SciELO - Scientific Electronic Library Online

 
vol.42 número2Uso de trampas de luz fluorescente para el manejo de la gallina ciega (Coleoptera: Melolonthidae) en maíz (Zea mays L.)Organización social en la gestión de una fuente de agua: los jagüeyes índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Agrociencia

versão On-line ISSN 2521-9766versão impressa ISSN 1405-3195

Agrociencia vol.42 no.2 México Fev./Mar. 2008

 

Protección vegetal

 

Detección cuantitativa del virus psorosis de cítricos mediante RT–PCR tiempo real

 

Quantitative diagnosis of citrus psorosis virus by real time RT–PCR

 

Gabriela Barragán–Valencia1, Alberto Morales–Loredo2, M. Genoveva Álvarez–Ojeda2, M. Ángeles Peña–del Río1 e Isela Quintero–Zapata1

 

1 Instituto de Biotecnología. Facultad de Ciencias Biológicas. UANL. Avenida Pedro de Alba y Manuel L. Barragán S/N, Cd. Universitaria. 66450, San Nicolás de los Garza, Nuevo León, México.

2 INIFAP, Centro de Investigación Regional del Noreste, Km 4.5 Carretera a Reynosa–Guadalupe, Nuevo León, México. 67100. (morales.alberto@inifap.gob.mx)

 

Recibido: Abril, 2007.
Aprobado: Enero, 2008.

 

Resumen

La RT–PCR tiempo real es útil para detectar el virus psorosis de cítricos (CPsV) y además permite evaluar la concentración viral que se puede usar para estudiar algunos aspectos de la enfermedad. En este trabajo se implementó un protocolo de RT–PCR tiempo real para la detección cuantitativa del CPsV, por lo que se diseñó un conjunto de iniciadores y una sonda Taqman con fundamento en una secuencia de 559 bases del gen responsable de la síntesis de la proteína de la cápside del CPsV procedente de tejido infectado de un árbol de campo. En el desarrollo de la curva estándar se obtuvo una R2 = 0.998 de la cantidad de ARN molde con respecto a los valores de CT y eficiencia de amplificación de 94.5%. Se determinó la concentración viral en muestras de campo y se encontró que la presencia del virus en los árboles no es uniforme; solo se detectó el virus en 40% de las muestras analizadas. También se trabajó en invernadero con una planta inoculada con el virus y se detectó el virus en cada determinación.

Palabras clave: CPsV, concentración viral, descortezamiento, manchas anulares, RT–PCR.

 

Abstract

Real time RT–PCR is useful for detecting citrus psorosis virus (CPsV) and also permits the evaluation of the viral concentration that can be used to study some aspects of the disease. In this study a protocol of real time RT–PCR was implemented for the quantitative detection of CPsV, for which a group of primers were designed along with a Taqman probe based on a sequence of 559 bases of the gene responsible for the synthesis of the capsid protein of CPsV from the infected tissue of a field tree. In the development of the standard curve, a R2 = 0.998 was obtained of the amount of mold RNA with respect to the values of CT and amplification efficiency of 94.5%. Viral concentration was determined in field samples and it was found that the presence of the virus in the trees is not uniform; the virus was detected in only 40% of the samples analyzed. Work was also carried out in the greenhouse with a plant inoculated with the virus, and the virus was detected in each determination.

Key words: CPsV, viral concentration, bark peeling, ring spots, RT–PCR.

 

INTRODUCCIÓN

El virus psorosis de los cítricos (CPsV) consiste de una partícula espiral filamentosa de ARN de polaridad negativa, cubierta por monómeros de una proteína de 48 kDa (Derrick et al., 1988) y afecta árboles de cítricos (naranja, pomelo, mandarina) pero es raro que afecte árboles de limón agrio. Este virus provoca en los árboles un descortezamiento en troncos y ramas principales, manchas en forma de anillo en hojas y frutos, pérdida de vigor y productividad. La enfermedad es de avance muy lento ya que los síntomas se manifiestan por lo menos 10 años después de la inoculación (Fawcett 1933). La psorosis se encuentra en las principales regiones citrícolas del mundo y es considerada un factor limitante de la producción.

El diagnóstico tradicional del CPsV es el de injerto en plantas, requiere 2 a 3 meses para obtener resultados, un espacio y condiciones de invernadero. Las técnicas moleculares permiten una detección rápida y oportuna del virus, principalmente la serología y la RT–PCR (transcripción inversa–reacción en cadena de la polimerasa). Mediante RT–PCR en tiempo real se detectan virus, se evalúa la concentración viral que es un indicador del grado de infección de una enfermedad, se conoce si una infección está activa y se obtiene información de la interacción huésped–virus (Mackay et al., 2002). Dado que se considera el RT–PCR en tiempo real una metodología fidedigna en la detección de patógenos que permitirá cuantificar la concentración viral del virus psorosis de cítricos, los objetivos del presente estudio fueron implementar un protocolo de RT–PCR tiempo real para la detección del CPsV y determinar concentración viral en hojas de árboles de naranja Mars afectados por psorosis en el Estado de Nuevo León (NL), México.

 

MATERIALES Y MÉTODOS

En la huerta GT01, municipio de General Terán, NL, se tomaron muestras de hojas de 10 árboles de naranja Mars afectados por el CPsV (denominados GT01 2–15, 3–5, 3–10, 4–17, 5–14, 6–17, 10–12. 11–20, 16–11 y 16–14), con síntomas típicos de descortezamiento en el tronco y en los que previamente se detectó el CPsV mediante RT–PCR convencional. La toma de muestras en cada árbol fue al azar, el 28 de marzo del 2006. Se tomaron también muestras de una planta de invernadero de naranja Valencia inoculada con el CPsV que forma parte de la colección del Instituto Nacional de Investigaciones, Forestales, Agrícolas y Pecuarias (INIFAP), en el Campo Experimental General Terán, NL. Estas muestras fueron el testigo y la planta estaba en condiciones de humedad y temperatura estables. Las hojas de cada árbol y de la planta testigo se lavaron, secaron y almacenaron a —20 °C hasta hacer las extracciones de ARN.

Obtención de un estándar de concentración de ARN

Se extrajo ARN en hojas de la planta de invernadero y de un árbol de campo, usando el reactivo comercial TRIzol (Molecular Research Center, Inc., Monterrey, NL, México) siguiendo el procedimiento recomendado por el fabricante. En las extracciones de muestras de campo se usó 0.10 g de tejido y la pastilla de ARN obtenida se resuspendió en 30 mL de agua libre de ribonucleasas.

En la muestra de invernadero y de un árbol de campo se amplificaron, mediante la RT–PCR en un solo paso, fragmentos de 600 pb que corresponden al gen de la proteína de la cápside. Para la reacción de RT–PCR se usaron 10 µL del extracto de ácidos nucleicos, 25 µL de mezcla de reacción (solución amortiguadora con una concentración 0.4 mM de cada dNTP y 2.4 mM de MgSO4), 12 µL de agua mQ estéril, 1 µL de iniciadores en solución (20 µM) y 1 µL de mezcla de enzimas RT/Taq Platinium® (InvitrogenTM). La secuencia de iniciadores usados fue: 5'–GCTTCC TGGAAAAGCTGATG–3' para el iniciador en la dirección sentido y 5'–TCTGTTTTTGTCAACACACT CC–3' para el iniciador en la dirección antisentido (Barthe et al., 1998). La reacción se efectuó en un termociclador Mini cyclerTM (MJ Research, Inc. USA). El protocolo de la reacción consistió en el paso de RT de 30 min a 50 °C seguido de una desnaturalización a 94 °C por 30 s; y luego 35 ciclos 94 °C por 15 s, 50 °C por 30 s, y 72 °C por 1 min, y una extensión final a 72 °C por 10 min. Los fragmentos amplificados se purificaron usando una matriz de sílica contenida en el kit para purificación de ADN (QIAGEN, Inc., USA). El fragmento de 600 pb obtenido de la muestra de campo se clonó en el vector TOPO PCR®4 y se insertó en células competentes de Escherichia coli TOPO TA. Se hicieron cultivos de la cepa transformada en medio Luria Bertani (LB) con ampicilina (50, µg mL–1). Se obtuvieron paquetes celulares desde los cultivos y se hicieron extracciones de ADN plásmido (kit para purificación del ADN del plásmido QIAGEN, Inc., USA). El plásmido purificado se digirió con la enzima Pvu II y se hizo la transcipción in vitro de un fragmento híbrido de 797 pb (formado por una parte de la secuencia del vector TOPO y el fragmento de 600 pb), bajo el control de la ARN polimerasa T3. El ADN residual en el producto de la transcripción se eliminó por la adición de ADNasa I. El ARN obtenido se cuantificó usando el kit de Ribogreen (InvitrogenTM) por fluorometría.

Diseño de iniciadores y sonda Taqman para RT–PCR tiempo real

Se obtuvieron las secuencias de fragmentos de 559 nt de la muestra de campo y de la planta de invernadero. La secuencia obtenida con la muestra de campo se analizó mediante el programa Primer Express® Software v2.0. Con base en los resultados de este análisis se seleccionó un conjunto de iniciadores y sonda atendiendo las características de contenido de guanina–citosina (GC), temperaturas de desnaturalización (Tm) y la no formación de dímeros. La secuencia de la sonda fue: FAMCAAGCAAAAGTTGTCCCCTM GBNFQ, y de los iniciadores: 5'–GGGTTTGCG AGCAGTTTTCA–3' y 3'–GATTCAGGAGTTGCACC AACAG–5'. En las RT–PCR tiempo real se amplificó un fragmento de 79 pb.

Optimización de la concentración de los iniciadores y de la sonda diseñados para RT–PCR tiempo real

Se evaluaron concentraciones de sonda Taqman de 100, 150 y 250 nM, y de los iniciadores de 150, 250 y 500 nM en la RT–PCR tiempo real.

Detección cuantitativa del CPsV

En los experimentos de detección cuantitativa del CPsV se hicieron curvas estándares de RT–PCR tiempo real. Se obtuvieron curvas de calibración con cinco muestras estándar por duplicado del ARN transcrito in vitro, cuantificado por fluorometría de concentraciones de ARN de: 5 X 10–2, 5 X 10–3, 5 X 10–4, 5 X 10–5 y 5 X 10–6 ng; que corresponden a 1.24X108, 1.24 X107, 1.24X106, 1.24X105 y 1.24X104 número de genomas virales. El número de genomas virales se calculó considerando el peso molecular (PM) del ARN transcrito in vitro (dado que su longitud es 797 rNTP's, el PM es 241,491), y el número de Avogadro.

Detección cuantitativa del CPsV en muestras de campo

Para las reacciones de RT–PCR se utilizaron 9 mL de la extracción de ARN de plantas de campo, una concentración de sonda Taqman de 150 nM y de los iniciadores de 250 nM. Se usaron los reactivos del Mix Master Taqman Applied Biosystem para RT–PCR tiempo real para un volumen de reacción de 20 mL. La RT–PCR se hizo en un equipo 7300 Real Time PCR System (Applied Biosystem Inc.,USA). El programa consistió en un primer paso a 50 °C por 30 min, seguido por 95 °C por 10 min y 40 ciclos de desnaturalización a 95 °C por 15 s y extensión a 60 °C por 1 min. Se empleó una muestra de un árbol sano como testigo negativo de la RT–PCR; además se manejó un blanco (mezcla de reactivos sin ARN).

Se hicieron dos ensayos de determinación de concentración viral en los 10 árboles evaluados. En el primero se hicieron detecciones cuantitativas en tres diferentes muestras de una sola hoja de cada árbol, mientras que en el segundo las detecciones fueron en tres muestras de diferentes hojas para cada árbol. Las muestras se tomaron al azar de las hojas en cada árbol.

 

RESULTADOS Y DISCUSIÓN

Obtención de un control positivo para RT–PCR tiempo real

Se amplificaron los fragmentos de 600 pb del gen de la proteína de la cápside del CPsV en la muestra de campo y de la planta de invernadero mediante la reacción de RT–PCR en un solo paso. Dicho procedimiento es una simplificación del reportado por Barthe et al. (1998) con la ventaja de ser un protocolo más rápido y práctico.

El fragmento obtenido de la planta de invernadero se clonó en células competentes de E. coli usando el vector TOPO PCR®4. Su presencia en el plásmido se confirmó mediante digestión enzimática. En la transcripción del vector TOPO con el inserto se obtuvo el fragmento de ARN del tamaño esperado. Esta estrategia para obtener estándares de concentración del ARN viral como testigos de cuantificación para RT–PCR tiempo real tuvo resultados satisfactorios, al igual que en otros estudios (Laue et al., 1999; Tang–Nelson y Lightner, 2001).

Las secuencias obtenidas de los fragmentos de 559 nt con la muestra de campo y de la planta de invernadero se presentan en la Figura 1. Estas dos secuencias tienen 98 % de similitud entre si y coinciden en 547 de 559 bases. Las diferencias entre las dos secuencias se encuentran en las posiciones 28, 29, 30, 38, 39, 69, 120, 333, 334, 402, 495 y 507. El análisis BLAST de las secuencias de 559 nt obtenidas con respecto a las reportadas en el Centro Nacional de Información de Biotecnológica (NCBI, www.ncbi.nlm.nih.gov/BLAST), reveló que estas secuencias tienen una mayor similitud (99–96%) con las reportadas por Alioto et al. (2003) Loconsole et al. (2006) y Martín et al. (2005), pero menor (85%) con las reportadas por Sánchez et al. (1998) y Barthe et al. (1998). Esto probablemente se debe a que las secuencias se obtuvieron de ARN viral de árboles que muestran síntomas de descortezamiento en tronco y manchas en hojas jóvenes, al igual que los árboles descritos por los primeros autores. En tanto que los árboles descritos por Barthe et al. (1998) y Sánchez de la Torre et al. (1998) muestran, además del descortezamiento, manchas anulares en hojas y frutos (psorosis del tipo B según clasificación de Fawcett y Klotz, 1938)). Con base en lo anterior se puede considerar que los árboles evaluados están afectados por Psorosis A.

Es importante mencionar estos resultados por la diferencia molecular (en la secuencia de 559 nt analizada) entre los virus que provocan los dos tipos de psorosis. Además, es necesario considerar las diferencias en bases en la detección del CPsV mediante RT–PCR, debido a que afecta la eficiencia de amplificación por diferencias entre los iniciadores y la secuencia blanco.

El análisis BLAST en NCBI de la secuencia de 79 pb amplificada por el protocolo de RT–PCR tiempo real, mostró que es una secuencia conservada en cinco de las secuencias que se reportan en este banco de genes. Tiene una similitud de 99% con nueve secuencias de las reportadas, un 98% con seis aislamientos y con sólo tres secuencias reportadas del CPsV tiene un porcentaje de similitud entre 85 y 94%. Así, es muy probable que este conjunto de iniciadores y sonda Taqman den resultados similares en la detección de otros aislamientos del CPsV.

Detección cuantitativa del CPsV en muestras de campo

En las curvas estándares R2 fue 0.998 y la eficiencia en la amplificación fue 94.1 % cada vez que se hizo la determinación, lo que indica una mayor homogeneidad (Cuadro 1 y 2). Se considera que mediante el protocolo implementado se cuantifica la concentración viral hasta un orden de 103, porque cuando las muestras estándares tienen una concentración de un orden menor de 103 el valor de R2 es menor a 0.98; por tanto, hay una mala correlación entre los valores de CT y la cantidad de ARN presente en las muestras. Los valores de R2 y eficiencia, así como el intervalo de concentraciones usadas en las muestras estándares, son equiparables con los reportados para protocolos de RT–PCR tiempo real (Laue et al., 1999; Martell et al., 1999 y Niesters et al., 2000).

En la detección de concentración viral en el ensayo donde se usaron tres diferentes muestras de una misma hoja para cada árbol se detectó el virus en cuatro árboles, pero al usar tres diferentes muestras de diferentes hojas para cada árbol se detectó el virus en nueve de los árboles evaluados. Por tanto, se considera que la distribución del virus en los árboles de campo no es uniforme. Para la planta de invernadero los valores de concentración viral fueron 104 y en cada determinación se detectó concentración viral, lo que indica una mayor homogeneidad del virus en la planta de invernadero en comparación con los árboles de campo.

En las muestras de campo se detectó el virus en 4 de cada 10 muestras analizadas, lo que puede atribuirse a las condiciones ambientales de los tejidos afectados y al grado de desarrollo de la patología. Hay reportes de detección del virus en muestras de campo por serología (Alioto et al., 1999 y Martín et al., 2002), donde se señala también la dificultad de este proceso en muestras de campo.

El empleo de RT–PCR tiempo real en la detección cuantitativa del CPsV es una herramienta de estudio de la psorosis para la determinar concentración viral en árboles afectados en campo, en diferentes épocas del año, en diferentes tejidos de los árboles (corteza, madera, varetas, frutos, etc.) y variedades de cítricos.

 

CONCLUSIONES

Las secuencias obtenidas de 559 nt tienen una mayor similitud con las reportadas para aislamientos procedentes de árboles que muestran el síntoma de descortezamiento en troncos, pero una menor similitud con las que proceden de árboles que muestran manchas anilladas en frutos.

Se detectó una concentración viral de 103 a 105 números de genomas virales del CPsV en 9 mL del ARN obtenido.

Las determinaciones de concentración viral en árboles de campo mostraron que la distribución del virus no es uniforme en los árboles, mientras que en la planta de invernadero hay una mayor homogeneidad del virus.

En muestras de campo se obtuvo 40% de sensibilidad en la detección, mientras que para la planta de invernadero se determinó concentración viral en cada muestra analizada.

 

LITERATURA CITADA

Alioto, D., M. Gangemi, S. Deaglio, P. Sposato, E. Noris, E. Luisoni, and R. G. Milne. 1999. Improved detection of citrus psorosis virus using polyclonal and monoclonal antibodies. Plant Pathol. 48:735–741.        [ Links ]

Alioto, D., M. Malfinato, A. Troisi, A. Peluso, S. Martín, R. Milne, G. J. Guerri, and P. Moreno. 2003. Variability of the coat protein gene of citrus psorosis virus in Campania, southern Italy. Arch. Virol. 148 (11): 2155–2166.        [ Links ]

Barthe, G., A. Ceccardi T., L. Manjunath K., and K. Derrick S. 1998. Citrus psorosis virus: nucleotide sequencing of the coat protein gene and detection by hybridization and RT–PCR. General Virol. 79: 1531–1537.        [ Links ]

Derrick K., S, R. Brlansky, H. da Graca J., V. Lee R., F. Timmer L., and T. Nguyen K. 1988. Partial characterization of a virus associated with citrus ringspot. Phytopathology 78 (10): 1298–1301.        [ Links ]

Fawcett H., S. 1933. Is psorosis of citrus a virus disease. Phytopathology 24:658–668.        [ Links ]

Fawcett H., S., and L. Klotz J. 1938. Types and symptoms of psorosis and psorosis–like diseases of citrus. Phytopathology 28: 670 (abstr.).        [ Links ]

Laue, T., P. Emmerich, and H. Schmit. 1999. Detection of dengue virus RNA impatients after primary or secondary dengue infection by using the TaqMan automated amplification system. J. Clin. Microbiol. 37: 2543–2547.        [ Links ]

Loconsole, G., M. Castellano, M. Dell'Orco, D. Boscia, and V. Savino. 2006. Serological detection of citrus psorosis virus by a polyclonal antiserum to recombinant virus coat protein. J. Plant. Pathol. 88 (3, Supplement): 577–578.        [ Links ]

Mackay, I., M. Arden K., and E. Nitsche A. 2002. Survey and summary real–time PCR in virology. Nucleic Acids Res. 30 (6): 1292–1305.        [ Links ]

Martell, M., J. Gómez, J. Esteban, I. Sauleda S., J. Quer, B. Cabot, R. Esteban, and J. Guardia. 1999. High–troughput real–time reverse transcription–PCR quantitation of hepatitis C virus RNA. J Clin. Microbiol. 37: 327–332.        [ Links ]

Martín S., D. Alioto, R. G. Milne, J. Guerri, and P. Moreno. 2002. Detection of citrus psorosis virus in field trees by direct tissue blot immunoassay in comparison with ELISA, symptomatology, biological indexing and cross–protection test. Plant Pathol . 51: 134–141.        [ Links ]

Martín, S., C. López, M. L. García, G. Naum–Onganía, O. Grau, R. Flores, P. Moreno, and J. Guerri. 2005. The complete nucleotide sequence of a Spanish isolate of citrus psorosis virus: comparative analysis with other ophioviruses. Arch. Virol. 150: 167–176.        [ Links ]

Niesters, H. G., J. van Esser, E. Fries, K. Wolthers C., J. Cornelissen, and A. Osterhaus D. 2000. Development of a realtime quantitative assay for detection of Epstein–Barr virus. J. Clin. Microbiol. 38: 712–715.        [ Links ]

Sánchez, de la T., M. Riva O., R. Zandomeni, O. Grau, and M. L. García. 1998. The top component of citrus psorosis virus contains two ssRNAs, the smaller encodes the coat protein. Molecular Plant Pathol. Disponible en: http://www.bspp.oçrg.uk/mppol/1998/1019sanchez/paper.htm. Fecha de consulta: mayo del 2007.        [ Links ]

Tang–Nelson, K., and D. V. Lightner. 2001. Development of realtime PCR assays for detection of white spot syndrome virus, yellow head virus, Taura syndrome virus, and infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp. Disponible en: www.nmfs.noaa.gov/mblsk/saltonstallken/whitespot_final.PDF. Fecha de consulta: mayo del 2007.        [ Links ]

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons