaciones financieras hasta de 200,000 dólares, debido a que se requieren manejos multidisciplinarios para atender tales malformaciones.2-4 El LPH es manejado principalmente con cirugías reconstructivas y procedimientos odontológicos; sin embargo, existe una serie de trastornos a largo plazo que representan un problema de salud traducidos en una alta incidencia de patologías mentales, así como un incremento de la probabilidad de muertes a temprana edad.4,5 El LPH también está asociado con una elevada probabilidad de presentar distintos tipos de cáncer (en cerebro, mama, colon) no sólo en los afectados de LPH, sino también en sus familiares.6-9 Las complicaciones derivadas de LPH en etapas tempranas de la vida tienen consecuencias devastadoras en países del tercer mundo, donde el acceso a los tratamientos médicos es difícil o inexistente.10

El LPH clínicamente es definido como un desarrollo embriológico craneofacial anormal. Los pacientes con estos rasgos clínicos presentan, además, otitis infecciosas recurrentes, trastornos del habla, de la masticación, de la deglución, así como alteraciones en la estética facial.11 Como ya se mencionó, el tratamiento de estos pacientes está a cargo de un equipo multidisciplinario, incluyendo el profiláctico: Otorrinolaringología, Cirugía Plástica y Maxilofacial, Ortodoncia, Terapia del lenguaje, Pediatría, Enfermería, Consejo Genético, Audiometría, Psicología o Trabajo Social, por enumerar algunos. Esto representa tratamientos muy complejos y a largo plazo, la mayoría en países del tercer mundo. De allí que es fundamental entender los mecanismos biológicos que son alterados durante etapas del desarrollo de los pacientes con LPH. Recientemente, han existido estudios acerca de las causas de dicha patología, entre ellas exposición ambiental a ciertos tóxicos, elevado riesgo a exposición al tabaco, alcohol o uso de ciertas drogas durante el embarazo, etcétera.12 Sin embargo, la etiología de la patología sigue siendo desconocida13 y se sabe aun menos de los posibles genes involucrados con los procesos patobiológicos del LPH.

Los estudios de asociación de genoma completo (GWAS) reportados en la literatura han arrojado alguna luz sobre los genes posiblemente involucrados en estos procesos.3,14-16 Los genes que muestran reproducibilidad en GWAS realizados por diversos grupos de investigación son: IRF6,17 MAFB,18 FGFR2,19 MSX1,20 VAX1,21 SOX9,22,23 ABCA4,18 BMP4,24 y SUMO1.25-27

Sin embargo, estos estudios reportados fueron hechos en poblaciones con fondos genéticos homogéneos. En el presente estudio se determina la frecuencia de diversos PNU localizados en los genes ABCA4, BMP4, MSX1, SUMO1, VAX1 e IRF6 en una población cerrada de la ciudad de Querétaro, México, con un fondo genético mixto.

MATERIAL Y MÉTODOS

Extracción del ADN total humano. El estudio fue aprobado por el Comité de Ética de la Facultad de Medicina de la Universidad Autónoma de Querétaro. Se seleccionaron sujetos adultos con un rango de edad entre 19-60 años. Tanto los padres como los abuelos de los voluntarios son nacidos y residentes de la ciudad de Querétaro por lo menos en tres generaciones. Los sujetos voluntarios que contaban con un padre nacido en la localidad y el otro de un estado o una ciudad distinta no fueron incluidos en el estudio. Ninguno de los voluntarios presentaron diagnóstico de maloclusión familiar. Otros datos tales como estilo de vida, talla, peso y otras patologías (enfermedades crónico-degenerativas o cáncer) fueron registradas, pero no consideradas para este trabajo. A los sujetos de estudio se les dio a firmar una hoja de consentimiento informado, siguiendo los lineamientos del Comité de Ética de la Facultad de Medicina de la Universidad Autónoma de Querétaro. Las muestras de ADN fueron obtenidas a partir de células epiteliales bucales tanto de los voluntarios sanos como de ambos padres como se describe en Aidar y Line, 2007. En este estudio se utilizaron 93 tríadas (279 individuos) para probar cada PNU.

Selección de PNU: PNU reportados para los genes ABCA4, BMP4, MSX1, SUMO1, VAX1 e IRF6 fueron localizados en la base de datos del NCBI (https://www. ncbi.nlm.nih.gov/snp/). Los PNU analizados en este trabajo fueron seleccionados bajo uno de los siguientes criterios: 1) que causen un cambio en el marco de lectura (missense), 2) que no tengan un efecto en el marco de lectura (synonimous), 3) que se encuentren localizados en zonas regulatorias (i.e. splicing, 3’UTR, 5’UTR). En el caso del la secuencia genómica del gen IRF6 se escogieron aquéllos que se encontraran esparcidos a lo largo de la secuencia genómica (Cuadros I y II). En todos los casos el cambio de nucleótido tiene que causar una modificación en el sitio de reconocimiento de una endonucleasa y este sitio de restricción no debe estar repetido en la secuencia que rodea al PNU en al menos 50 pb de los extremos 5’ y 3’. Para el análisis de sitios únicos de restricción factibles de ser analizados por RFLP para cada uno de los PNU aquí reportados se utilizó el programa NEB cutter v2 software (http://nc2.neb.com/NEBcutter2/).

PCR. Las reacciones en cadena de la polimerasa (PCR) se llevaron a cabo utilizando el reactivo GoTaq® MasterMix (Promega) de acuerdo a las especifi caciones del fabricante. Del ADN total de cada individuo se utilizaron 500 ng como templado para dicha reacción en un volumen total de 20 μL. Los cebadores (primers) fueron diseñados utilizando el programa http://biotools.umassmed.edu/bioapps/primer3_www.cgiy sintetizados por IDT technologies. Las secuencias de cada par de cebadores se encuentran localizadas en el cuadro I.

La reacción fue sujeta a los siguientes ciclos: 95 oC por cinco minutos, 30 ciclos de 95 oC por 30 segundos, temperatura de anclaje (annealing) de cada par de cebadores (primer annealing) por 30 segundos y extensión a 72 oC por 30 segundos. Al final de los 30 ciclos, se añadió un paso de extensión a 72 oC por 10 minutos. La Tm utilizada para el anclaje de los cebadores fue basada en la determinada por IDT. La amplificación fue llevada a cabo utilizando un termociclador marca Artik (Thermo-Fisher) en un volumen fonal de reacción 20 μL. Diez μL de los productos amplificados fueron incubados con su enzima de restricción siguiendo las especificaciones del fabricante (Cuadro II), en un volumen total de 20 μL. Todas las endonucleasas fueron adquiridas del fabricante NEB. Los productos de PCR sin enzima y con enzima de restricción fueron visualizados por electroforesis en cámara submarina en un gel de agarosa al 3% teñido con bromuro de etidio utilizando como búffer de corrimiento TBE al 0.5%. De acuerdo al patrón de restricción, el alelo para cada PNU fue determinado. Todos los reactivos químicos fueron adquiridos de Sigma Aldrich. Resultados representativos de este análisis se muestran en las figuras 1 y 2.

Cuadro I Frecuencias encontradas en muestras de individuos sanos de la ciudad de Santiago de Querétaro, Querétaro, México, para los PNU localizados en la secuencia genómica de los genes MAFB, FGFR2, MSX1, VAX1, SOX9, ABCA4, BMP4 y SUMO1. ADN de 93 tríadas (hijo/a, madre y padre) rodeando al PNU seleccionado fueron amplificadas por PCR de punto fi nal y restringidas con la correspondiente endonucleasa. 

PNU Gen Tipo de cambio Cambio de aminoácido Alelo 1 Alelo 2 Enzima Alelo encontrado (279/279) Genotipo (279/279) Frecuencia reportada&
rs377311148 ABCA4 Miss L (P A G TspRI G GG A = 1.0
rs145066457 BMP4 Syn L (L A T BfaI T TT T = 1.0
rs149960650 MSX1 Syn L (L A G BfaI G GG G = 0.996 A = 0.004
rs143825095 SUMOI Syn H (H A G Mnl I A AA A = 1.0
rs200364078 VAX1 Intr Ninguno C T BfaI T TT N/A

& Frecuencia reportada en la base de datos del NCBI, Miss = Cambio de sentido; Syn = Cambio sinónimo; Intr = PNU localizado en la secuencia intrónica.

Cuadro II Frecuencias encontradas en muestras de individuos sanos de la ciudad de Santiago de Querétaro, Querétaro, México, para los PNU localizados en la secuencia genómica del gen IRF6. ADN de 93 tríadas (hijo/a, madre y padre) rodeando al PNU seleccionado fueron amplificadas por PCR de punto final y restringidas con la correspondiente endonucleasa. 

PNU Gen Tipo de cambio Cambio de aminoácido Alelo 1 Alelo 2 Enzima Alelo encontrado (279/279) Genotipo (279/279) Frecuencia reportada&
rs141555342 IRF6 Syn P (P C T MspI T TT T = 0.999983 C = 0.000016
rs377332433 IRF6 Miss P (L A G Msp I G GG G = 0.999950 A = 0.000049
rs527840168 IRF6 Intr N/A C T MspI C CC N/A
rs539406879 IRF6 3’ UTR N/A C T MspI T TT N/A
rs752367933 IRF6 Intr N/A C G BfaI G GG N/A
rs767916600 IRF6 Miss Q (R C T MnlI T TT T = 0.999991 C = 0.000008
rs774631697 IRF6 Intr N/A A G MspI A AA N/A

& Frecuencia reportada en la base de datos del NCBI. Miss = Cambio de sentido; Syn = Cambio sinónimo; Intr = PNU localizado en la secuencia intrónica.

RESULTADOS Y DISCUSIÓN

El LPH representa la malformación congénita más frecuente en el mundo con una tasa aproximada de uno por cada 90 nacidos vivos. Estudios de asociación genética han revelado genes que se asocian con la aparición de LPH tales como: MAFB, FGFR2, MSX1, VAX1, SOX9, ABCA4, BMP4, SUMO1 e IRF6. Con base en ello decidimos probar si un marcador genético es adecuado para ser empleado en estudios de asociación. Las frecuencias encontradas para cada PNU seleccionado para el presente trabajo son mostrados en los cuadros I y III. En el cuadro I observamos que los PNU localizados en los genes ABCA4, BMP4, MSX1, SUMO1 y VAX1 son compartidos en el 100% de la población (279 de 279). Además, los PNU elegidos para ABCA4, BMP4, MSX1 y SUMO1 son concordantes con los resultados reportados en la base de datos de la NCBI PNU. En este trabajo se reporta por primera vez en la literatura la frecuencia de VAX1 en una población.

Debido a que ningún PNU resultó útil para ser utilizado como marcador genético para estudios de asociación en ninguno de estos genes, decidimos enfocar nuestra atención en IRF6. Estudiar el gen IRF6 como pieza clave en etiopatogenia del LPH es de gran interés, basados en dos reportes recientes, en los cuales, de manera independiente y en dos poblaciones diferentes, se demostró su capacidad de ser reproducible como marcador genético asociado a LPH. Su función durante el desarrollo embrionario es de gran importancia, porque han sido reportadas mutaciones en este gen, dando origen a fenocopias que semejan la patología no sindrómica de LPH. El producto del gen IRF6 es una proteína llamada factor regulador del interferón 6, la cual es un factor regulador perteneciente a la familia SMIR. Esta proteína se caracteriza por una estructura altamente conservada para reconocer las secuencias promotoras del ADN. Dicho gen se localiza en la región 1q32-q41, la cual se considera una zona crítica asociada con el síndrome de Van der Woude (VWS1). Asimismo, diferentes mutaciones del gen IRF6 dan como resultado fenotipos del VWS1, transmitiéndose de forma autosómica dominante con penetrancia incompleta y con rasgos clínicos de hoyuelos en labio inferior y/o LPH. Este síndrome representa la forma más frecuente de LPH y de malformaciones sindrómicas del labio. Los marcadores genéticos han sido descritos cerca del gen IRF6 para poblaciones homogéneas, como es el caso de Querétaro, así como en otras poblaciones de México. Las variantes alélicas que fueron halladas en nuestro trabajo son mostradas en el cuadro III.

Cuadro III Secuencias de los cebadores utilizados para la reacción en cadena de la polimerasa. 

Gen PNU ID Cebador izquierdo Cebador derecho
ABCA4 rs377311148 TAACCCTCCCAGCTTTGGAC AAGCTGCTCATTGTCTTCCC
BMP4 rs145066457 TCGGCTAATCCTGACATGCT ACACGACTACTGGACACGAG
MSX1 rs149960650 CTCCGCAAACACAAGACGAA GTAGTCTCTTTGCCTTGGCG
SUMO1 rs143825095 GCAGTTAAGCAGGGTACAAGA TCTCCTTAGGATAGCAGTGAGA
VAX1 rs200364078 CCACAGCCTCTTCAGCCT TTGTTGGTCCGGGAGTAAGG
IRF6 rs141555342 CAGCTCTCCTGGGTTTGAAG GTCTTCCTCAGGGCCTCTTT
IRF6 rs377332433 GCTGTATAGGTGCCTGGGG CCCCTGTCTGCTCACCATAT
IRF6 rs539406879 TTCCTCTGACATCATTCTGAAAA AAGTGCCAAGAAATGCCAAG
IRF6 rs527840168 AAGCGGGAATGTAACGTGTG AATAGACACTGGGGCCTCCT
IRF6 rs767916600 TTTGTTTTCTGGGTCCTTCC CTGCGCTGTGCTCTCAATAA
IRF6 rs774631697 ACTTCTCAAGCCCCACAATG ATGCTGCCCTACAAAACACC
IRF6 rs752367933 CTGCTCCCCAGTCCTATCAC TCTCCTTTCCCATCATCAGG

PCR = Reacciones en cadena de la polimerasa.

Figura 1 Muestra representativa del análisis por RFLP del PNU rs143825095 (A/G) ubicado en la secuencia codificante del gen SUMO1. El producto de 237pb obtenido por PCR (carriles 2, 4, 6, 8, 10, 12, 14, 16 y 18) obtenido de cada individuo sano fue sujeto a restricción con la endonucleasa MnlI por 1 hora a 37 oC (carriles 3, 5, 7, 9, 11, 13, 15, 17 y 19). Las muestras fueron cargadas en un gel de agarosa al 3% teñido con bromuro de etidio. Como marcadores de peso molecular se utilizó ADN del fago Phi 174 restringidos con la endonucleasa HaeIII (carril 1) y el marcador de 25 pb de NEB (carril 20). El gel se corrió por electroforesis en cámara submarina por una hora (material y métodos). 

Figura 2 Muestra representativa del análisis por RFLP del PNU rs27840168 (C/T) ubicado en la secuencia intrónica del gen IRF6. El producto de 220bp obtenido por PCR (carriles 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 y 22) obtenido de cada individuo sano fue sujeto a restricción con la endonucleasa MspI por 1 hora a 37 oC (carriles 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 y 23). Las muestras fueron cargadas en un gel de agarosa al 3% teñido con bromuro de etidio. Como marcador de peso molecular se utilizó ADN del fago Phi 174 restringidos con la endonucleasa HaeIII (carriles 1 y 24). El gel se corrió por electroforesis submarina por una hora (material y métodos).  

Los resultados del genotipo de la población analizada muestran que ninguno de estos PNU muestran las características necesarias para ser considerados como marcadores genéticos, debido a que se les encontró en el 100% de la población estudiada. Dos de los PNU: (rs767916600, rs141555342) concuerdan con lo reportado en la literatura, sin embargo las frecuencias de los PNU rs539406879, rs527840168, rs774631697, rs752367933 son descritas por primera vez provenientes de una población de Querétaro, México.

CONCLUSIÓN

Después de realizar el análisis RFLP de varios PNU ubicados en la región genómica de los genes ABCA4, BMP4, MSX1, SUMO1, VAX1 e IRF6, podemos concluir que cuando menos para dichos marcadores existe una homogeneidad genética en la población analizada, lo cual la convierte en la población ideal para realizar más estudios en ella. Aun cuando ninguno de los PNU reportados en el estudio son de utilidad para futuros posibles estudios de asociación, se plantea estudiar un conjunto de 36 PNU candidatos a análisis RFLP en la población sana que se encuentren distribuidos a lo largo de la secuencia genómica de IRF6, a fin de encontrar uno que llene las características de ser marcador molecular para estudios de asociación genética.

Financiamiento: El estudio fue financiado con los programas PRODEP-SEP 2016.

REFERENCIAS

1. Rahimov F, Jugessur A, Murray JC. Genetics of nonsyndromic orofacial clefts. Cleft Palate Craniofac J. 2012; 49 (1): 73-91. [ Links ]

2. Berk NW, Marazita ML. The costs of cleft lip and palate: personal and societal implications. In: Wyszynski DF, editor. Cleft lip and palate: from origin to treatment. Oxford: Oxford University Press; 2002. p. 458-670. [ Links ]

3. Marazita ML, Spence MA, Melnick M. Genetic analysis of cleft lip with or without cleft palate in Danish kindreds. Am J Med Genet. 1984; 19 (1): 9-18. [ Links ]

4. Wehby GL, Cassell CH. The impact of orofacial clefts on quality of life and healthcare use and costs. Oral Dis. 2010; 16 (1): 3-10. [ Links ]

5. Christensen K, Juel K, Herskind AM, Murray JC. Long term follow up study of survival associated with cleft lip and palate at birth. BMJ. 2004; 328 (7453): 1405. [ Links ]

6. Bille C, Knudsen LB, Christensen K. Changing lifestyles and oral clefts occurrence in Denmark. Cleft Palate Craniofac J. 2005; 42 (3): 255-259. [ Links ]

7. Dietz A, Pedersen DA, Jacobsen R, Wehby GL, Murray JC, Christensen K. Risk of breast cancer in families with cleft lip and palate. Ann Epidemiol. 2012; 22 (1): 37-42. [ Links ]

8. Menezes R, Marazita ML, Goldstein MT, Cooper ME, Bardi K, Brandon C et al. AXIS inhibition protein 2, orofacial clefts and a family history of cancer. J Am Dent Assoc. 2009; 140 (1): 80-84. [ Links ]

9. Zhu JL, Basso O, Hasle H, Winther JF, Olsen JH, Olsen J. Do parents of children with congenital malformations have a higher cancer risk? A nationwide study in Denmark. Br J Cancer. 2002; 87 (5): 524-528. [ Links ]

10. Wehby GL, Murray JC. Folic acid and orofacial clefts: a review of the evidence. Oral Dis. 2010; 16 (1): 11-19. [ Links ]

11. Jiang R, Bush JO, Lidral AC. Development of the upper lip: morphogenetic and molecular mechanisms. Dev Dyn. 2006; 235 (5): 1152-1166. [ Links ]

12. Yang J, Carmichael SL, Canfi eld M, Song J, Shaw GM. National birth defects prevention study. Am J Epidemiol. 2008; 167 (2): 145-154. [ Links ]

13. Jugessur A, Shi M, Gjessing HK, Lie RT, Wilcox AJ, Weinberg CR et al. Genetic determinants of facial clefting: analysis of 357 candidate genes using two national cleft studies from Scandinavia. PLoS One. 2009; 4 (4): e5385. [ Links ]

14. Mitchell LE. Mode of inheritance of oral clefts. In: Wyszyski DF, editor. Cleft lip and palate: from origin to treatment. Oxford: Oxford University Press ; 2002. p. 234-239. [ Links ]

15. Sivertsen A, Wilcox AJ, Skjaerven R, Vindenes HA, Abyholm F, Harville E et al. Familial risk of oral clefts by morphological type and severity: population based cohort study of fi rst degree relatives. BMJ. 2008; 336 (7641): 432-434. [ Links ]

16. Jugessur A, Farlie PG, Kilpatrick N. The genetics of isolated orofacial clefts: from genotypes to subphenotypes. Oral Dis. 2009; 15 (7): 437-453. [ Links ]

17. Kondo S, Schutte BC, Richardson RJ, Bjork BC, Knight AS, Watanabe Y et al. Mutations in IRF6 cause Van der Woude and popliteal pterygium syndromes. Nat Genet. 2002; 32 (2): 285-289. [ Links ]

18. Beaty TH, Murray JC, Marazita ML, Munger RG, Ruczinski I, Hetmanski JB et al. A genome-wide association study of cleft lip with and without cleft palate identifi es risk variants near MAFB and ABCA4. Nat Genet. 2010; 42 (6): 525-529. [ Links ]

19. Wilkie AO, Slaney SF, Oldridge M, Poole MD, Ashworth GJ, Hockley AD et al. Apert syndrome results from localized mutations of FGFR2 and is allelic with Crouzon syndrome. Nat Genet. 1995; 9 (2): 165-172. [ Links ]

20. van den Boogaard MJ, Dorland M, Beemer FA, van Amstel HK. MSX1 mutation is associated with orofacial clefting and tooth agenesis in humans. Nat Genet. 2000; 24 (4): 342-343. [ Links ]

21. Mangold E, Ludwig KU, Birnbaum S, Baluardo C, Ferrian M, Herms S et al. Genome- wide association study identifi es two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. Nat Genet. 2010; 42 (1): 24-26. [ Links ]

22. Foster JW, Dominguez-Steglich MA, Guioli S, Kwok C, Weller PA, Stevanovic M et al. Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature. 1994; 372 (6506): 525-530. [ Links ]

23. Wagner T, Wirth J, Meyer J, Zabel B, Held M, Zimmer J et al. Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell. 1994; 79 (6): 1111-1120. [ Links ]

24. Suzuki S, Marazita ML, Cooper ME, Miwa N, Hing A, Jugessur A et al. Mutations in BMP4 are associated with subepithelial, microform, and overt cleft lip. Am J Hum Genet. 2009; 84 (3): 406-411. [ Links ]

25. Alkuraya FS, Saadi I, Lund JJ, Turbe-Doan A, Morton CC, Maas RL. SUMO1 haploinsufficiency leads to cleft lip and palate. Science. 2006; 313 (5794): 1751. [ Links ]

26. Shi M, Mostowska A, Jugessur A, Johnson MK, Mansilla MA, Christensen K et al. Identification of microdeletions in candidate genes for cleft lip and/or palate. Birth Defects Res A Clin Mol Teratol. 2009; 85 (1): 42-51. [ Links ]

27. Mostowska A, Hozyasz KK, Wojcicki P, Biedziak B, Paradowska P, Jagodzinski PP. Association between genetic variants of reported candidate genes or regions and risk of cleft lip with or without cleft palate in the polish population. Birth Defects Res A Clin Mol Teratol. 2010; 88 (7): 538-545. [ Links ]

**Este artículo puede ser consultado en versión completa en http://www.medigraphic.com/facultadodontologiaunam

Recibido: 01 de Septiembre de 2017; Aprobado: 01 de Febrero de 2018

Dirección para correspondencia: Miguel Francisco Javier Lloret Rivas E-mail: miguellloret8@gmail.com

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons