Introduction

Four pinniped species belonging to 2 families can be found along the Pacific coast of Mexico, the northern elephant seal, Mirounga angustirostris (Gill 1866), and the harbor seal, Phoca vitulina richardsi (Gray 1864), in the Phocidae family, and the California sea lion, Zalophus californianus (Lesson 1828), and the Guadalupe fur seal, Arctocephalus philippii townsendi (Peters 1866), in the Otariidae family. Pinniped populations are associated with geographic areas like coasts and islands where different food resources are available (^{Riedman 1990}). Access to these resources is affected by the temperature of the ocean, strongly restricting the distribution of populations (^{Trillmich et al. 1991}). Despite geographical restrictions, several sightings of different pinniped species have been recorded outside their typical areas of distribution, even at distances greater than hundreds or thousands of kilometers. Some atypical records in Mexico include Arctocephalus australis (Zimmerman 1783) in Oaxaca (^{Villegas-Zurita et al. 2016}), Eumetopias jubatus (Schreber 1776) in Colima (^{Ceballos et al. 2010}, ^{Gallo-Reynoso et al. 2020}), Zalophus wollebaeki (Sivertsen 1953) in Chiapas, and Arctocephalus galapagoensis (Heller 1904) in Guerrero, Chiapas, and Michoacán (^{Aurioles-Gamboa et al. 2004}, ^{Páez-Rosas et al. 2017}).

The Galapagos fur seal (GFS), A. galapagoensis, is the smallest of the fur seals. Its sexual dimorphism is very subtle in comparison with other otariids. Males reach sizes between 1.5 and 1.6 m long and weigh between 60.0 and 68.0 kg. Females can reach 1.3 m long and weigh between 21.5 and 33.0 kg. Pups weigh between 3.0 and 4.0 kg and yearlings around 11.3 kg (^{Jefferson et al. 2008}). This species has one of the most confined geographic distributions among the pinnipeds; it is endemic to the Galapagos Archipelago (Fig. 1) and is mainly distributed in the northwestern region, where upwelling provides nutrient-rich waters to the ocean surface (^{Alava and Salazar 2006}, ^{Páez-Rosas et al. 2017}). The highly productive waters and, consequently, GFS prey availability are strongly affected by the interannual variability associated with mainly El Niño/Southern Oscillation.

Figure 1 Distribution range of Arctocephalus galapagoensis (slanted bars) and location of the A. galapagoensis individual that stranded in Oaxaca, Mexico (triangle). 

During an El Niño event, trade winds and the Equatorial Undercurrent patterns change and become weak (^{Liu et al. 2014}), leading to a decrease in primary productivity and therefore fish numbers. This process is associated with the warming of surface waters as a result of weak upwelling (^{Chavez et al. 1999}). The event affects GFS population survival in the Tropical Eastern Pacific, mostly because of prey shortage and malnutrition (^{Trillmich and Limberger 1985}, ^{Páez-Rosas et al. 2012}). For example, the population reduction of approximately 50% reported for 1982-1983 and 1996-1998 was mainly attributed to strong El Niño conditions (^{Trillmich and Dellinger 1991}, ^{Bastida et al. 2007}).

The influence of El Niño on the decrease of the GFS’ main prey along the well-known established foraging areas forces the GFS to expand its feeding grounds to unusual sites, well beyond its common distribution range (^{Trillmich et al. 1991}), leading to some individuals being sighted or stranded outside their usual range and foraging areas. The GFS has been reported on the coasts of mainland Ecuador, Colombia, and Mexico (^{Capella et al. 2002}, ^{Aurioles-Gamboa et al. 2004}). Some unusual pinniped records have locations that are over 3,000 km away from the known distribution range and include the northernmost record for A. galapagoensis, in Michoacán, Mexico (^{Páez-Rosas et al. 2017}). Most of the pinnipeds sighted in Mexico were identified by visual inspection and morphometric data, but this kind of assessment can be difficult as young individuals of several species are very similar. In such cases, the use of molecular tools allows accurate identification of species, especially during early growth stages, when diagnostic traits have not yet been developed.

On 19 May 2019, local people from La Escobilla community in Oaxaca, Mexico, reported a young pinniped individual in the Santuario Playa de Escobilla Natural Protected Area. The individual was injured and in poor condition and was thus transferred to the Centro Mexicano de la Tortuga by veterinary staff for rehabilitation, with previous authorization from the Procaduría Federal de Protección Ambiental (PROFEPA) in Oaxaca (Fig. 2). The individual was attended to by the center’s veterinarians, who provided hydration and nourishment. Though it eventually gained strength and started eating on its own, after 10 days from arrival the individual suddenly died of pneumonia, as confirmed by the necropsy. We proceeded with visual inspection to confirm the species and looked for important fur seal traits such as size of head, profile shape, muzzle structure, and fur coloration. In A. galapagoensis the muzzle has a small pointy and conical nose and the pinnae are long and prominent; females are often lighter in the face and forehead (^{Shirihai 2006}). Several photographs were taken from different angles, revealing a pointy snout of light color along with a small dark body. Though the traits resembled those of A. galapagoensis, given the early age and the strong resemblance among juvenile fur seals of different species, genetic confirmation was required. This study aimed to amplify a short fragment of the specimen’s mitochondrial DNA (mtDNA) control region in order to confirm the identity of the species.

Figure 2 Arctocephalus galapagoensis individual found in La Escobilla community, Oaxaca, Mexico. 

Materials and methods

A 12-mg tissue sample from a hind flipper was kept in 97% ethanol in a 2 mL Eppendorf tube. DNA was extracted from the tissue sample at the Umar Genetics Laboratory with the QIAGEN Gentra PureGene kit (Chatsworth, CA). A 660-bp fragment of the mtDNA control region was amplified with primers ZcalF (3′ CCTAAGACTCAAGGAAGAAGCA 5′) and ZcalR (3′ TGCACCTCATGGTTGTATGA 5′), which were designed in this study using a Z. californianus sequence (NC_008416.1). PCR conditions were 150 µM dNTPs, 1.5 mM MgCl₂, 20 mM Tris-HCl with a pH of 8.0, 50 mM KCl, 0.3 µM for each primer, 1.25 U/µL Taq-polimerase, and 20 ng of DNA, with initial denaturation at 95 ºC for 4 min, followed by 30 cycles at 94 ºC for 45 s, 59 ºC for 1 min, and 72 ºC for 1 min, and final extension at 72 ºC for 5 min. PCR products were checked for integrity and concentration in 2% agarose gels dyed with ethidium bromide, and 5 µL of the remaining PCR product were sent for Sanger dideoxy sequencing in an Applied Biosystems 3730xl automated sequencer (50 cm capillary array) in the Core DNA Sequencing Facility at the University of Illinois Urbana-Champaign.

The obtained forward and reverse sequences were checked by eye for quality control and aligned with the software Bioedit v.7.0.5 to obtain a forward consensus fragment (UM71). Several control region sequences from other fur seal species were taken from GenBank and added to the alignment (see Fig. 3 for accession numbers). A parsimony tree was constructed with a bootstrap support of 500 repetitions using MEGA 7 (^{Tamura et al. 2007}), and the California sea lion, Z. californianus, was used as an outgroup.

Figure 3 Parsimony tree with 500 bootstrap repetitions. The sequenced individual (UM71 Oaxaca) is shown within the A. galapagoensis clade. Genbank access numbers for each sequence are shown in the label. 

Results

Inspection of the genital area of the stranded pinniped confirmed that it was a female. The individual weighed 10.8 kg and measured 91 cm total curvilinear length and 87 cm total length. Data collected from free-ranging individuals at the Galapagos Archipelago indicate that mean weight of one-year-old females is 9.5 kg in an ordinary year and 12.1 kg in a good year (^{Trillmich 1986}); therefore, the individual stranded in Oaxaca was approximately one year old. The tree obtained from the mtDNA control region clustered the specimen’s sequence (UM71) (GenBank accession number: MT992621) within the GFS, A. galapagoensis, group (Fig. 3).

Discussion

Stranded individuals provide invaluable information regarding the distribution, ecology, and health of marine mammals, especially in regions where the study of these animals is limited. Stranding events become the first effort in the compilation of regional checklists that could constitute the baseline to document historical changes in species distribution, behavior, and dispersal due to changing natural conditions. Visual identification of marine mammals requires a level of expertise that is limited to highly trained individuals, limiting the proper documentation of atypical sightings. Additionally, young individuals lack diagnostic species traits, occasionally making it impossible for experts to determine species visually. This note documents the first record of A. galapagoensis on the coast of Oaxaca, Mexico, by means of a DNA analysis, allowing for species assignment even when diagnostic characteristics are not clear. Molecular tools can prevent misidentification of sightings, especially during pinniped early growth stages. DNA analysis has been used in some cases (^{Aurioles-Gamboa et al. 2004}); however, it has not become a standardized tool for species identification during rare sightings and strandings (^{Ceballos et al. 2010}, ^{Gallo-Reynoso et al. 2020}), which could be due to the cost and time to process the sample.

The GFS identified in this study by mtDNA analysis was one of at least 4 separate sightings of juvenile pinnipeds that occurred within a few days apart. The first one was reported and photographed by members of the community in Paraje Brinca Perros, El Coyul, in the municipality of San Pedro Huamelula (15º51ʹ N, 95º48ʹ W), Oaxaca, on 15 May 2019. Another report followed on 17 May at the locality of Cuatunalco, in the municipality of Pochutla (approximately 64 km from the first sighting). The subject of this study was reported on 19 May in the Santuario Playa de Escobilla Natural Protected Area (15º43ʹ N, 96º44ʹ W) (approximately 70 km from the second sighting). In addition, on 23 May, another small juvenile with the same physical characteristics was sighted weak and trying to get back into the water in the Lagunas de Chacahua Natural Protected Area, in the locality of Barra Quebrada (15º58ʹ N, 97º40ʹ W), El Azufre, in the municipality of San Pedro Tututepec.

A possible explanation for the presence of A. galapagoensis in the Pacific coast of southern Mexico could be the effects of an El Niño event. According to the US National Oceanic and Atmospheric Administration’s National Weather Service-Climate Prediction Center, an El Niño event took place in October 2018 and continued through July 2019 in the Northern Hemisphere (https://origin.cpc.ncep.noaa.gov/products/analysis_monitoring/ensostuff/ONI_v5.php). Changes in sea surface temperature were evident in the Galapagos Archipelago region (Fig. 4). In May 2019 there could have been an atypical presence of GFS yearlings on the southeastern coast of Mexico, which is what probably lead to the first record of this species, confirmed with DNA analysis, on the coasts of Oaxaca.

Figure 4 Average sea surface temperature (SST) anomalies (ºC) for the week centered for each month (February, March, April, and May). Anomalies are computed with respect to the 1981-2010 base period weekly means. Images taken from https://www.cpc.ncep.noaa.gov/ products/expert_assessment/ENSO_DD_archive.php. The square shows the location of the Galapagos Archipelago. 

Sightings of GFS beyond their usual range have been reported in recent years, most of them adults in good body condition (^{Páez-Rosas et al. 2017}). In 1998, 2 juvenile GFSs in poor condition were reported by ^{Aurioles-Gamboa et al. (2004}) in the southern Mexican states of Guerrero and Chiapas. GFSs show a single foraging strategy, which consists in covering large foraging areas with shallow dives associated with lunar cycles, while Galapagos sea lions show several foraging strategies (shallow and deep dives) in a smaller area (^{Villegas-Amtmann et al. 2013}). While there is niche segregation between both species, some overlapping has been documented and related to moderate El Niño conditions, with warm water and decreased prey availability (^{Páez-Rosas et al. 2012}). It is possible that in warmer years the competition between both species becomes stronger and drives fur seals to perform farther foraging trips, as they have to cover a larger territory because of their unique foraging strategy, causing them to get lost and tired and prone to being caught in an ocean current. This anomalous situation could be enhanced by high sea surface temperatures due to El Niño events, as previously mentioned by ^{Páez-Rosas et al. (2017)}. Considering that climate change scenarios predict constant rises in global temperature, the protection of this species requires a coordinated effort between several countries to document and properly identify the atypical presence of this vulnerable species.