SciELO - Scientific Electronic Library Online

 
vol.46 número7Antocianinas y actividad antioxidante en maíces (Zea mays L.) de las razas chalqueño, elotes cónicos y bolitaCrecimiento de vara perlilla (Symphoricarpos microphyllus H. B. K.) en respuesta a fertilización y altura de corte índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • No hay artículos similaresSimilares en SciELO

Compartir


Agrociencia

versión On-line ISSN 2521-9766versión impresa ISSN 1405-3195

Agrociencia vol.46 no.7 México oct./nov. 2012

 

Protección vegetal

 

Resistencia a fungicidas en poblaciones de Mycosphaerella fijiensis del sureste mexicano

 

Fungicides resistance on Mycosphaerella fijiensis populations of southeastern México

 

Luciano Martínez–Bolaños1, Daniel Téliz–Ortiz2, J. Concepción Rodríguez–Maciel2*, J. Antonio Mora–Aguilera2, Daniel Nieto–Ángel2, J. Isabel Cortés–Flores2, Dimas Mejía–Sánchez1, Cristian Nava–Diaz3, Gonzalo Silva–Aguayo3

 

1 Universidad Autónoma Chapingo. 56230. Chapingo, Estado de México, México.

2 Fitopatología. Campus Montecillo. Colegio de Postgraduados. 56230. Montecillo, Estado de México. *Autor responsable.

3 Universidad de Concepción, Facultad de Agronomía, Avenida Vicente Méndez 595, Casilla 537, Chillán, Chile.

 

Recibido: junio, 2012.
Aprobado: octubre, 2012.

 

Resumen

El control de Sigatoka negra (Mycosphaerella fijiensis Morelet) del banano (Musa acuminata Colla AAA) y plátano (Musa balbisiana Colla AAB) requiere de numerosas aplicaciones de fungicidas, principalmente de los grupos triazoles que inducen alta presión de selección en poblaciones del patógeno. El objetivo del presente estudio fue determinar la respuesta de cepas de M. fijiensis aisladas de plantaciones de banano de Tabasco y Chiapas, México, al propiconazol y tridemorf. Los bioensayos se realizaron en medio de cultivo Papa Dextrosa Agar (PDA®) adicionados con diferentes concentraciones del fungicida. Los medios se inocularon con 100 µL de una suspensión conidial y fragmentos miceliares del hongo, y se incubaron en oscuridad a 26 °C por 7 d. La concentración efectiva 50 (CE50) y 95 % (CE95) para cada aislamiento se estimó mediante análisis Probit del porcentaje de inhibición del crecimiento relativo del patógeno. Los valores CE50 en propiconazol variaron de 0.0001 a 0.95 mg L–1; y los de CE95 de 0.006 a 12.51 mg L–1. La proporción de resistencia en el nivel CE95 fue superior a 2085x, para el aislamiento MF–RmC2 de la finca Remedios en Teapa, Tabasco. Los valores para CE50 en tridemorf variaron de 0.00001 a 0.002 mg L–1 y los de CE95 de 0.03 a 0.85 mg L–1. La proporción de resistencia a nivel CE95 entre el aislamiento sensible de referencia y el menos susceptible (MF–RcC5 de la finca el Recreo, Tabasco) fue superior a 28.3x. La correlación positiva entre el número de aplicaciones y los valores de CE50 y de CE95 son indicativos de que la presión de selección ejercida en esta plantación generó resistencia al propiconazol.

Palabras clave: Sigatoka negra, propiconazol, tridemorf, banano, plátano.

 

Abstract

The control of black Sigatoka (Mycosphaerella fijiensis) of banana (Musa acuminate Colla AAA) and (Musa balbisiana Colla AAB) requires numerous applications of fungicides, mainly of the triazoles group that impose high selection pressure in populations of this pathogen. The aim of the this study was to determine the response of strains of Mycosphaerella fijiensis isolated from banana plantations of Tabasco and Chiapas, México, to propiconazol and tridemorph. The bioassays were carried out in potato dextrose agar (PDA®) culture medium added with different concentrations of these fungicides. The media were inoculated with 100 µL of a conidial suspension and mycelia fragments of the fungus, and incubated in darkness at 26 °C for 7 d. The effective concentration 50 (EC50) and 95 % (EC95) was estimated through Probit analysis of the percentage of inhibition of the relative growth of the pathogen. The EC50 values in propiconazol varied from 0.0001 to 0.95 mg L–1 and those of EC95 from 0.006 to 12.51 mg L–1. The resistance ratio at the level of EC95 was higher than 2085x, for the isolate MF–RmC2 of the Remedios plantation from Teapa, Tabasco. The values for EC50 in tridemorph varied from 0.00001 to 0.002 mg L–1 and those of EC95 from 0.03 to 0.85 mg L–1. The resistance ratio to level EC95 between the sensitive isolate of reference and the least susceptible (MF–RcC5 of the Recreo plantation, Tabasco) was higher than 28.3x. The positive correlation between the number of applications and the values of EC50 and of EC95 are indicative that the selection pressure exerted in this plantation generated resistance to the propiconazol.

Key words: Black Sigota, propiconazol, tridemorph, banana, plantain.

 

INTRODUCCIÓN

Mycosphaerella fijiensis Morelet (Anamorfo Pseudocercospora fijiensis) es el agente causal de la Sigatoka negra del banano (Musa acuminata Colla AAA) y plátano (Musa balbisiana Colla AAB) y es la principal enfermedad del banano (Churchill, 2011). El hongo causa lesiones foliares necróticas que se expanden y destruyen los tejidos, reduciendo la capacidad fotosintética, el volumen de producción e inducen la maduración del fruto (Stover, 1974; Chillet etal., 2009). El control de Sigatoka negra se apoya en el manejo integrado del cultivo que considera mejorar el drenaje del suelo, baja densidad de siembra (2000 plantas ha–1), balance nutricional de N, P y K para inducir resistencia fisiológica, control de maleza, eliminación de tejido enfermo que actúa como fuente de inóculo y combate químico (Marín et al., 2003; Orozco et al., 2008; Kablan et al., 2012). La aspersión profiláctica o terapéutica de fungicidas de contacto o sistémicos es indispensable en el programa de manejo de esta enfermedad, pero aumenta el costo económico y riesgo ambiental (Chin et al., 2001), por lo cual se debe implementar un programa de manejo de la resistencia para reducir el número de aplicaciones. En México, los fungicidas más usados son mancozeb y clorotalonil (preventivos), e ingredientes sistémicos de los grupos benzimidazoles, triazoles, estrobirulinas, y anilopirimidinas (Romero y Sutton, 1997). En Tabasco, México, el manejo químico de la Sigatoka negra requiere 48 a 52 aplicaciones de fungicidas por año, principalmente de mancozeb, propiconazol y tridemorf, por lo cual hay riesgo de desarrollo de resistencia del patógeno a estos agroquímicos (FRAC, 2010).

La resistencia a fungicidas es un factor crítico que limita la eficiencia de los programas de manejo integrado del hongo, al incrementar dosis o frecuencias de aspersiones. Varios estudios muestran la capacidad de M. fijiensis para desarrollar resistencia a fungicidas sistémicos de los grupos benzimidazoles (Fullerton y Tracey, 1984; Romero y Sutton, 1998), triazoles (Romero y Sutton, 1997; Pérez, et al., 2003) y estrobirulinas (Sierotzki, et al., 2000; Marín et al., 2003). En contraste, no se ha documentado cambios significativos en la respuesta a morfolinas, a pesar de ser un fungicida de uso antiguo para controlar Sigatoka negra en las principales zonas productoras de plátano y banano como Costa Rica y Ecuador. En México no hay estudios del grado de sensibilidad de M. fijiensis a los grupos toxicológicos de fungicidas (FRAC, 2010). Por tanto, el objetivo de esta investigación fue determinar la respuesta a los fungicidas propiconazol y tridemorf en poblaciones de M. fijiensis que afectan al banano cv Gran Enano en Tabasco y Chiapas.

 

MATERIALES Y MÉTODOS

Aislamiento e identificación de los aislamientos

El aislamiento de cepas de M. fijiensis se realizó del 2009 al 2010 en plantaciones del cv. Gran Enano, Subgrupo Cavendish, en Tabasco y Chiapas, y los sitios de recolección tenían diferentes programas de manejo químico (Cuadro 1). Las cepas se aislaron en el laboratorio de enfermedades de frutales del programa de Fitopatología del Colegio de Posgraduados, Campus Montecillo, mediante el método de descarga de ascosporas (Stover, 1976) incubando secciones necróticas de tejidos foliar de 1.0 cm a 26 °C/48 h en oscuridad. Los cultivos mono ascospóricos se obtuvieron en agua–agar al 3 % y se transfirieron a PDA (BioxonTM) para favorecer la esporulación sexual (Romero y Sutton, 1997). Las ascosporas se incubaron cuatro semanas en cajas petri a 26 °C en oscuridad para favorecer crecimiento miceliar y producción de conidios (Müller et al., 1997). Los aislamientos mono ascospóricos representativos se conservaron en tubos de ensayo con PDA a 4 °C.

Caracterización cultural y molecular de aislamientos

La verificación de la especie y caracterización morfológica de las ascosporas de aislamientos de M. fijiensis se realizó mediante las claves descritas por Hanlin (2000), Crous et al. (2007) y Arzanlou et al. (2008). Cada aislamiento mono ascospórico se incubó cuatro semanas a 26 °C. El ADN se extrajo del crecimiento miceliar con el método AP (Sambrook y Russell, 2001). La integridad del ADN se verificó por electroforesis mediante un gel de agarosa al 1 % a 80 V/40 min en amortiguador TBE teñido con bromuro de etidio. La identificación y confirmación de la especie se realizó con los iniciadores específicos MF137 (5'–GGCGCCCCCGGAGGCCGTCTA–3') (Johanson y Jeger, 1993) y universal ITS4 (5'–TCCTCCGCTTATTGATAT–GC–3') (White et al., 1990) para amplificar la región interna del transcrito (ITS) del rADN y producir fragmentos de 400 pb (Johanson y Jeger, 1993) en ocho aislamientos representativos. El proceso de PCR se desarrolló en un termociclador Mod 2720 (Applied Biosystems®) y la amplificación se desarrolló con 25 µL de una mezcla con 10 mM de cada iniciador, 10 mM dNTP, 10 x amortiguador de PCR, 50 mM MgCl2, 0.5 U Taq Polymerasa y 0.5 ng de ADN molde. La rutina de PCR fue una desnaturalización inicial de un ciclo de 95° C/ 5 min, 35 ciclos a 95 °C/ 1 min, 57° C/ 1 min y 72° C/ 1 min, con una extensión final de 72 °C/ 10 min. Los productos se separaron por electroforesis en gel de agarosa 1 % teñido con bromuro de etidio y visualizados en un transiluminador con luz UV. Se empleó un marcador molecular de 100 pb (Invitrogen®).

Concentración de fungicidas y efecto en el crecimiento micelial

Los bioensayos se realizaron con dos fungicidas de uso común para el manejo de Sigatoka negra: Tilt® 250 CE (Propiconazol, concentrado emulsionable, 250 g de i.a. L–1., Syngenta Agro S.A. de C.V.) y Calixin® CE (Tridemorf, concentrado emulsionable 860 g de i. a. L–1, Basf S. A. de C.V.). Los fungicidas se prepararon en agua destilada estéril en concentraciones de 0.0 (testigo), 0.000135, 0.00135, 0.0135, 0.135, 1.35, 13.5, y 135.00 µg i. a. mL–1. Después se agregaron 10 mL de la concentración respectiva en 190 mL de PDA y vaciaron en cajas petri. Cada tratamiento tuvo tres repeticiones y el experimento completo se repitió dos veces.

El estudio se realizó con 200 cepas de M. fijiensis; 25 por finca bananera en ocho plantaciones en Tabasco y Chiapas. El inóculo de cada cepa individual se preparó de colonias de 15 d de edad en PDA (Bioxon). El crecimiento micelial de cada caja se raspó con una varilla de vidrio y se colocó en tubos de ensayo con 10 mL de agua destilada estéril y 5 µL de Tween 20. La mezcla se homogeneizó con un agitador tipo vortex, se tomó una alícuota de 100 µL de la suspensión conidial y fragmentos miceliares y se dispersó con un asa bacteriológica sobre cajas petri con medio de cultivo PDA y se incubaron 7 d en oscuridad a 26 °C. Después, en cada concentración de fungicida se midió el diámetro (mm) de crecimiento micelial de 100 colonias formadas de fragmentos de micelio o conidios usando microfotografías y el programa Axiovision Carl Zeiss.

Análisis estadístico

El diseño experimental fue completamente al azar. La concentración efectiva 95 % (CE95), concentración efectiva 50 % (CE50), límites de confianza (LC) y proporción de resistencia (PR) se determinó mediante el procedimiento Probit (SAS Institute, 2003). La proporción de resistencia se obtuvo al dividir el valor de la CE95 de cada cepa fungosa con la del aislamiento sensible de M. fijiensis. La respuesta fue significativamente diferente cuando los LC al 95 % no exhibieron traslape (Robertson y Preisler, 1992). La correlación entre la CE95 y frecuencia de aplicaciones en campo de fungicidas sistémicos (Cuadro 1) para el manejo de Sigatoka negra se determinó usando el coeficiente de Pearson (SAS Institute, 2003).

 

RESULTADOS Y DISCUSIÓN

Aislamiento e identificación de aislamientos

Todos los aislamientos mono ascospóricos obtenidos por descargas de ascosporas a partir de de tejidos de hojas de banano con Sigatoka negra se identificaron como M. fijiensis. Las ascosporas fueron de coloración hialina, forma globosa y con un septo que forman dos células unidas, una de las cuales siempre fue ligeramente más abultada que la otra. El micelio fue de color blanco y apariencia algodonosa, redonda y de crecimiento lento. El reverso de la caja petri mostró un color negro con bordes blancos.

Caracterización molecular de aislamientos

La amplificación y secuenciación de la región ITS (Figura 1) del gen rADN de aislamientos representativos presentaron 100 % de similitud a la secuencia documentada por Johanson y Jeger (1993) para M. fijiensis.

Efecto del propiconazol y tridemorf en el crecimiento de M. fijiensis

Respuesta al propiconazol

La concentración efectiva 50 % (CE50) que presentó M. fijiensis a propiconazol fue de 0.0001 a 0.095 mg L–1 y la CE95 de 0.006 a 12.51 mg L–1. Los aislamientos de la finca Remedios de Tabasco tuvieron la mayor CE95, con valores de 9.49 a 12.51 mg L–1. Los aislamientos con mayor sensibilidad se presentaron en las fincas sin aplicación del fungicida (Cuadro 2). No hubo superposición de los LC a 95 % de mortalidad, por lo cual se consideraron significativamente diferentes los aislamientos de M. fijiensis respecto al aislamiento sensible. La mayor proporción de resistencia (PR) a nivel de CE95 se observó en el aislamiento MF–AlgC3 (> 2085×) (Cuadro 2). Estos resultados coincidieron con los de Romero y Sutton (1997) quienes caracterizaron la sensibilidad de M. fijiensis a propiconazol en Costa Rica, con valores de CE50 entre 0.06 y 0.05 mg L–1 para poblaciones con historial de aplicaciones de propiconazol y 0.008 mg L 1 en susceptibles, con un PR50 de 6.0× y 7.5×. De acuerdo con estos valores, sólo los aislamientos de M. fijiensis de la finca Remedios (Teapa, Tabasco), donde se aplicaron tres ciclos de fungicidas por año, pueden considerarse como resistentes a propiconazol mientras que en los restantes, donde se usa mayoritariamente mancozeb (Cuadro 1) son sensibles. Según Pérez et al. (2003), los niveles de sensibilidad a triazoles, como propiconazol, de poblaciones de M. fijiensis están en un CE50 de 0.0001 a 0.001 mg L–1, aunque la sensibilidad (CE50) disminuye en el tiempo entre 0.03 a 0.1 mg L–1 con una correlación lineal entre la pérdida de sensibilidad y el número de aplicaciones de triazoles. En 42 cepas de M. fijiensis provenientes de Ecuador, Brasil, Costa Rica, áfrica y sudeste de Asia hubo una gran variabilidad en la sensibilidad a triazoles, con CE50 <0.095 mg L–1 para poblaciones sensibles, y 0.18 – 0.39 y >0.90 mg L–1 para tolerantes y resistentes (Cañas et al. 2009). Las cepas resistentes se identificaron en países donde se realiza un alto número de aplicaciones de fungicidas por ciclo como Ecuador y Costa Rica (Marín et al., 2003).

Respuesta al tridemorf.

Los valores de la CE50 para los aislamientos de M. fijiensis fluctuaron entre 0.0001 mg L–1 y 0.002 mg L–1 y la CE95 entre 0.006 mg L–1 y 2.0 mg L–1. Los aislamientos de la finca Recreo (MF–RcC3 MF–RcC4 MF–RcC5) y Alegre (MF–AlgC5) presentaron la mayor CE95. Al no registrarse superposición de los límites de confianza a un 95 % de mortalidad, se consideró que existe diferencia estadística entre los aislamientos de M. fijiensis y el sensible. La PR a nivel CE95 entre el aislamiento sensible y el más tolerante fue superior a 28.3×, y correspondió al aislamiento MF–RcC3 (Cuadro 3).

Correlación entre variables

La correlación entre el número de aplicaciones de propiconazol en campo y el nivel de sensibilidad CE95 de los aislamientos de M. fijiensis fue significativa (r=0.8; p<0.0001). La correlación con el número de aplicaciones y los valores de proporción de resistencia a nivel de CE50 y de CE95 indican que los aislamientos de M. fijiensis de la plantación Remedios son resistentes al propiconazol (Figura 2A). La sensibilidad del hongo al propiconazol muestra una correlación lineal entre la pérdida de sensibilidad y el número de aplicaciones de triazoles (Pérez et al., 2003; Cañas et al. 2009), y en M. graminicola hay una correlación significativa entre las variaciones genéticas del patógeno y la presión de selección a fungicidas (Ware et al., 2006). Según Cañas et al. (2009) y Mullins et al. (2011), la resistencia de M. fijiensis a propiconazol y fungicidas inhibidores de la desmetilación (DMIs) se correlaciona con uno o más sitios de mutación de la secuencia del gen CYP51 (Y136F, A313G, Y461D, Y463H, Y463N y Y463S) que codifica a la enzima esterol 14 α–demethylasa, esencial en la biosíntesis del ergosterol el cual afecta la fluidez y permeabilidad de las células del hongo que es esencial para la sobrevivencia de la célula (Lepesheva y Waterman, 2004). Respecto a la CE95 para tridemorf, los aislamientos mostraron amplia variación en susceptibilidad. Entre el grado sensibilidad del hongo (CE95) y el número de aplicaciones de esta molécula realizadas para el control de M. fijiensis hubo una correlación positiva (r=0.82) (Figura 2B). Tridemorf es un fungicida del grupo de las morfolinas con actividad protectante y sistémica que inhibe la síntesis de ergosterol de tipo II sobre la Δ7–Δ 8 iomerasa y la C14 reductasa (Kerkenaar, 1995). No hay cambios significativos de resistencia de M. fijiensis a morfolinas, ya que son fungicidas de bajo riesgo de desarrollo de resistencia; además, su movimiento en musáceas es limitado, esencialmente traslaminar (Cronshaw et al. 1994). FRAC (2010) indica que tridemorf es un componente importante en las estrategias anti resistencia a benzimidazoles, estrobirulinas y triazoles.

El desarrollo de resistencia a fungicidas en poblaciones de M. fijiensis puede estar influenciado por factores genéticos, bioecológicos y operacionales como frecuencia inicial de alelos de resistencia, número y expresividad de los genes, duración de la generación, tasa epidémica de reproducción y uso de fungicidas. En este sentido, cuando se detecta resistencia del patógeno a un fungicida específico, dependiendo de su grado y estabilidad, éste debe restringirse o detener su uso por varios ciclos de cultivo y usar un fungicida alterno con diferente modo de acción y mecanismos de destoxificación (FRAC, 2010). Un programa fitosanitario exitoso apoyado en los fungicidas inhibidores de la dimetilación, estará en función de mantener un nivel bajo de la fuente de inóculo mediante prácticas culturales (Orozco et. al., 2008).

 

CONCLUSIONES

La correlación entre el número de aplicaciones y los valores de proporción de resistencia tanto a nivel de CE50 como de CE95 indicaron que los aislamientos de M. fijiensis de la plantación Remedios en Teapa, Tabasco, fueron resistentes al propiconazol; sin embargo, los demás aislamientos fueron susceptibles. Todos los aislamientos del hongo fueron susceptibles al tridemorf. Hubo una correlación significativa entre el número de aplicaciones en campo y el nivel de resistencia al propiconazol.

 

AGRADECIMIENTOS

A los productores de plátano y banano de México, y al CONACYT (FORDECYT No.116886) por el apoyo económico brindado para el desarrollo del presente trabajo de investigación. Se agradece el apoyo de la Línea Prioritaria de Investigación No. 7: Inocuidad, calidad alimentaria y bioseguridad, del Colegio de Postgraduados.

 

LITERATURA CITADA

Arzanlou, M., J. Z. Groenewald, R. A. Ullerton, E. C. A. Abel, J. Carlier, M. F. Zapater, A. Buddenhagen, and P. W. Crous. 2008. Multiple gene genealogies and phenotypic characters differentiate several novel species of Mycosphaerella and related anamorphos on banana. Persoonia 20: 19–37.         [ Links ]

Cañas, G. G. P., V. M. J. Angarita, F. J. M. Restrepo, P. Rodríguez, C. X. Moreno, and R. Arango. 2009. Analysis of the CYP51 gene encoded protein in propiconazole resistant isolates of Mycosphaerella fijiensis. Pest Manage. Sci. 65: 892–899.         [ Links ]

Chillet, M., C. Abadie, O. Hubert, Y. Ch. Chilin, and D. B. L. De Lapeyre. 2009. Sigatoka disease reduces the greenlife of bananas. Crop Protect. 28: 41–45.         [ Links ]

Chin, K. M., M. Wirz, and D. Laird. 2001. Sensitivity of Mycosphaerella fijiensis from banana to trifloxystrobin. Plant Dis. 85: 1264–1270.         [ Links ]

Churchill, A. C. L. 2011. Mycosphaerella ijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control. Molec. Plant Pathol. 12: 307–328.         [ Links ]

Cronshaw, K., G., Lorenz, and D. Mappes. 1994. Monitoring results of Mycosphaerella fijiensis to tridemorph. In: Heany S., D. Slawson, D. W. Holloman, M. Smith, P. E. Russell, and D. W. Parry. (eds). Fungicide Resistance. British Crop Protection Council Monograph No. 60. pp: 315–321.         [ Links ]

Crous, P. W., U. Braun, and J. Z. Groenewald. 2007. Mycosphaerella is polyphyletic. Studies Mycol. 58: 1–32.         [ Links ]

FRAC (Fungicide Resistance Action Committee). 2010. Fungicide use guidelines. 10th Meeting Working Group Bananas. Orlando, FLA, USA.         [ Links ]

Fullerton, R. A., and G. M. Tracey. 1984. Tolerance of Mycosphaerella fijiensis to benomyl and carbendazim in the Pacific Islands. Trop. Agric. (Trinidad). 61. 133–136.         [ Links ]

Hanlin, R. T. 2000. Illustrated Genera of Ascomycetes. Volume 1. The American Phytopathological Society, St. Paul, Minnesota, USA, 263 p.         [ Links ]

Johanson, A., and M. J. Jeger. 1993. Use of PCR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain. Mycol. Res. 97: 670–674.         [ Links ]

Kablan, L., Lagauche, A., Delvaux, B., and Legreve, A. 2012. Silicon reduces black Sigatoka development in banana. Plant Dis. 96(2): 273–278.         [ Links ]

Kerkenaar, A.1995. Mechanism of Action of Cyclic Amines Fungicides: Morpholines and Piperidines. Modern Selective Fungicides: Properties, Applications, Mechanism of Action. Verlag, Jena, Alemania. pp: 185–204.         [ Links ]

Lepesheva G., and M. Waterman. 2004. CYP51–the opmnipotent P450. Mol. Cell Endocrinol. 215: 165–170.         [ Links ]

Marín, D. H., R. A. Romero, M. Guzman, and T. B. Sutton. 2003. Black Sigatoka: an increasing threat to banana cultivation. Plant Dis. 87: 208–222.         [ Links ]

Müller, R., G. C. Pasberg, F. Gauhl, J. Ramser, and G. Kahl. 1997. Oligonucleotide fingerprinting detects genetic variability at different levels in Nigerian Mycosphaerella fijiensis. J. Phytopathol. 145: 25–30.         [ Links ]

Mullins, J. G. L., J. E. Parker, H. J. Cools, R. C. Togawa, J. A. Lucas, B. A. Fraaije, D. E. Kelly, and S. L. Kelly. 2011. Molecular modeling of emergence of zole resistance in Mycosphaerella graminicola. PLos ONE 6(6): e20973. 1–11.         [ Links ]

Orozco S., M., J. Orozco R., O. Pérez Z., G. Manzo S., L. Farías J., y M. Da Silva W. 2008. Prácticas culturales para el manejo de la Sigatoka negra en bananos y plátanos. Trop. Plant Pathol. 33: 189–196.         [ Links ]

Pérez L., A. Batlle, A. Hernández, M. Pérez, R. Trujillo, C. Álvarez, y A. Méndez. 2003. Evolución de la sensibilidad a fungicidas de las poblaciones de Mycosphaerella fijiensis Morelet en banano en Cuba. Fitosanidad 7: 49–54.         [ Links ]

Robertson, J. L., and Preisler, H. K. 1992. Pesticide Bioassays with Arthropods. CRC, Boca Raton, 127 p.         [ Links ]

Romero, R. A., and T. B. Sutton. 1997. Sensitivity of Mycosphaerella fijiensis, causal agent of Black Sigatoka of banana, to propiconazole. Phytopathology 87: 96–100.         [ Links ]

Romero, R. A., and T. B. Sutton. 1998. Characterization of benomyl resistance in Mycosphaerella fijiensis, cause of Black Sigatoka of banana, in Costa Rica. Plant Dis. 82: 931–934.         [ Links ]

Sambrook, J., and D. W. Russell. 2001. Molecular cloning. A Laboratory Manual. Third edition. 1: 1.32–1.34. Cold Spring Harbour Laboratory Press, New York.         [ Links ]

SAS Institute. 2003. Language guide for personal computer release 9.0 edition SAS Institute. Cary, North Caroline. USA. 1028 p.         [ Links ]

Sierotzki, H., S. Parisi, U. Steinfeld, I. Tenzer, S. Poirey, and U. Gisi. 2000. Mode of resistance to respiration inhibitors at the cytochrome bc1 enzyme complex of Mycosphaerella fijiensis field isolates. Pest Manage. Sci. 56: 833–841.         [ Links ]

Stover, R. H. 1974. Effect of measured levels of Sigatoka disease of bananas on fruit quality and leaf senescence. Trop. Agric. 51: 531–542.         [ Links ]

Stover, R. H. 1976. Distribution and cultural characteristic of the pathogens causing banana leaf spot. Trop. Agric. (Trinidad) 53: 111–114.         [ Links ]

Ware S., T. Diaz, G. Kema, T. Van der Lee, and M. de Waard. 2006. Aspects of sexual reproduction of Mycosphaerella species on wheat and barley: genetic studies on specificity, mapping and fungicide resistance. PhD thesis Wageningen University. The Netherlands, ISBN 90–8504–527–4. Chapter 5: 102–104; 114–119.         [ Links ]

White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetic. In: Inni, M. A., D. H. Gelfand, J. J. Sninski, and T. J. White (eds). PCR Protocols. A Guide to Method and Applications. Academic Press, San Diego, CA. pp: 315–322.         [ Links ]

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons