SciELO - Scientific Electronic Library Online

 
vol.17 issue3Transverse deflection of polymer-based alternative materials for the manufacturing of a denture baseIn vitro comparison of anti-microbial activity of AH Plus, RSA and Ledermix against Enterococcus faecalis author indexsubject indexsearch form
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • Have no similar articlesSimilars in SciELO

Share


Revista odontológica mexicana

Print version ISSN 1870-199X

Rev. Odont. Mex vol.17 n.3 México Jul./Sep. 2013

 

Trabajos originales

 

Expresión de la osteocalcina en el ligamento periodontal al inducir fuerzas ortodóncicas

 

Maritere Villarreal Brito,* Marco Antonio Álvarez Pérez,§ Francisco Javier Marichi RodríguezII

 

* Alumna de la Especialidad de Ortodoncia de la División de Estudios de Postgrado e Investigación. Facultad de Odontología de la UNAM.

§ Profesor e Investigador del Laboratorio de Biología Celular y Molecular de la División de Estudios de Postgrado e Investigación. Facultad de Odontología de la UNAM.

II Profesor de la Especialidad de Ortodoncia de la División de Estudios de Postgrado e Investigación. Facultad de Odontología de la UNAM.

Correspondencia

 

RESUMEN

La osteocalcina es una proteína no colágena presente en hueso alveolar, cemento radicular y subpoblaciones del ligamento periodontal. Esta proteína juega un papel importante en la biomineralización y en la matriz extracelular regulando la maduración de los cristales de hidroxiapatita y en el reclutamiento de los osteoclastos participando en la remodelación ósea. La remodelación y la nueva formación de tejido periodontal es parte esencial durante los movimientos ortodóncicos, los cuales al aplicar fuerzas causan tensión en las células provocando una adaptación que se traduce en respuestas celulares y moleculares que pueden afectar la matriz extracelular. Por ello, el propósito de esta investigación fue determinar la expresión de la osteocalcina asociada a la remodelación periodontal cuando se aplican fuerzas ortodóncicas. En primeros premolares superiores e inferiores se colocó aparatología fija prescripción Roth 0.022 con un arco NiTi 0.016, la cual se aplicó a todos los dientes de ambas arcadas con excepción de los premolares superiores e inferiores izquierdos. Los premolares sin aparatología (t = 0) y en presencia de aparatología para inducir movimientos ortodóncicos durante 1, 3, 5, 7 y 9 días; fueron extraídos para analizar la expresión de la osteocalcina en la matriz extracelular del ligamento periodontal. Para determinar la expresión temporal y espacial de los mensajeros de la osteocalcina en el ligamento periodontal se llevó a cabo la técnica RT-PCR. La expresión de la osteocalcina en el grupo experimental estuvo presente en todos los días de prueba, sugiriendo que los movimientos ortodónticos generan cambios que son susceptibles en las concentraciones del mensajero de la proteína osteocalcina.

Palabras clave: Osteocalcina, ligamento periodontal, fuerzas ortodóncicas.

 

INTRODUCCIÓN

La osteocalcina o BGP (por sus siglas en inglés Bone Gla Protein), es la proteína no colágena más abundante en el periodonto y constituye hasta el 3% de la proteína ósea total. Tiene 49 aminoácidos con tres residuos de ácido gama-carboxiglutámico, los que se asocian con sus propiedades de unión a calcio. La producen los osteoblastos, cementoblastos y subpoblaciones de fibroblastos del ligamento periodontal completamente diferenciados, con una masa de aproximadamente de 6 kDa y es secretada en el frente de mineralización.1-3 Los estudios de inmunohistoquímica la han localizado en hueso alveolar, dentina y cemento radicular y su papel en la biomineralización se ha determinado parcialmente. Se sabe que la producción de la osteocalcina es estimulada por vitamina K, ya que en modelos animales tratados con warfina (antagonista de la vitamina K) inhibe la carboxilación de los residuos de ácido glutámico; y por el factor de crecimiento fibroblástico tipo 2 (FGF-2) debido a que ratones knock-out del gen FGF-2 presentan una hipermineralización ósea. Esto sugiere que la BGP desempeña un papel en la biomineralización y en la matriz extracelular regulando la maduración de los cristales de hidroxiapatita y en el reclutamiento de los osteoclastos participando en la remodelación ósea.4-7

En tratamientos ortodóncicos, los órganos dentarios responden a las fuerzas mecánicas aplicadas por medio de remodelar la matriz extracelular del periodonto. Cuando las fuerzas son aplicadas al órgano dentario; existen dos puntos principales que pueden influenciar una respuesta: un lado de presión donde suceden ciclos de reabsorción y un lado de tensión donde predomina la formación de matriz extracelular. Durante los procesos de reabsorción y formación de matriz extracelular del periodonto bajo influencia de movimientos ortodóncicos, existen un gran número de moléculas que se expresan (desde factores de crecimiento, moléculas colágenas, glicoproteínas, hormonas, proteoglucanos, etc.) para regular las funciones de adhesión, motilidad, crecimiento y diferenciación celular. Dichas funciones son extremadamente reguladas por la matriz extracelular, jugando un papel clave en los movimientos ortodóncicos.8

Las investigaciones con movimientos ortodóncicos han reportado que la aplicación local de osteocalcina llevó a una aceleración en el movimiento dental en ratas durante los periodos iniciales del tratamiento. Esta aceleración fue debida principalmente por un incremento en el reclutamiento de osteoclastos. Lo que ha llevado a suponer que la aplicación de la osteocalcina en un periodo inicial puede ser suficiente para acelerar el movimiento dental, ya que podría actuar como una molécula que promueve quimioatracción para las células precursoras de los osteoclastos participando en la remodelación de la matriz por un lado y por el otro favoreciendo un microambiente apropiado para la biomineralización.8,9

Por lo anterior el objetivo de este estudio fue determinar la expresión del gen que codifica para la osteocalcina que se encuentra en el ligamento periodontal de dientes sometidos a fuerzas ortodóncicas durante 1, 3, 5, 7 y 9 días de tratamiento.

 

MÉTODOS

SELECCIÓN DE PACIENTES Y APLICACIÓN DE APARATOLOGÍA

Para realizar este estudio, se reclutaron 50 pacientes sanos de ambos sexos, mayores de edad que acudían a la Clínica de Ortodoncia de la División de Estudios de Postgrado e Investigación de la Facultad de Odontología de la UNAM. Su tratamiento de base contempló extracciones de primeros premolares superiores e inferiores y ellos fueron informados del estudio para su consentimiento. A los 50 pacientes, divididos en grupos de 10 pacientes para cada tiempo experimental (1, 3, 5, 7 y 9 días), se les colocó aparatología fija prescripción Roth 0.022, con un arco Sentalloy calibre 0.016 NiTi. La aparatología se aplicó en todos los dientes de ambas arcadas con excepción de los premolares superiores izquierdos, los cuales actuaron como grupo control (t = 0). Los premolares superiores derechos fueron considerados como el grupo que fue sometido a presión ortodóncica (grupo experimental). A dichos premolares se les colocó el bracket con una angulación de 30° hacia distal respecto al plano oclusal del paciente (Figura 1). Dicho bracket se ligó al arco con un módulo elastomérico (marca GAC) y el diente se sometió a una presión ortodóncica constante calibrada alrededor de los 80 gramos de fuerza durante 1, 3, 5, 7 y 9 días. Al término de cada tiempo en que se dejaron actuar las fuerzas ortodóncicas de la aparatología, los premolares superiores e inferiores fueron extraídos.

 

EXTRACCIÓN DENTAL

La extracción de los premolares de los pacientes se llevó a cabo en la Clínica de Periodoncia de la misma institución durante 1, 3, 5, 7 y 9 días después de haber colocado la aparatología. La extracción se realizó utilizando 1.8 mililitros de anestésico lidocaína con epinefrina (36/0.025 mg, Uniseal) luxando el órgano dentario con un elevador recto No. 301 m y manipulando con fórceps No. 150. Los premolares extraídos se colocaron en nitrógeno líquido para su conservación y posterior utilización para el aislamiento del ácido ribonucleico (ARN).

 

AISLAMIENTO DE ARN

Premolares bajo movimientos ortodóncicos (t = 1, 3, 5, 7 y 9 días) y sin movimientos ortodóncicos (t = 0), fueron extraídos para analizar la expresión del gen de la osteocalcina presente en la matriz extracelular del periodonto. Una vez extraídos los premolares, se procedió a retirar el tejido periodontal unido a las zonas media y apical de los premolares por medio del raspado con una hoja de bisturí. El tejido fue homogeneizado en 1 mL de TRIZOL (Gibco BRL) para llevar a cabo la extracción del ARN total siguiendo las instrucciones del fabricante. El ARN total se incubó con DNAasa libre de RNAasas (Boehringer Mannheim Biomedicals, IN) con el fin de garantizar que no exista contaminación de DNA genómico. El RNA fue cuantificado por densitometría óptica a 260 nm y utilizado posteriormente para la técnica de RT-PCR.

 

RT-PCR

Para determinar la expresión temporal y espacial del mensajero de la osteocalcina aislada de la matriz extracelular del periodonto bajo movimientos ortodóncicos durante 1, 3, 5, 7 y 9 días, llevamos a cabo la técnica de RT-PCR. Se utilizó el kit SuperScript One-Step RT-PCR (Invitrogen, Carlsbad, CA) para la transcripción de la cadena complementaria a partir de 1 μg de RNA total de cada muestra siguiendo las especificaciones del fabricante. Para generar cada templado de cDNA el RT se llevó a cabo usando los oligos específicos para la osteocalcina: oligo en dirección sentido 5' GATCCATGAGAATGAGAAGCG 3' y oligo en dirección antisentido 5' CTATGTTAGCACCTTATCCCC 3' a una temperatura de 45°C por 30 minutos y un ciclo de 94°C por 2 minutos. EL cDNA se amplificaron bajo el siguiente programa de PCR: 94°C durante un minuto (desnaturalización), temperatura de alineamiento de los oligos para la osteocalcina a 55°C durante un minuto y extensión a 72°C por un minuto, hasta completar 35 ciclos. Los productos de PCR fueron separados por electroforesis en geles de agarosa al 1.2%, teñidos con bromuro de etidio y visualizados bajo un transiluminador de luz ultravioleta. Las imágenes se fotodocumentaron con el sistema EDAS 290 (Kodak, USA).

 

RESULTADOS

La figura 1 muestra un ejemplo representativo de los premolares que fueron sujetos a la colocación de la aparatología (grupo experimental) para inducir la tensión ortodóncica durante 1, 3, 5, 7 y 9 días. La imagen corresponde al premolar superior derecho donde se puede apreciar el grado de angulación con respecto al plano oclusal que fue de 30°. Durante el estudio tanto en el grupo de premolares control correspondientes al tiempo cero, como en el grupo de premolares experimentales; no se presentaron cambios clínicamente observados en el grosor del ligamento periodontal durante el tiempo de estudio que se aplicaron las fuerzas ortodóncicas.

En la figura 2 se puede apreciar la expresión del gen que codifica para la osteocalcina, la cual presenta un peso molecular de 310 pares de bases aproximadamente. Los resultados durante los días de aplicación de las fuerzas ortodóncicas indican que la osteocalcina se expresa durante todos los tiempos experimentales con un aumento en la expresión durante los días cinco y nueve del tratamiento. Durante los días 1, 3 y 7 la expresión es similar al tiempo cero o control con una ligera disminución en el día siete.

 

DISCUSIÓN

Los resultados obtenidos en este estudio indican que al aplicar fuerzas ortodóncicas en premolares por la presencia de la aparatología durante uno a nueve días, se produce un cambio en la expresión del gen que codifica para la osteocalcina en el área del ligamento periodontal. Debido a que la osteocalcina tiene injerencia en la reabsorción como en el depósito de matriz mineralizada, los resultados obtenidos de este estudio confirman el papel regulador de la osteocalcina en los procesos de formación de la matriz extracelular del periodonto. La expresión del gen de la osteocalcina durante los tiempos experimentales puede interpretarse debido a la inducción de la reabsorción inicial del hueso y de la matriz de fibras colagénicas del ligamento periodontal necesaria para el movimiento del órgano dentario y para el reclutamiento específico de los osteoclastos en el sitio de la reabsorción. Confirmando los estudios en la cual reportan que la aplicación local de la proteína aumenta la velocidad de los movimientos ortodóncicos en modelos animales.9

La expresión del gen que codifica para la osteocalcina se mantiene con una expresión creciente al tiempo de inducción de los movimientos ortodóncicos hasta observarse un aumento en el 5to día sugiriendo que está llegando al pico máximo de la reabsorción para tener una fase recesiva en el día siete, para tener una expresión significativa en el 9no día; lo cual indicaría que se inicia el proceso de mineralización debido a que es una proteína involucrada en regular las concentraciones de calcio e hidroxiapatita. La expresión de la osteocalcina como se muestra en la figura 2, nos da indicios de que la matriz del ligamento periodontal puede ser remodelada desde las primeras horas de colocada la aparatología. En la literatura existen reportes que han demostrado el efecto de las fuerzas ortodóncicas sobre el ligamento periodontal. Sin embargo, estos estudios están realizados in vitro y/o en especies distintas del ser humano.10 Estas primeras etapas de respuesta por parte del ligamento periodontal pueden relacionarse al proceso de inflamación que se genera al inducir movimientos dentales por los procesos de ortodoncia. Por lo tanto, la osteocalcina podría facilitar los movimientos ortodóncicos al funcionar como una molécula que induce quimioatracción para reclutar a los osteoclastos en los sitios de mayor presión y funcionar como un factor importante que ayuda en los frentes de biomineralización en el lado de tensión.

 

CONCLUSIÓN

Nuestros estudios indican que existen cambios a nivel molecular en la matriz del ligamento periodontal sensible al tiempo de inducción del movimiento del órgano dentario cuando se utiliza aparatología fija.

Los cambios a nivel molecular fueron determinados por la técnica de RT-PCR para el gen que codifica a la osteocalcina, la cual refleja que la matriz del ligamento periodontal es sensible en el tiempo a las fuerzas ortodóncicas a la que fueron sujetas los órganos dentarios en el estudio.

La expresión de la osteocalcina sugiere una doble participación en los procesos ortodónticos participando en los procesos de reabsorción y remodelación de la matriz del periodonto.

 

REFERENCIAS

1. Bilezikian JP, Raisz LL. Principles bone biology. (USA): Academic Press; 1996.         [ Links ]

2. Hauschka PV, Lian JB, Cole DEC, Gundberg CM. Osteocalcin and matrix gla protein-vitamin K-dependent proteins in bone. Physiol Rev. 1989; 69 (3): 990-1047.         [ Links ]

3. Alcain FJ, Buron MI. Ascorbate on cell-growth and differentiation. J Bioenerg Biomembr. 1994; 26 (4): 393-398.         [ Links ]

4. Geneser F. Histología. 3a edición, España, Ed. Panamericana. 2002.         [ Links ]

5. Glowacki J, Rey C, Cox K, Lian J. Effects of bone matrix components on osteoclast differentiation (Review). Connect Tissue Res. 1989; 20 (1-4): 121-129.         [ Links ]

6. Ducy P. Increased bone formation in osteocalcin deficient mice. Nature. 1996; 382 (6590): 448-452.         [ Links ]

7. Xiao G, Jiang D, Gopalakrishnan R, Franceschi RT. Fibroblast growth factor 2 induction of the osteocalcin gene requires MAPK activity and phosphorylation of the osteoblast transcription factor, Cbfa1/Runx2. J Biol Chem. 2002; 277 (39): 36181-36187.         [ Links ]

8. Kobayashi Y, Takagi H, Sakai H, Hashimoto F, Mataki S, Kobayashi K. Effects of local administration of osteocalcin on experimental tooth movement. Angle Orthod. 1998; 68 (3): 259-266.         [ Links ]

9. Hashimoto F, Kobayashi Y, Mataki S, Kobayashi K. Administration of osteocalcin acelerates orhodontic tooth movement induced by close coil spring in rats. Eur J Orthod. 2001; 23 (5): 535-45.         [ Links ]

10. Takano-Yamamoto T, Takemura T, Kitamura Y, Nomura S. Site-specific expression of mRNAs for osteonectin, osteocalcin, and osteopontin revealed by in situ hybridization in rat periodontal ligament during physiological tooth movement. J Histochem Cytochem. 1994; 42 (7): 885-896.         [ Links ]

 

Dirección de correspondencia:
Francisco Javier Marichi Rodríguez
E-mail: fmarichi@fo.odonto.unam.mx

 

Nota

Este artículo puede ser consultado en versión completa en http://www.medigraphic.com/facultadodontologiaunam

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License