SciELO - Scientific Electronic Library Online

 
vol.42 número1Análisis temporal de la pudrición blanca (Sclerotium cepivorum Berk.) de la cebolla (Allium cepa L.) bajo tres niveles de inóculo del patógenoAnálisis de la expresión transcripcional inducida bajo condiciones de estrés biótico y abiótico en Capsicum chinense BG-3821 índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • No hay artículos similaresSimilares en SciELO

Compartir


Agrociencia

versión On-line ISSN 2521-9766versión impresa ISSN 1405-3195

Agrociencia vol.42 no.1 México ene./feb. 2008

 

Protección vegetal

 

Estructura poblacional de aislamientos del citrus tristeza virus y su asociación con la muerte súbita de los cítricos en Brasil

 

Population structure of citrus tristeza virus isolates and its association with citrus sudden death in Brazil

 

Patricia Rivas–Valencia1, Emiliano Loeza–Kuk1, Gustavo Mora–Aguilera1, Vicente Febres 2, Daniel Ochoa–Martínez1, Ma. Alejandra Gutiérrez–Espinosa3, Waldir Cintra de Jesus–Junior4, Celia Correia–Malvas5 y Nelson Arno–Wulff 5

 

1 Fitopatología Campus Montecillo. Colegio de Postgraduados. 56230. Montecillo, Estado de México. (morag@colpos.mx).

2 University of Florida, Gainesville, FL, USA.

3 Fruticultura. Campus Montecillo. Colegio de Postgraduados. 56230. Montecillo, Estado de México.

4 UFES, CEP 29500–000, Alegre, ES, Brasil.

5 FUNDECITRUS A.C. CEP 14807–040, Araracuara, SP, Brasil.

 

Recibido: Julio, 2006.
Aprobado: Noviembre, 2007.

 

Resumen

Se desconoce la etiología de la enfermedad muerte súbita de los cítricos (MSC) y su relación con una variante severa del virus tristeza de los cítricos (Citrus tristeza virus, CTV). Para estudiar una posible relación se estudiaron cinco poblaciones de 100 árboles cada una, en regiones con y sin presencia MSC, en huertas comerciales de los estados de São Paulo y Minas Gerais, Brasil. En las huertas con MSC se observó decoloración foliar, defoliación, crecimiento vegetativo reducido y eventualmente muerte del árbol. El objetivo de este estudio fue caracterizar la estructura poblacional de aislamientos de CTV presentes en ambas regiones con el fin de asociar etiológicamente al CTV con la MSC. Únicamente 96/500 muestras amplificaron para el gen de la capa proteica (CP) del CTV, las que fueron sometidas a hibridación con sondas específicas y a un análisis de conformación polimórfica de cadena simple de ADN (single–strand conformation polymorphism, SSCP). Los porcentajes de hibridación con sondas específicas para aislamientos severos de CTV fueron 79.60% y 84.67% en la región con y sin MSC, por lo que no se encontró una asosiación definitiva de aislamientos severos con MSC. El análisis SSCP determinó la presencia de hasta cinco haplotipos en un solo árbol en regiones con MSC, y hasta siete en regiones sin MSC. No se encontró un patrón dominante. El análisis de varianza molecular (AMOVA) mostró una mayor variación dentro de poblaciones que entre regiones, lo que indica una estructura poblacional heterogénea con origen local. Con los datos obtenidos no se determinó una relación directa entre aislamientos severos de CTV y la MSC, pero tampoco se descartó la posible función del CTV en el nuevo síndrome.

Palabras clave: Hibridación, sondas específicas, SSCP.

 

Abstract

The etiology of citrus sudden death (CSD) and its relationship with a severe variant of the citrus tristeza virus (citrus tristeza virus, CTV) is unknown. To discover a possible relationship, a study was made of five populations of 100 trees each one, in regions with and without CSD presence, in commercial groves of the states of São Paulo and Minas Gerais, Brazil. In the groves with CSD, foliar discoloration was observed, along with defoliation, reduced vegetative growth and eventually tree death. The objective of the present study was to characterize the population structure of CTV isolates present in both regions with the purpose of etiologically associating CTV with CSD. Only 96/ 500 amplified for the gene of the coat protein (CP) of the CTV, which were subjected to hybridation with specific probes and to an analysis of single–strand conformation polymorphism (SSCP). The percentages of hybridation with specific probes for severe CTV isolations were 79.60% and 84.67% in the region with and without CSD. Therefore, no definite association was found of severe isolations with CSD. The SSCP analysis determined the presence of up to five haplotypes in a single tree in regions with MSC, and as many as seven in regions without CSD. A dominant pattern was not found. The analysis of molecular variance (AMOVA) showed a greater variation within populations than among regions, which indicates a heterogeneous population structure with local origin. With the data obtained, no direct relationship was determined between severe CTV isolates and CSD, but the possible involvement of CTV in the new syndrome was not discarded.

Key words: Hybridation, specific probes, SSCP.

 

INTRODUCCIÓN

La tristeza de los cítricos, ocasionada por el Citrus tristeza virus (CTV), es producto de una población constituida por distintos aislamientos biológicamente dinámicos (Weng et al., 2007; Huang et al., 2004). El virus, detectado en Brasil en 1934, ha causado la muerte de más de 100 millones de árboles en América del Sur, Estados Unidos de Norteamérica, Israel y España (Müller et al., 2000; Cambra et al., 2000). El CTV puede encontrarse en todas las especies y variedades de cítricos en Brasil por su carácter endémico y por los programas intensivos de protección cruzada (Souza et al., 2002; Müller et al., 2000). En 1999 se reportó un síndrome denominado muerte súbita de los cítricos (MSC) en 500 árboles de naranjo dulce (Citrus sinensis) injertados en limón cravo (C. limonia), una de las combinaciones más exitosas para el control genético del CTV (Bassanezi et al., 2003). Actualmente la MSC ha afectado a más de 2 millones de árboles. Los síntomas y el progreso epidemiológico de la MSC son análogos al declinamiento de los cítricos, causado por aislamientos severos del CTV (Jesus–Junior y Bassanezi, 2004; Bassanezi et al., 2003). La hipótesis propuesta es que el agente causal de la MSC es una variante nueva del CTV (Bassanezi et al., 2003).

En México no existe la MSC ni aislamientos severos del CTV con alta prevalencia; sin embargo, el riesgo de epidemias de alta intensidad ante la introducción de Toxoptera citricida, el vector más eficiente de variantes severas del CTV, obliga a estudiar los mecanismos intrínsecos del patógeno para adaptarse e inducir nuevas epidemias y mitigarlas mediante los principios de exclusión y erradicación. Con este fin se realizó el presente trabajo en las condiciones de Brasil, con el objetivo de efectuar un estudio comparativo a nivel molecular de la estructura poblacional del CTV, en regiones con aislamientos de tipo severo, y con presencia y ausencia de MSC para contribuir al entendimiento etiológico y epidémico de la MSC.

 

MATERIALES Y MÉTODOS

Ubicación del área de estudio

El estudio se hizo de septiembre a noviembre de 2005. Se realizaron muestreos con ayuda de personal de campo de FUNDECITRUS A.C.6 en cinco huertas comerciales ubicadas en los estados de São Paulo (SP) y Minas Gerais (MG). En la región de SP los árboles mostraban síntomas de tristeza (picado de tallo) y presencia de aislamientos severos y moderados de CTV. Éstos se detectaron previamente por FUNDECITRUS A.C. En las huertas de MG se observó la presencia de MSC (Cuadro 1).

El muestreo se enfocó a árboles con síntomas de declinamiento, según la escala de severidad propuesta por Bassanezzi et al. (2003). De los 500 árboles se recolectaron hojas jóvenes (última brotación) en los cuatro puntos cardinales a una altura promedio de 1.50 m, para su procesamiento molecular en las instalaciones de FUNDECITRUS A.C.

Extracción de RNA y RT–PCR de un paso para la amplificación parcial y total de la capa proteica (CP)

Se usó Trizol® Reagent (InvitrogenTM) para la extracción de RNA total de cada muestra (100 mg de hoja fresca), según protocolo del fabricante (Cat. No. 15596–018). La amplificación de la CP total por RT–PCR de un paso se realizó con 5 µL de RNA total precalentado 5 min a 65 °C, mezclado en un volumen final de 50 µL usando 10 X PCR buffer, 2.5 mM de MgCl2, 0.1 mM de DDT, 200 µM de dNTP's, 0.5 µL (100 ng/µL–1) de los iniciadores HCP1 5' ATGGACGACGAAACAAACAA3' y HCP2 5' TCAACGTGTGTT GAATTTCC 3' (Huang et al., 2004), 20 unidades de RNAseout (InvitrogenTM), 50 unidades de M–MLV transcriptase reversa (InvitrogenTM) y 1.25 unidades de Taq DNA Polymerase (PromegaTM). La RT–PCR se hizo con un ciclo de 60 min a 42 °C, 35 ciclos de 1 min a 94 °C, 1 min a 55 °C y 1 min a 72 °C y un periodo de extensión final de 10 min a 72 °C. El producto de la amplificación (672 pb) se analizó en gel de agarosa a 1 % teñido con bromuro de etidio. También se amplificó una parte del gen p25 que codifica a la CP en el extremo 3' (273 pb) con 0.5 µL (100 ng/µL-1) de los iniciadores específicos CPKF 5' AACGCCCTTCGAGTCTGGGG TAGGA3' y CPKR 5'TCAACGTGTGTTGAATTTCCCAAGC 3' (Kong et al., 2000). El producto de la amplificación se analizó en gel de agarosa a 1% teñido con bromuro de etidio.

Análisis SSCP

El SSCP (single–strand conformation polymorphism) detecta mutaciones y cambios puntuales de bases en fragmentos de ADN del mismo tamaño (polimorfismo) (Kong et al., 2000). La identificación de los patrones de SSCP se realizó a partir del producto de PCR de parte del gen p25 de la CP (273 pb). Se tomaron 5 µL del producto de amplificación y se desnaturalizó por 10 min a 99 °C en un volumen de solución desnaturalizante (95 % formamida, 20 mM EDTA, bromofenol azul y xilencianol). Los fragmentos se separaron mediante electroforesis en gel de poliacrilamida al 12% en una cámara BIORAD Protean II (16 x 20cm X 1mm) con amortiguador TBE 1 X a 200 v por 2 h 30 min a temperatura ambiente (TA); el gel fue teñido con plata según el protocolo de Beidler et al. (1982).

Síntesis y marcaje de sondas

Para evaluar la estructura poblacional y detectar la prevalencia de aislamientos que pudieran ser responsables de la etiología de la MSC, se sintetizaron seis oligonucleótidos que se utilizaron como sondas y que fueron diseñados a partir de diferencias de bases en la capa proteíca de los aislamientos originarios de diferentes regiones geográficas (Cevick et al., 1996) (Cuadro 2). El marcaje de las sondas se realizó con digoxigenina (DIG) con 'DIG DNA Labeling Kit', (RocheTM), con el protocolo del fabricante. Estas sondas no habían sido utilizadas en Brasil para este tipo de estudio.

Dot blotting, hibridación y revelado

El producto obtenido de PCR con los iniciadores HCP1 y HCP2 se diluyó con 10X SSC para obtener un volumen final de 50 µL. Se colocó las muestras en una membrana de nylon (Hybond N+) con un aparato para dot blot (GibcoTM). Se desnaturalizó al DNA incubando la membrana en 0.4 M NaOH por 10 min a TA con agitación suave (AS). Posteriormente se incubó la membrana en 0.2 M Tris–Cl pH 8.0, 0.1 % SDS y 1X SSC a TA por 10 min. Después se fijó el DNA de la membrana con rayos ultravioleta. Se prepararon 4 membranas de 9X 12 cm con 6 repeticiones y se almacenaron a 4 °C. La prehibridación de las membranas se realizó a 37 °C por una hora con AS en tubos de vidrio para hibridación (HybaidTM) en 20 ml de solución de prehibridación (5X SSC, 0.02% SDS, 1% reactivo bloqueante de RocheTM). Se descartó la solución de prehibridación y se agregaron 20 ml de solución de hibridación precalentada con 9 pmol de sonda marcada. Las membranas se mantuvieron en esta solución toda la noche a 37 °C con AS en una estufa de hibridación HybaidTM. Al siguiente día, las membranas fueron lavadas con 6X SSC a TA por 5 min en AS y dos veces con 4X SSC conteniendo 0.1% SDS a 45 °C por 10 min (sondas 0, I, II, III, y VI) y a 55 °C por 10 min (sonda V). Adicionalmente se hicieron dos lavados con solución de maleato 1M pH 7.5 y 0.3% Tween por 15 min y uno con solución de maleato por 5 min. Para el revelado de las membranas se agregó una solución con el anticuerpo anti–digoxigenina conjugado con fosfatasa alcalina (RocheTM) (dilución de 1/10000) y se incubaron por 30 min a TA, se lavaron dos veces por 15 min con solución de maleato y 0.3% tween, y finalmente con 20 ml de Tris–NaCl pH 9.5 por 5 min. La detección quimioluminiscente se realizó con CSPD (RocheTM) siguiendo el protocolo del fabricante. Las membranas se expusieron a películas de rayos X por 12 horas. Para el revelado de las películas se usó revelador y fijador Kodak®.

Análisis de datos

Para comparar las regiones se construyó [con vectores de presencia (1) y ausencia (0) de señal de hibridación y de bandas de SSCP] dos matrices a partir del coeficiente de Nei y Li. Con cada una de las matrices se generaron dendrogramas por el método de promedio aritmético de grupos de pares no ponderados (UPGMA) con el programa NTSYSpc ver. 2.10L. Para cada caso se hizo un análisis de varianza molecular (AMOVA) con el programa GenAlEx6 (Peakall y Smouse, 2006).

 

RESULTADOS Y DISCUSIÓN

En Brasil todos los árboles son preinmunizados con un aislamiento moderado de CTV, por lo que se esperaba que la totalidad de las muestras (500) sometidas a RT–PCR amplificaran el fragmento correspondiente al tamaño de la CP (672 pb) (Huang et al. 2004). Sin embargo, sólo 96 muestras lo amplificaron (Cuadro 3). Ésto pudo deberse a que la época de toma de muestras no fue la adecuada (septiembre), ya que no se recomienda realizar el muestreo en épocas muy cálidas porque se limita la replicación (Cambra et al. 2000), o debido a que el ARN tuviera contaminantes que inhibieron la reacción de PCR, e.g. polisacáridos o fenoles (P. Moreno7, comunicación personal). Por otro lado, en las huertas ubicadas en Capela do Alto, Capão Bonito y Botucatu, la calidad del material vegetal recolectado no fue óptima, debido a que tenían un estrés hídrico evidente, por un manejo menos tecnificado, comparado con las huertas de MG y que corresponden con el menor número de muestras amplificadas con HCP1/HCP2 (Cuadro 3). Por la gran heterogeneidad de aislamientos presentes en Brasil (Müller et al., 2000) es posible que los iniciadores utilizados seleccionen sólo algunos haplotipos, subestimando la diversidad genética presente en la región. Ésto se ha confirmado con aislamientos de California (Kong et al., 2000).

El porcentaje de hibridación con las sondas específicas en regiones con y sin MSC fue 79.60% y 84.67% (Cuadro 3).

La mayor variabilidad entre aislamientos de CTV dentro de las poblaciones puede ser explicada por los cambios de las poblaciones del virus dentro del árbol como consecuencia de las frecuentes inoculaciones de áfidos vectores presentes (Weng et al., 2007; Sentandreu et al., 2006). Con la sonda 0 (universal), 55/65 muestras hibridaron; sin embargo, las 10 muestras restantes hibridaron con alguna otra sonda. En contraste, con esta misma sonda en ausencia de MSC, hibridaron 29/31 muestras (Cuadro 3), lo que sugiere que, aunque la sonda fue diseñada a partir de diversos aislamientos de diferentes regiones geográficas del mundo, puede no ser absolutamente universal para las condiciones específicas de Brasil, considerando en especial la presión de inóculo, la dinámica poblacional de áfidos vectores, en especial Toxoptera citricida, así como las condiciones climáticas (Souza et al., 2002).

Debido a que una muestra puede exhibir poblaciones complejas de mezclas de diferentes genotipos virales de CTV, no es extraño que este resultado se deba a diversos eventos de recombinación, es decir procesos de inserción de segmentos de información genética entre las cadenas de nucleótidos de diferentes variantes génicas durante el proceso de replicación (Weng et al., 2007; García–Arenal et al., 2001).

La asociación de sintomatología atribuible a aislamientos severos de CTV con MSC no fue determinante. Se obtuvo menor número de muestras hibridadas para la sonda I (declinamiento rápido) y II (picado de tallo), en Comendador Gomes (25/32 y 15/32) y Uberlândia con presencia del MSC (18/33 y 31/33) (Cuadro 3).

La no hibridación con la sonda VI (específica para los aislamientos tipo T–30 y otros no severos de Florida) puede deberse a que este tipo de aislamiento se encuentra relacionado con otros de origen asiático como de Taiwán (B252), además de Colombia (B272) y California (B354) (Roischaster y Moreno, 1991) y no con los de Brasil. El análisis de varianza molecular (AMOVA) calculado dió 91% de variabilidad dentro de poblaciones y 9% de variación entre regiones con y sin MSC (Cuadro 4), lo cual indica una compleja heterogeneidad e interacción entre los aislamientos de CTV presentes en la muestra (que corresponde a una planta), lo que limita el reconocimiento de los sitios de alineamiento de las sondas.

El dendrograma construido con una matriz de datos de ausencia/presencia de señal de hibridación generó 2 grupos, de los cuales uno incluye casi todas las muestras (93) (Figura 1), con un coeficiente de similaridad de 0.63; 62/65 muestras con MSC se agruparon con condición severa o moderada. Por tanto no hubo una asociación clara entre la sintomatología atribuida a aislamientos severos de CTV y MSC. Sin embargo, sí se puede asociar la MSC con el CTV, ya que no están en grupos distintos (Figura 1).

El resultado del análisis de SSCP de una porción del gen p25 de la CP mostró patrones complejos en las cinco localidades. El número de bandas varía de dos a catorce (Figura 2). Se considera que cada banda corresponde a una cadena del DNA dúplex, lo que indica que existe una combinación de hasta siete haplotipos en cada aislamiento. El número de haplotipos en regiones con MSC fue 5 o más y en regiones sin MSC fue hasta 7. Esto confirma la existencia de una interacción compleja entre los aislamientos presentes y su hospedante, que pueden cambiar en el tiempo y espacio a una mezcla de aislamientos con diferentes niveles de severidad (Souza et al., 2002; Corazza–Nunez et al., 2001), pero que hasta el momento no se puede implicar a aislados severos del CTV con la etiología de la MSC.

En el análisis de varianza molecular (AMOVA) de los patrones electroforéticos de SSCP se calculó una variación de 98% dentro de poblaciones de las cinco regiones estudiadas, lo que explica que no se encontró ningún patrón predominante. La poca variabilidad entre regiones (2%) indica una estructura poblacional heterogénea local (Cuadro 5).

El dendrograma de datos de ausencia/presencia de bandas del SSCP (resultados no mostrados), presenta dos grupos, sin una clara diferenciación de regiones geográficas y, por tanto, de sintomatología, con lo cual se confirma la heterogeneidad de la estructura poblacional en las cinco regiones geográficas y la no implicación de aislados severos en la MSC (Cuadro 5).

 

CONCLUSIONES

La hibridación con sondas específicas y el análisis de SSCP de aislamientos de CTV, detectó la existencia de mezclas de diferentes genotipos virales en las poblaciones de árboles estudiados. Aunque la mayor variabilidad dentro de poblaciones (91 y 98%) que entre regiones es compatible con la posible aparición de un aislamiento de CTV con capacidad para inducir nuevas epidemias de alta intensidad y que puede explicar la localización de la MSC en el estado de Minas Gerais y su ausencia en otras regiones citrícolas de Brasil, no se puede implicar al CTV con la MSC de manera concluyente. La hibridación con sondas de tipo severo fue prácticamente igual en regiones con y sin MSC, lo que no permite asociar específicamente aislamientos severos de CTV con MSC, pero sí la asociación general de CTV a un nivel de 63% de similaridad poblacional. No se descarta la existencia de una nueva variante distante de las secuencias de CTV presentes en Brasil, por lo que se recomienda diseñar sondas asociadas a sintomatología atribuible a CTV a partir de aislamientos endémicos de Brasil.

 

AGRADECIMIENTOS

Al Consejo Nacional de Ciencia y Tecnología (CONACYT) en México y FUNDECITRUS A.C. en Brasil por el financiamiento respectivo.

 

LITERATURA CITADA

Bassanezi, R. B., A. Bergamin–Filho, L. Amorim, N. Gimenes–Fernandes, T. R. Gottwald, and J. M. Bové. 2003. Spatial and temporal analyses of citrus sudden death as a tool to generate hypotheses concerning its etiology. Phytopathology 93: 502–512.        [ Links ]

Beidler, L. L., P. R. Hiliard, and R. L. Rill. 1982. Ultrasensitive staining of nucleic acids with silver. Analytical Biochemical 126: 374–380.        [ Links ]

Cambra, M., M. T. Gorris, C. Marroquín, M. P. Román, A. Olmos, M. C. Martínez, A. Hermoso de Mendoza, A. López, and L. Navarro. 2000. Incidence and epidemiology of Citrus tristeza virus in the Valencian community of Spain. Virus Research 71:85–95.        [ Links ]

Cevick, B., S. S. Pappu, R. F. Lee, and C. L. Niblett. 1996. Detection and differentiation of citrus tristeza closterovirus using a point mutation and minor sequences differences in their coat protein genes. Phytopathol. 86, S101.        [ Links ]

Corazza–Nunez, M. J., M. A. Machado, G. W. Müller, D. R. Stach–Machado, A. A. de Souza, W. M. de C. Nunez. 2001. Evaluation of Citrus tristeza virus (CTV) complexes in pre–immunized Marsh seedless grapefruits. Summa Phytopatologica 27:11–16.        [ Links ]

García–Arenal, F., A. Fraile, and J. M. Malpica. 2001. Variability and Genetic structure of plants virus populations. Annu. Rev. Phytopathol. 39: 157–186.        [ Links ]

Huang, Z., P. A. Rundell, X. Guan, and P. A. Powell. 2004. Detection and isolate differentiation of citrus tristeza virus in infected field trees based on reverse transcription–polymerase chain reaction. Plant Dis. 88: 625–629.        [ Links ]

Jesus–Junior, W. C., and R. B. Bassanezi. 2004. Análise da dinâmica e estrutura de focos da morte súbita dos citros. Fitopatologia Brasileira 29:399–405.        [ Links ]

Kong, P., L. Rubio, M. Polek, and B.W. Falk. 2000. Population structure and genetic diversity of California citrus tristeza virus (CTV) field isolates. Virus Genes 21: 139–145.        [ Links ]

Müller, G. W., M. L. Targon, and M. A. Machado. 2000. Thirty years of preimunized pera sweet orange in the citricultura in São Paulo State, Brazil. In: Proceedings of the 14th Conference of IOCV. Riverside, CA. pp: 400–403.        [ Links ]

Peakall, R., and P.E. Smouse. 2006. GenAlEx 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6:288.        [ Links ]

Roistacher, C. N., and P. Moreno. 1991. The worldwide threat from destructive isolates of Citrus tristeza virus. A reviw. In: Proceedings of the 11th Conference of IOCV. Riverside, CA. pp: 1–19.        [ Links ]

Sentandreu, V., J. A. Castro, M. A. Ayllón, L. Rubio, J. Guerri, F. González–Candelas, P. Moreno and A. Moya. 2006. Evolutionary analysis of genetic variation observed in citrus tristeza virus (CTV) after host passage. Arch. Virol. 151:875–894.        [ Links ]

Souza, A. A., G. W. Müller, M. L. Targon, M. A. Takita, and M. Machado. 2002. Stability of the Mild Protective "PIAC" Isolate of Citrus Tristeza Virus. In: Proceedings of the 15th Conference of IOCV. Riverside, CA. pp: 131–135.        [ Links ]

Weng, Z., R. Barthelson, S. Gowda, M.E. Hilf, W.O. Dawson, D.W. Galbraith, and Z. Xiong. 2007. Persistent infection and promiscuous recombination of multiple genotypes of an RNA virus within a single host generate extensive diversity. PLos ONE 2(9): e917.doi:10.1371/journal.pone.0000917.        [ Links ]

 

NOTAS

6 Fundo de Defensa da Citricultura, A.C. Av. Adhemar Pereira de Barros, 201 CEP 14807–40 Araracuara, São Paulo, Brasil.

7 Pedro Moreno. Instituto Valenciano de Investigaciones Agrarias. Carretera Moncada – Náquera, Km. 4,5 Moncada (Valencia), España. (pmoreno@ivia.es)

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons