SciELO - Scientific Electronic Library Online

 
vol.30Descripción de cultivos miceliares de Boletales neotropicales y europeos (Boletus grupo edulis, Boletellus y Suillus) y formación de primordios de B. edulis en cultivo puroPrimeros registros de hongos gasteroides en la Reserva Forestal Nacional y Refugio de Fauna Silvestre Ajos-Bavispe, Sonora, México índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Revista mexicana de micología

versão impressa ISSN 0187-3180

Rev. Mex. Mic v.30  Xalapa dez. 2009

 

Contribuciones

 

Ophiostoma ips asociado al insecto descortezador (Dendroctonus adjunctus) del pino de las alturas (Pinus hartwegii)

 

Ophiostoma ips associated with the bark beetle (Dendroctonus adjunctus) in hartweg pine

 

Omar Alejandro Pérez–Vera1 * , Dionicio Alvarado–Rosales1, Elizabeth Cárdenas–Soriano1, Armando Equihua–Martínez2, David Cibrián–Tovar3, José G. Álvarez–Moctezuma3, Dimas Mejía–Sánchez4 y Thomas C. Harrington5

 

1 Programa de Fitopatología, Colegio de Postgraduados, Campus Montecillo, Carretera México–Texcoco, Km 36.5, Montecillo, Estado de México, C.P. 56230.

2 Programa de Entomología, Colegio de Postgraduados, Campus Montecillo, Carretera México–Texcoco, Km 36.5, Montecillo, Estado de México, C.P. 56230.

3 División de Ciencias Forestales (DICIFO), Universidad Autónoma Chapingo, C.P. 56230. Chapingo, Estado de México.

4 Parasitología Agrícola, Universidad Autónoma Chapingo, C.P. 56230. Chapingo, Estado de México.

5 Department of Plant Pathology. Iowa State University. 221 Bessey Hall, Ames, Iowa 50011, USA.

 

*Autor para correspondencia:
Omar Alejandro Perez oalejandrovera@gmail.com

 

Recibido 5 de noviembre 2008
Aceptado 30 de agosto 2009.

 

Abstract

In the "pino de las alturas" (Pinus hartwegii Lindl) it has been reported the presence of the bark beetle Dendroctonus adjunctus associated with the genus Ophiostoma spp., which causes the blue–stain of the wood. The objective of this study was to identify and characterize the Ophiostoma species associated with the bark beetle D. adjunctus in P. hartwegii. Galleries and insects were collected in the Zoquiapan Experimental Forest Station (ZEFS), of the Universidad Autonoma Chapingo, in Zoquiapan, Puebla. It was isolated from galleries and insects the morphologically identified fungi Graphilbum sp. and Ophiostoma ips, the latter from galleries only. In addition, molecular characterization was developed by the polymerase chain reaction technique (PCR). Molecular analysis confirmed the morphological identification. It was conclude that this fungus corresponds to Ophiostoma ips which is found on both stages, the teleomorph and its anamorph (Graphilbum sp.). This is the first report of O. ips in Mexico associated with P. hartwegii.

Key words: Graphilbum, fungi, insect, PCR.

 

Resumen

En el "pino de las alturas" (Pinus hartwegii Lindl) se ha reportado la presencia del descortezador Dendroctonus adjunctus asociado al género Ophiostoma spp., causante del manchado azul de la madera. El objetivo del presente estudio fue identificar y caracterizar la especie de Ophiostoma asociada al descortezador D. adjunctus en P hartwegii. Se colectaron galerías e insectos en la Estación Forestal Experimental Zoquiapan (EFEZ) de la Universidad Autónoma Chapingo, en Zoquiapan, Puebla. Se aisló e identificó morfológicamente a Graphilbum sp. en galerías e insectos y Ophiostoma ips solamente en galerías. Además, se caracterizaron molecularmente mediante la técnica de reacción en cadena de la polimerasa (PCR). El análisis molecular corroboró la identificación morfológica. Se concluye que el hongo corresponde a Ophiostoma ips (teleomorfo) y Graphilbum sp. su anamorfo. Este es el primer reporte en México de O. ips asociado a P hartwegii.

Palabras clave: Graphilbum, hongo, insecto, PCR.

 

Introducción

El "pino de las alturas" (Pinus hartwegii Lindl) se encuentra distribuido en 15 estados de la República Mexicana con clima semifrío, a una temperatura media de 12°C, precipitaciones medias anuales de 850 a 1,500 mm y altitudes de 3, 000 a 4, 000 msnm. Esta especie también se ha reportado en Guatemala, Honduras y entre la frontera de Honduras–El Salvador (Musálem y Solís, 2000; Perry, 1991a). Los bosques de pino en México son atacados por los descortezadores Dendroctonus adjunctus, D. approximatus, D. mexicanus, D. parallelocollis, D. valens, Ips bonanseai, I. integer, I. mexicanus, Pissodes zitacuarence e Hylurgus spp., que se alimentan del floema y del cambium vascular del árbol (Cibrián et al., 1995; Musálem y Solís, 2000). Este grupo de insectos son plagas en bosques de coníferas (Paine et al., 1997) con excepción del último (Cibrián et al., 1995). En particular, D. adjunctus, ataca a 16 especies de pino, dentro de los cuales está P. hartwegii y cuyo daño se acentúa especialmente en los Parques Nacionales del centro de México (Cibrián et al., 1995).

La mayoría de las especies de insectos descortezadores actúan como vectores de hongos de los géneros Ceratocystis y Ophiostoma (Perry, 1991b; Harrington, 1993; Paine et al., 1997). Muchos de ellos son patógenos primarios y agentes causantes del manchado azul de la madera (Harrington, 1988; Paine et al., 1997). En el mundo se han reportado 189 especies de los géneros en diferentes hospedantes (Index Fungorum, 2008). Para el caso de México se han reportado Ceratocystiopsis collifera, Ophiostoma picea, O. piliferum y Leptographium sp. asociados a Pinus hartwegii (Marmolejo y Butin, 1993; Marmolejo, 1991) y otros 13 hongos ophiostomatoides en coníferas y latifoliadas (Marmolejo, 1989; Marmolejo y Butin, 1993; Zhou et al., 2004 a; Cibrián et al., 2007). Dada la poca información que existe de estos hongos en México y que las especies del género Ophiostoma no son fáciles de identificar por características morfológicas y que solo O. pulvinisporum se ha identificado con comparaciones de secuencias de ADNr (Zhou et al., 2004 a), el presente estudio tuvo como objetivo identificar y caracterizar la especie de Ophiostoma asociada al descortezador D. adjunctus en P. hartwegii.

 

Materiales y métodos

Colecta de muestras

Las colectas se realizaron en la Estación Forestal Experimental Zoquiapan (EFEZ) de la Universidad Autónoma Chapingo, municipio de Zoquiapan, Puebla, México (Tabla 1). Se recolectaron 22 muestras de corteza de 10 × 10cm2 de Pinus hartwegii, con galerías de Dendroctonus adjunctus, además, se recolectaron 35 adultos del insecto descortezador. Todas las muestras se etiquetaron y trasladaron al laboratorio de Patología Forestal del Campus Montecillo–Texcoco, Edo. de México, donde se conservaron a 4 °C para su posterior análisis.

Aislamiento del hongo

Las muestras de corteza se colocaron en cámaras con humedad relativa de 95 a 100% durante 30 días. Masas de conidios acumulados en la punta de conidióforos fueron cuidadosamente colectadas con una aguja de disección estéril y transferidas a cajas Petri con medio de cultivo selectivo extracto–malta–agar al 2% adicionado con cicloheximida (0.1 g) y sulfato de estreptomicina (0.02 g). De cada muestra se hicieron cinco siembras en dos cajas Petri con medio, en total se sembraron 44 cajas.

Los 35 insectos adultos se sembraron directamente en EMA adicionado con cicloheximida y sulfato de estreptomicina descrito anteriormente. Todas las cajas se incubaron en luz natural a 25 ± 1 °C durante 15 días. Posteriormente, cada aislamiento fue purificado en EMA al 2%. Todos los aislamientos obtenidos para este estudio se conservaron en tubos inclinados con EMA al 2% y se cubrieron con aceite mineral estéril.

Identificación morfológica Microscopía de luz

Con el propósito de identificar a nivel género cada uno de los aislamientos obtenidos, se hicieron cultivos monoconidiales en agar–agua al 1.8% y se incrementaron en EMA al 2%. Los aislamientos de galerías e insectos se agruparon en base al sitio de colecta, coloración en medio de cultivo, tipo de crecimiento, tipo de micelio y presencia del teleomorfo o anamorfo para facilitar el uso de claves. Para este tipo de microscopía se seleccionaron al azar siete aislamientos de galerías (ZOQ1, ZOQ3, ZOQ4, ZOQ7, ZOQ10, ZOQ11 y ZOQ14) y tres de insectos (ZOQ18, ZOQ19 y ZOQ20). Los montajes permanentes se hicieron en glicerol a 50% acidificado con HCl y se midieron 200 ascosporas y conidios, 50 sinemas y 30 peritecios de cada aislamiento con objetivos de 100X y 10X, respectivamente. Las claves usadas para la identificación fueron las de Jacobs y Wingfield (2001); Upadhyay (1981) y Hunt (1956).

Microscopía de barrido

Para observar el tipo de conidiogénesis y forma de los conidios, se utilizó este tipo de microscopía; para esto se utilizaron cuatro cultivos monoconidiales de 15 a 20 días de edad (ZOQ1, ZOQ3, ZOQ4 y ZOQ19) cultivados en EMA al 2% (Tabla 1). Con un sacabocado, se tomaron discos de 0.5 cm de diámetro y se fijaron en glutaraldehído al 3% con pH 7.2 durante 24 h. Las muestras se lavaron tres veces con el amortiguador de fosfatos por un minuto. Después, cada muestra se deshidrató en una serie de soluciones graduales de etanol (30, 40, 50, 60, 70, 80, 90 y 100%); las últimas tres soluciones dos veces por 15 min en cada una. Las muestras se secaron a punto crítico con CO2 en una secadora Sandri–780A® (TOUSIMIS Research Corporation, Rockville, EUA), se colocaron sobre un portamuestras usando una cinta doble adhesiva de cobre (o carbón) y se recubrieron con oro durante 4 min en una ionizadora JFC–1100® (JEOL LTD, Tokio, Japón). Las muestras se observaron en un microscopio electrónico de barrido JSM–35C® (JEOL LTD, Tokio, Japón) en el laboratorio de Microscopia Electrónica del Colegio de Postgraduados en Montecillo, Estado de México.

Caracterización molecular

Diez aislamientos fueron utilizados para la caracterización molecular (Tabla 1), los cuales fueron primeramente agrupados e identificados morfológicamente. Los cultivos monoconidiales de Graphilbum en agar–agua al 1.8%, incrementaron en EMA al 2%. Cada aislamiento fue cultivado en matraces con 50 mL de medio líquido de extracto–malta al 2% a una temperatura de 25 °C y oscuridad por 25 días. La extracción de ADN fue con el método AP (Sambrook y Russell, 2001). La calidad del mismo se evaluó por electroforesis en gel de agarosa 1%. Las regiones internas ITS1 e ITS2 entre los genes ribosomales (rADN) 18S–5.8S y 5.8S–18S fueron amplificados por la Reacción en Cadena de la Polimerasa (PCR) con los iniciadores ITS1–F (5'–CTTGGTCATTTAGAGGGAAGTAA–3') e ITS4 (5'–TCC TCC GCT TAT TGA TAT GC–3'). La reacción de PCR por muestra estuvo compuesta por: 12.5 µl agua libre de nucleasas, 2.5 µl de Buffer 5X, 2.5 mM de MgCl2, 2.5 µl; 200 µM de dNTPs, 0.5 µl; 0.8 µM de cada uno de los iniciadores ITS1–F e ITS4, 1 µl; 2 U de Taq–DNA polimerasa (Promega, EUA), 0.5 µl y 10 ng de ADN problema, 2 µl. Se utilizó un termociclador Applied BiosystemsTM (Mod. Termal Cycler 2720) con el siguiente programa: desnaturalización inicial a 95 °C por 3 min; 35 ciclos de desnaturalización a 94 °C por 59 seg; alineamiento a 55 °C por 59 s y extensión a 72 °C por 1 min, y una extensión final de 72 °C por 8 min (Zhou et al., 2004a). Los productos amplificados se analizaron por electroforesis en gel de agarosa al 1%, y se tiñieron con bromuro de etidio y las bandas se visualizaron en un fotodocumentador (Bio–Imagen Systems Mini Bis Pro). Los productos de la PCR fueron tomados directamente del gel y purificados con Wizard SV (Promega, EUA). El producto de PCR fue secuenciado en el Instituto de Fisiología Celular de la Universidad Nacional Autónoma de México con un secuenciador Genetic Analizer 3100 (Applied Biosystem Corp).

Las secuencias obtenidas con el iniciador ITS1–F se alinearon con las secuencias disponibles en el banco de genes del National Center for Biotechnology Information (NCBI) de EUA (http://www.ncbi.nlm.nih.gov). De los valores cuantitativos generados, solo se bajaron las secuencias con el valor más alto para su comparación con las secuencias en estudio y otras secuencias de Ophiostoma adjuncti, O. montium, O. pulvinisporum que morfológicamente son similares (Tabla 2). Las secuencias fueron alineadas con Clustal W versión 1.6 y un análisis filogenético fue realizado con el software MEGA 4: Molecular Evolutionary Genetics Analysis (Tamura, et al. 2007) por el método de Neighbor–Joining, modelo Amino: Poisson correction. En el árbol se usó como raíz una secuencia de O. quercus del banco de genes con número de acceso (AF493239). Las secuencias de este estudio fueron depositadas en el Banco de Genes para obtener su número de acceso (Tabla 2).

 

Resultados y discusión

Aislamientos

Se obtuvieron 156 aislamientos de galerías e insectos, de éstos, 144 fueron de galerías y el resto del cuerpo de Dendroctonus adjunctus (Tabla 1).

Identificación de los aislamientos

Caracterización morfológica

Los resultados de los estudios de microscopía de luz y microscopía de barrido indicaron la presencia del anamorfo Graphilbum sp. y el teleomorfo O. ips en galerías y cuerpo de insectos de D. adjunctus en P. hartwegii (Figura 1), un mayor porcentaje fue Graphilbum (galerías e insectos), y únicamente en la muestra de galerías de ZOQ3 se formó el teleomorfo y el anamorfo. Estos hongos, Graphilbum, Hyalorhinocladiella y Acremonium son anamorfos reportados para O. ips, un hongo considerado pleomórfico (Upadhyay, 1981; Hutchison y Reid, 1988; Benade et al., 1995). Harrington (1988) menciona a Leptographium y Graphium como anamorfos de O. ips. Otros han considerado a Graphium como sinónimo de Pesotum, sin embargo, Harrington et al. (2001) restringe a Pesotum al complejo de O. picea. Por otro lado, mientras que Hunt (1956) menciona que el anamorfo de O. ips es una transición entre Leptographium y Graphium. Sin embargo, en nuestros aislamientos únicamente se obtuvo a Graphilbum como anamorfo de O. ips.

El crecimiento en medio de cultivo fue radial y alcanzó un diámetro de 8 cm en 12 días para los aislamientos de Graphilbum y O. ips. En Graphilbum la coloración de la colonia fue blanca cremosa a café claro a los tres días, tornándose a café amarillento en cultivos de mayor edad (Figura 1A). En los aislamientos con teleomorfo y anamorfo juntos de O. ips la coloración fue color café oscuro a grisáceo y de café a café oscuro al reverso de la caja Petri (Figura 1B).

En Graphilbum el micelio fue de color café oscuro, septado, micelio aéreo hialino y escaso. Conidióforos sinematosos dominante en el medio de cultivo. En general, la masa de conidias es contenida en un mucílago de color cremoso viscoso con la edad. Hutchison y Reid (1988), Hunt (1956) y Upadhyay (1981), concuerdan en que Graphilbum presenta una variabilidad en coloración de la colonia de hialina, café claro, café amarillento, café oliváceo, gris claro o gris oscuro. Además, Hunt (1956) y Upadhyay (1981) mencionan abundancia de micelio inmerso y aéreo septado de color hialino a café. Hutchison y Reid (1988) reportan por primera vez la formación de clamidosporas y blastosporas del micelio, esto dependiendo del aislamiento y las condiciones de crecimiento in vitro.

Los conidióforos de Graphilbum fueron sinematosos, de (235–)296(–329) µm de largo incluyendo aparato conidiogénico (Figura 1C,D). Los sinemas fueron solitarios o agrupado de 2 a 6, hialinos a color crema a los tres a cuatro días y tornándose a café claro a los 10 a 12 días para aislamientos de galerías e insectos (Figura 1C). Los Conidióforos presentaron de 3 a 5 ramas. Las células conidiogénicas de proliferación percurrente, anelaciones de apariencia simpodial, cilíndrica e hialina de (8.5–)13.8(–14.5) × (0.8–)2.0(–2.2) µm (Figura 1E,F). La conidiogénesis de Graphilbum en este estudio, concuerda con lo descrito por Upadhyay y Kendrick (1975). Sin embargo, Benade et al. (1995) observaron con microscopía electrónica de barrido (MEB) y microscopía electrónica de transmisión (MET) una conidiogénesis percurrente de apariencia simpodial muy similar a Hyalorhinocladiella. Hutchison y Reid (1988), mencionan que la conidiogénesis es fialídica y percurrente para Graphilbum. Mientras que Wingfield y Marasas (1980) reportan que la conidiogénesis es fialídica de apariencia simpodial sin asignar un anamorfo. Los conidios son hialinos, unicelulares, cilíndricos a ovoides, con el ápice redondeado y la base truncada de (3.6–)5.5(–8.9) × (1.0–)1.5(–2.6) µm (Figura 1E,F,G,H). La forma de los conidios fue similar a lo reportado por Hunt (1956) y Wingfield y Marasas (1980), pero Upadhyay (1981); Rumbold (1931) y Hutchison y Reid (1988) mencionan la presencia de conidios globulares, limoniformes, oblongos a elipsoides.

Ophiostoma ips es morfológicamente similar a O. adjuncti, O. montium y O. pulvinisporum. Estas especies presentan el ascocarpo oscuro, hifas ostiolares ausentes en el ápice y las ascosporas de tipo almohada en vista frontal y con diferentes formas de la cubierta mucilaginosa en cada una de las especies (Hunt, 1956; Upadhyay, 1981; Zhou et al., 2004b; Davidson, 1978).

Los peritecios crecen superficialmente inmersos en medio de cultivo, desarrollándose a los 25 días solitarios a agrupados. Su base es globosa, oscuros, de 131 a 263 µm de diámetro usualmente ornamentados con hifas aseptadas de color café claro de (1.8–)3.7(–4.9) µm de ancho (Figura 1:I,J). El cuello del peritecio es café oscuro a negro de 301 a 766 µm de largo y (19–)24(–38) µm de ancho de la base. El ápice del cuello ligeramente curvado y más claro, de (10–)13(–21) µm de ancho e hifas ostiolares ausentes (Figura 1:J,K). A diferencia de Hutchison y Reid (1988), Wingfield y Marasas (1980), Hunt (1956), Upadhyay (1981) y Rumbold (1931) mencionan que la longitud del cuello y base del peritecio son mayores. Sin embargo, estas dimensiones son semejantes a las descritas por Marmolejo y Butin (1993). Las ascas son de tipo evanescentes. Ascosporas hialinas, aseptadas, de forma aparentemente rectangular o de forma de almohada, y provistas de una cubierta mucilaginosa, de 4.0–5.9 × 1.8–2 µm (Figura 1:L). En cuanto al tamaño de las ascosporas, en este estudio fue variable, comparado con Hutchison y Reid (1988), Wingfield y Marasas (1980), Hunt (1956), Upadhyay (1981), Rumbold (1931) y Marmolejo y Butin (1993).

Caracterización molecular

En general, la banda del producto de PCR fue de un peso aproximado de 700 pb con los primers ITS1–F e ITS4. Al comparar las diez secuencias de nucleótidos obtenidas de galerías y del cuerpo de Dendroctonus adjunctus identificadas morfológicamente, con las disponibles en el GenBank resultó que los diez aislamientos correspondieron a Ophiostoma ips. Sin embargo, nueve aislamientos se alinearon con O. ips con número de acceso AY172021 y el aislamiento ZOQ10 se alineó con O. ips con número de acceso AY546697. En general, se presentó una identidad de 96 a 99%. Cada secuencia se depositó en el banco de genes y se obtuvo un número de acceso (Tabla 2). El resultado del alineamiento múltiple de las secuencias resultó en 803 pb para la construcción del árbol filogenético, usando la secuencia de O. quercus obtenida del banco del Banco de Genes con número de acceso (AF198238). El árbol mostró un claro agrupamiento de tres grupos (Figura 2). El primer grupo correspondió a O. ips, con aislamientos de galerías e insecto de D. adjunctus en P. hartwegii en México y los aislamientos de O. ips reportados en el banco de genes con hospedantes del subgénero Pinus (Perry, 1991a), en este grupo se incluye O. adjuncti (número de acceso CMW135), como única secuencia en el banco de genes lo que hace necesario realizar estudios genéticos más específicos que demuestren la separación de las dos especies. Además, se confirma la identificación morfológica donde se presentó el teleomorfo y Graphilbum considerado como anamorfo de O. ips (Hutchison y Reid, 1988 y Upadhyay, 1981). El segundo grupo corresponde a O. pulvinisporium con el subgénero Diploxylon (Perry, 1991a; Martínez, 1948). El tercer grupo lo constituye O. montium con los hospedantes de los subgéneros Diploxylon y Pinus (Perry, 1991a; Martinez, 1948).

O. ips ha sido reportado como patógeno en coníferas y asociado a varias especies de descortezadores (Zhou et al., 2007). En el Hemisferio Norte, se ha reportado en Pinus echinata, P. sylvestris y P. rigida asociado a Ips calligraphus (Perry, 1991b). En el Hemisferio Sur se ha reportado en Australia en galerías de Ips grandicollis en Pinus taeda (Wingfield y Marasas, 1980; Zhou et al., 2001), y en Nueva Zelandia en Pinus elliottii y P. radiata (Hutchison y Reid, 1988). En Sudáfrica asociado con Orthotomicus erosus, Hylurgus angustatus e H. ligniperda en P. radiata, P. patula y P. elliottii (Wingfield y Marasas, 1980; Zhou et al., 2001). En Chile se ha asociado con H. ligniperda en P. patula (Zhou et al., 2004b). En este estudio, el hongo fue aislado del cuerpo de Dendroctonus adjunctus y galerías en Pinus hartwegii y se identificó por características morfológicas y moleculares. En México, previamente se reportó a O. ips asociado con D. mexicanus e Ips sp., en Pinus teocote y P. pseudostrobus identificados morfológicamente (Marmolejo, 1989; Marmolejo y Butin, 1993).

Con base en los resultados morfológicos y análisis molecular de los aislamientos obtenidos de galerías e insecto descortezador Dendroctonus adjunctus en Pinus hartwegii, se concluye que el hongo corresponde a Ophiostoma ips, encontrándose el teleomorfo y anamorfo (Graphilbum sp.), el cual se reporta por primera vez asociado a este insecto en Pinus hartwegii en México.

 

Literatura citada

Benade, E., M.J. Wingfield, P.S. Van Wyk, 1995. Conidium development in the Hyalorhinocladiella anamorph of Ophiostoma ips. Mycologia 87:298–303.        [ Links ]

Cibrián, T.D., D.A. Rosales, S.E. García, 2007. Enfermedades Forestales de México. Universidad Autónoma Chapingo. México.        [ Links ]

Cibrián, T.D., J.T. Méndez. M, R.C. Bolaños, H.O. Yates III, J. F. Lara, 1995. Insectos Forestales de México. Universidad Autónoma Chapingo. México.        [ Links ]

Davidson, R., 1978. Staining fungi associated with Dendroctonus adjunctus in pines. Mycologia 70:35–41.        [ Links ]

Jacobs, K., M.J. Wingfield. 2001. Leptographium species: tree pathogens, insect associates, and agents of blue–stain. The American Phytopathological Society, St. Paul, Minnesota.        [ Links ]

Harrington, T.C., 1988. Leptographium species, their distributions, hosts and insect vectors. In: Harrington, T.C., F.W. Cobb (eds.), Leptographium root diseases on conifers. The American Phytopathological Society, St. Paul, Minn. pp. 1–39.        [ Links ]

Harrington, T.C., 1993. Disease of conifers caused by species of Ophiostoma and Leptographium. In: Wingfield, M.J., K.A. Seifert, J.F. Webber (eds.), Ceratocystis and Ophiostoma: Taxonomy, ecology and pathogenicity. The American Phytopathological Society Press, St. Paul, Minn. pp. 161–172.        [ Links ]

Harrington, T.C., D. McNew, J. Steimel, D. Hofstra, R. Farrell, 2001. Phylogeny and taxonomy of the Ophiostoma piceae complex and the Dutch elm disease fungi. Mycologia 93:111–136.        [ Links ]

Hunt, J. 1956. Taxonomy of the genus Ceratocystis. Lloydia 19:1–59.        [ Links ]

Hutchison, L.J., J. Reid, 1988. Taxonomy of some potential woodstaining fungi from New Zealand. Ophiostomataceae. New Zealand Journal of Botany 26: 63–81.        [ Links ]

Index fungorum, 2008. CABI Bioscience Databases. http://www.indexfungorum.org/Names/Names.asp.        [ Links ]

Marmolejo, J.G., 1991. El manchado azul de la Madera en Nuevo León. Reporte científico No. 27. Facultad de Ciencias Forestales, UANL, México. 59 p.        [ Links ]

Marmolejo, J.G., H. Butin, 1993. Las especies de Ophiostoma y Ceratocystiopsis (Ascomycetes, Microascales) conocidas de Nuevo León, México. Reporte científico especial No. 13. Facultad de Ciencias Forestales, UANL, México. pp. 155–170.        [ Links ]

Marmolejo–Moncivais, J.G., 1989. Forstpathologische untersuchungen zur Pilzflora Nordost–Mexikos. Tesis de Doctorado. Universität Göttingen.        [ Links ]

Martínez, M., 1948. Los pinos mexicanos. Segunda edición. Botas. México.        [ Links ]

Musálem, S.M.A., M.A. Solís, 2000. Monografía de Pinus hartwegii. SAGAR. INIFAP. CIRSE Campo Experimental Valle de México. Libro Técnico No. 3. Chapingo, Estado de México.        [ Links ]

Paine, T.D., K.F. Raffa, T.C. Harrington, 1997. Interactions among scolytid bark beetles, their associated fungi, and live host conifers. Annual Reviews in Entomology 42:179–206.        [ Links ]

Perry, J.P., 1991a. The pines of Mexico and Central America. Timber Press, Inc.        [ Links ]

Perry, T.J., 1991b. A Synopsis of the taxonomic revisions in the genus Ceratocystis including a review of blue–staining species associated with Dendroctonus bark beetles. General Technical Report. USDA, Forest Service. New Orleans, Louisiana.        [ Links ]

Rumbold, C.T., 1931. Two blue–stain fungi associated with bark beetle infestation of pines. Journal of Agricultural Research 43:847–873.        [ Links ]

Sambrook, J., D.W. Russell, 2001. Molecular Cloning. A Laboratory Manual, Third edition. 1:1.32–1.34. Cold Spring Harbour Laboratory Press, New York.        [ Links ]

Tamura, K., J.N. Dudley, S. Kumar, 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596–1599.        [ Links ]

Upadhyay, H.P., 1981. A monograph of Ceratocystis and Ceratocystiopsis. University of Georgia Press. Athens. Georgia.        [ Links ]

Upadhyay, H.P., W.B. Kendrick, 1975. Prodromus for a revision of Ceratocystis (Microascales, Ascomycetes) and its conidial states. Mycologia 67: 798–805.        [ Links ]

Wingfield, M.J., O.F.W. Marasas, 1980. Ceratocystis ips associated with Orthomicus erosus (Coleoptera: Scolytidae) on Pinus spp. in the Cape Province of South Africa. Phytophylactica 12:65–69.        [ Links ]

Zhou, X., I.T. Burgess, W. De Beer, F. Lieutier, A. Yart, K. Klepzig, A. Carnegie, M.J. Portales, D.B. Wingfield, M.J. Wingfield, 2007. High intercontinental migration rates and population admixture in the sapstain fungus Ophiostoma ips. Molecular Ecology 16:89–99.        [ Links ]

Zhou, X.D., W.Z. De Beer, B.D. Wingfield, M.J. Wingfield, 2001. Ophiostomatoid fungi associated with three pine–infesting bark beetles in South Africa. Sydowia 53:290–300.        [ Links ]

Zhou, X.D., Z.W. De Beer, D.C. Tovar, B.D. Wingfield, M.J. Wingfield, 2004a. Characterisation of Ophiostoma species associated with pine bark beetles from Mexico, including O. pulvinisporum sp. nov. Mycological Research 108:690–698.        [ Links ]

Zhou, X.D., Z.W. De Beer, R. Ahumada, B.D. Wingfield, M.J. Wingfield, 2004b. Ophiostoma and Ceratocystiopsis spp. associated with two pine–infesting bark beetles in Chile. Fungal Diversity 15:261–274.        [ Links ]