SciELO - Scientific Electronic Library Online

 
vol.35 número4Tasa de aclaramiento del mejillón Mytilus galloprovincialis. I. Respuesta a intervalos extremos de clorofila índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Ciencias marinas

versión impresa ISSN 0185-3880

Cienc. mar vol.35 no.4 Ensenada dic. 2009

 

Nota de Investigación

 

Lack of genetic differentiation among size groups of jumbo squid (Dosidicus gigas)*

 

Ausencia de diferenciación entre grupos de talla del calamar gigante (Dosidicus gigas)

 

E Sandoval–Castellanos*, M Uribe–Alcocer, P Díaz–Jaimes

 

Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, Circuito Exterior de Ciudad Universitaria, Insurgentes Sur 3000, Coyoacán, México DF 04510. * E–mail: esandoval@miranda.ecologia.unam.mx

 

Recibido en febrero de 2008.
Aceptado en octubre de 2009.

 

Abstract

The population structure of the jumbo squid (Dosidicus gigas) is complex, containing several cohorts and three groups defined by their size (small, medium, and large) and by differences in maturation, growth, and life span. Several authors have indicated the possibility of such groups representing discrete genetic units even at level subspecies or species in statu nascendi. Genetic divergence was tested in samples from the Gulf of California (Mexico) and Peruvian Sea by estimation of population divergence statistics, an exact test of homogeneity of allele frequencies, analysis of molecular variance, and genealogical trees applied to data obtained with two molecular markers: RAPDs and mtDNA sequences identified by SSCPs. Neither significant values of θ (FST) nor significant heterogeneity in allele frequencies were detected. Lack of evidence does not imply complete lack of differentiation among the groups but supports the fact that a geographically spread population can have different size groups without relevant genetic differentiation, implying that the hypothetical genetically differentiated groups can occur in different ecological niches.

Key words: Dosidicus gigas, RAPDs, mtDNA, genetic differentiation.

 

Resumen

La estructura poblacional del calamar gigante (Dosidicus gigas) es aparentemente compleja al contener varias cohortes y a tres grupos identificados que fueron definidos por su talla (pequeño, mediano y grande) y por diferencias en su maduración, crecimiento y longevidad. Varios autores han señalado la posibilidad de que tales grupos representen unidades genéticamente discretas incluso a nivel de subespecies o especies en status nascendii. Se probó la hipótesis de divergencia genética en muestras del Golfo de California (México) y del Mar de Perú mediante la estimación de estadísticos de divergencia poblacional, una prueba exacta de homogeneidad de frecuencias alélicas, un análisis de varianza molecular y árboles genealógicos; aplicados a datos obtenidos con dos marcadores moleculares: RAPDs y secuencias de mtDNA identificadas mediante SSCPs. No se detecaron valores significativos de θ (FST) ni heterogeneidad en las frecuencias alélicas. La falta de evidencia no necesariamente implica la ausencia de diferenciación entre los grupos pero sustenta el hecho de que la población, en su amplia extensión geográfica, puede tener diferentes grupos de talla sin diferenciación genética relevante, implicando que los hipotéticos grupos genéticamente diferenciados pueden ocurrir en diferentes nichos ecológicos.

Palabras clave: Dosidicus gigas, RAPDs, mtDNA, diferenciación genética.

 

Introducción

Actualmente el calamar gigante sustenta la pesquería de cefalópodos más grande del mundo (Young y Olson 2007). A pesar de su importancia, hay numerosas preguntas pendientes acerca de tópicos primarios para la adecuada comprensión y el manejo racional de la pesquería (Nigmatullin et al. 2001).

Dosidicus gigas (D'Orbigny, 1835) es un calamar oceánico y parcialmente nerítico (Nesis 1983) cuya distribución se restringe a aguas tropicales y subtropicales del Pacífico Oriental desde 37–40° N a 45–47° S y hasta 125–140° W sobre la línea del ecuador. Alcanza densidades poblacionales elevadas frente a las costas peruanas en el Hemisferio Sur y en los alrededores e interior del Golfo de California en el Hemisferio Norte (Sato 1976, Mariátegui et al. 1997). Las poblaciones en ambos hemisferios han sido genéticamente diferenciadas (Sandoval–Castellanos et al. 2007) y comparten una estructura compleja que contiene a varias cohortes y a tres grupos identificados que se definen por su talla (pequeña (S), mediana (M) y grande (L)) y por diferencias en su maduración, crecimiento, longevidad e incluso distribución (Nesis 1970, 1983; Argüelles et al. 2001, Markaida et al. 2004). Los organismos del grupo S miden de 130–140 a 260–340 mm de longitud de manto (LM), habitan áreas más ecuatoriales, maduran rápidamente y a menores tallas, y tienen una longevidad menor (Argüelles et al. 2001, Tafur et al. 2001, Markaida et al. 2004). Los calamares del grupo M miden de 240–280 a 420–600 mm LM, habitan en todo el rango de distribución exceptuando las periferias (norte y sur), crecen y maduran a tasas intermedias, y tienen una longevidad de aproximadamente un año (Argüelles et al. 2001, Markaida y Sosa–Nishizaki 2001, Tafur et al. 2001, Markaida et al. 2004). El grupo L presenta tallas de >500–650 y puede llegar hasta los 1000–1200 mm LM. Estos calamares tienden a presentarse en los márgenes sur y norte del área de distribución, a madurar y crecer más lentamente y a tener una longevidad de hasta 1.5–2 años (Argüelles et al. 2001, Markaida y Sosa–Nishizaki 2001, Tafur et al. 2001, Markaida et al. 2004).

Varios autores han señalado que tales grupos podrían presentar aislamiento reproductivo y por lo tanto mostrar diferencias genéticas no sólo a nivel poblacional sino incluso a nivel de subespecies o especies en status nascendii (Anderson y Rodhouse 2001, Nigmatullin et al. 2001).

En este trabajo se evaluó la hipótesis de divergencia genética entre grupos de talla empleando muestras del Mar de Perú y del Golfo de California, y dos técnicas moleculares: la técnica de DNA polimórfico amplificado aleatoriamente (RAPD, por sus siglas en inglés), que consiste en la amplificación aleatoria por PCR de fragmentos tratados como caracteres mendelianos, que son identificados y separados por su movilidad electroforética; y la de secuencias de DNA mitocondrial (mtDNA) identificadas mediante SSCPs (polimorfismos de conformación de cadena sencilla), la cual consiste en la separación de fragmentos de DNA cuyas diferencias en la secuencia producen diferentes conformaciones con diferentes movilidades electroforéticas.

 

Materiales y métodos

Este estudio empleó un total de 30 muestras de D. gigas recolectadas en el Mar del Perú recolectadas entre 77–84° W y 4–16° S, y 46 muestras del Golfo de California recolectadas alrededor de 106°48' W y 23°25' N entre agosto y octubre de 2002. Las muestras se clasificaron de acuerdo a la talla de los organismos a fin de integrarlos en cada uno de los tres grupos (S, M y L) de acuerdo a la información de Hernández–Herrera et al. (1996), Argüelles et al. (2001), Markaida y Sosa–Nishizaki (2001), Tafur et al. (2001) y Markaida et al. (2004). Sin embargo, no se encontraron individuos del grupo pequeño en el Golfo de California.

Se obtuvieron plantillas de DNA genómico mediante el equipo de purificación Wizard Genomic DNA (Promega Biosciences Inc., San Luis Obispo, California), que fueron cuantificadas por fluorometría. Las muestras clasificadas se analizaron mediante dos técnicas moleculares. Las reacciones de PCR para RAPDs se realizaron en 15 que contenían amortiguador de PCR 10x "B" (Cat. M1901, Promega Biosciences), 0.2 mM de cada dNTP, 0.75 U de Taq polimerasa (Cat. M1661, Promega Biosciences), 5.6 pmol de iniciadores (primers), 3.0 mM de MgCl2 y 1.5 ng de plantilla de DNA (2.5 ng µL–1). Se ensayaron 20 iniciadores de la serie OPF (Operon, QIAGEN Inc. Valencia, California), de los cuales se escogieron los cinco que presentaron mayor intensidad, claridad y repetibilidad para el estudio completo. El programa de PCR consistió en un paso inicial (3 min a 94°C), 44 ciclos de tres pasos (1 min a 94°C, 1 min a 37°C, 2 min a 72°C, incrementando el segundo y tercer pasos un segundo cada ciclo) y un paso final (10 min a 72°C). Los productos de PCR se separaron mediante electroforesis horizontal en geles de agarosa al 2% (Cat. 15510–019, Gibco, Invitrogen Corp., Grand Island, Nueva York) teñidos con bromuro de etidio.

Para la amplificación del fragmento de citocromo b del DNA mitocondrial, se utilizaron los iniciadores diseñados por Merritt et al. (1998), UCYTB151F y UCYTB272R, mismos que después fueron reemplazados por las versiones no degeneradas UCYTB272RND (5'–GCGAATAGGAAGTACCATTC–3') y UCYTB151FND (5'–TGTGGGGCCACTGTTATGAC–TAA–3'), a fin de evitar artificios en las reacciones de secuenciación debidos a su carácter degenerado. El PCR se llevó a cabo en 10 que contenían amortiguador de PCR 10x "B" (Cat. M1901, Promega Biosciences), 0.2 mM de cada dNTP (Cat. U1240, Promega Biosciences), 0.5 U de Taq polimerasa (Cat. M1661, Promega Biosciences), 10 pmol de cada iniciador, 3.25 mM de MgCl2, y 1 µL de plantilla. El programa de PCR consistió en un paso inicial (3 min a 94°C), 40 ciclos de tres pasos (1 min a 94°C, 1 min a 37°C, 2 min a 72°C) y un paso final (7 min a 72°C). El protocolo de la técnica de SSCPs fue el presentado por Sunnucks et al. (2000).

Se obtuvieron las frecuencias alélicas para ambos marcadores y se probó su homogeneidad mediante la prueba exacta de Raymond y Rousset (1995), la cual es una prueba insesgada de contingencias de χ2. La prueba exacta supone reproducción aleatoria y es útil para detectar probabilidades multilocus pero además loci individuales aberrantes. Adicionalmente, la diferenciación se midió mediante una estimación insesgada del estadístico de diferenciación poblacional de Wright FST llamado θ (Weir y Cockerham 1984). Su intervalo de confianza se obtuvo mediante remuestreo por bootstraping (Weir y Cockerham 1984, Miller 1998). La potencia estadística fue analizada mediante simulaciones con el programa POWSIM (Ryman y Palm 2006) usando los tamaños de muestra reales, las frecuencias observadas y diferentes niveles de diferenciación (FST). Además se llevó a cabo un análisis de varianza molecular (AMOVA) (Excoffier et al. 1992) con el fin de estimar la proporción de la variación total que se debe a la diferenciación al interior de los grupos de talla, diferenciación entre los grupos de talla y diferenciación entre poblaciones (Mar del Perú y Golfo de California). También se construyó un árbol filogenético de neighbor joining (ver Nei y Kumar 2000), el cual es un algoritmo que encuentra eficientemente el árbol que minimiza la longitud total de las ramas que conectan a los taxones, empleando todas las secuencias individuales. Para ello se empleó el programa MEGA 3.1 (Kumar et al. 2004), después de elegir un modelo de sustitución molecular mediante el programa MODELTEST 3.7 (Posada y Crandall 1998).

 

Resultados

Se analizó un total de 74 bandas/loci de RAPDs, de las cuales 71 (98.6%) fueron polimórficas en el Golfo de California y 73 (95.9%) en el Mar del Perú, con una diversidad genética total de 0.36 (frecuencias alélicas mostradas en la tabla 1).

El fragmento mitocondrial analizado corresponde a una porción de 367 pb de la región central (posiciones 453 a 819) del citocromo b que codifica para 121 aminoácidos (posiciones 152 a 273). El análisis de DNA mitocondrial detectó siete haplotipos (números de acceso del Genbank: EU882065, EU882066, EU882072, EU882077, EU882081, EU882082 y EU882083; apéndice) con 11 sitios polimórficos (9 transiciones, 2 transversiones) que produjeron sólo 4 sustituciones de aminoácidos después de la traducción. La diversidad genética total fue de 0.361 y el promedio de diferencias pareadas de 1.81.

Los datos mitocondriales coincidieron con los de RAPDs en confirmar la carencia de diferenciación ya sea con la falta de valores significativos de θ (FST) o de heterogeneidad significativa en las frecuencias alélicas en los valores totales o pareados (tabla 2). De hecho, las frecuencias alélicas se mostraron altamente homogéneas alcanzando valores de P de hasta 1.0. No obstante, el análisis de AMOVA atribuyó una cantidad no significativa de variación (3.8% con RAPDs y 2.8% con mtDNA) debida a diferenciación entre grupos. Las estimaciones de migración efectiva mostraron valores primordialmente elevados entre grupos de talla del mismo hemisferio (Mar del Perú o Golfo de California) con RAPD (media > 10) y con secuencias de mtDNA (media > 10). Los árboles genealógicos de todos los individuos (no mostrados) no sustentaron la presencia de algún patrón o asociación entre clados y grupos de talla, mostrando topologías poco profundas (la diferencia máxima entre secuencias fue de cinco sustituciones). Sin embargo, cuatro de los siete haplotipos mitocondriales fueron exclusivos de un grupo de talla (tabla 3).

La potencia estadística analizada mediante el programa POWSIM con 50 loci de RAPD (el programa no puede manejar más) mostró valores de 0.99 y 0.90 para una prueba de χ2 y una prueba exacta de Fisher, respectivamente (ambas pruebas son análogas a la prueba exacta usada aquí), en la población del Golfo de California y 0.95 y 0.90 en la población peruana. En todos los casos para una diferenciación equivalente a una FST= 0.029.

 

Discusión

En este estudio no se confirmó la hipotética diferenciación entre grupos de talla. Este resultado puede ser atribuido a: (1) la falta de potencia estadística del estudio debido al tamaño pequeño de las muestras; (2) que las muestras no son representativas de los grupos de talla diferenciados; o (3) la falta de diferenciación genética entre grupos.

A pesar del limitado número de organismos usados, el número de loci polimórficos (71–73) y sitios (11) dieron una potencia estadística equivalente a la que se obtendría con más de 60 individuos en cada categoría al analizarlos con 10 hipotéticos loci dialélicos. Ello permitiría detectar diferenciación probablemente tan baja como una FST = 0.02, la cual es una diferenciación pequeña usualmente detectada entre poblaciones sin barreras geográficas entre sí y procesos de diferenciación recientes (digamos unos pocos miles de años de diferenciación debida a deriva génica). Posiblemente el uso de secuencias mitocondriales mayores y de microsatélites confirmaría o rechazaría la carencia de diferenciación entre grupos de talla del calamar gigante.

Si los organismos muestreados no hubieran mostrado diferenciación debido al hecho de no provenir realmente de grupos de talla diferenciados, eso sería posible si en realidad perteneciecen al grupo grande, y los organismos de tallas pequeña y mediana en realidad hayan sido especímenes juveniles en crecimiento del mismo grupo. Lo anterior parece improbable, al menos para las muestras peruanas, por dos razones: primero, los organismos se obtuvieron aleatoriamente en seis localidades de muestreo que abarcan más de 1500 km; y segundo, el grupo pequeño incluyó organismos en estadio de madurez III (Lipinski y Underhill 1995), que es un estadio previo a la madurez reproductiva, lo que indica que dichos organismos difícilmente habrían alcanzado tallas mayores en la madurez. Así, resulta razonable considerar que nuestras muestras contenían organismos de diferentes grupos de talla madurando y creciendo a diferentes tasas.

Este estudio, como cualquier otro de su tipo, no permite rechazar definitivamente la presencia de grupos genéticamente diferenciados pero de hecho si apoya el que las poblaciones peruana y californiana tengan simultáneamente organismos presentes en una amplia extensión geográfica con diferentes tallas y estadios de madurez pero con poca o ninguna diferenciación genética (FST< 0.02). Adicionalmente, este resultado va de acuerdo con la ausencia de diferenciación críptica detectada en otros calamares oegópsidos: en más de 20 especies reportadas, sólo para dos se han detectado especies o subespecies crípticas: Martialia hyadesi (Brierley et al. 1993) y Berryteuthis magister (Katugin 2000). Por otro lado, la mayoría de los calamares miópsidos analizados mediante datos genéticos (todos ellos demersales en contraste con los altamente oceánicos oegópsidos) presentaron especiación críptica (Triantafillos et al. 2004). Por ello, se ha sugerido que las mayores oportunidades de derivar en el ambiente pelágico evita que los oegópsidos tengan aislamiento poblacional localizado que más tarde pudiera resultar en especiación críptica (Triantafillos et al. 2004). Bajo este escenario, D. gigas podría ser el calamar ommastréfido con mayores probabilidades de diferenciación ya que es el único miembro de la familia que presenta características consideradas como nerítico–oceánicas o pseudo–oceánicas, tales como su distribución y su reproducción, características opuestas a los hábitos completamente oceánicos del resto de la familia (Nigmatullin et al. 2001).

Si existen grupos genéticamente divergentes de D. gigas, éstos deberían mostrar una tendencia a habitar nichos ecológicos no traslapados con la población principal que mantiene organismos de diversas tallas y tasas de crecimiento y madurez. Se sugiere, para estudios posteriores, realizar muestreos extensos de organismos no ecuatoriales, así como de organismos ecuatoriales pequeños, registrando cuidadosamente la temporadas, estadio de madurez y posiblemente la edad.

 

Agradecimientos

Este proyecto empleó fondos del Programa de Apoyo para la Investigación e Inovación Tecnológica (PAPIIT) de la Universidad Nacional Autónoma de México (proyecto IN 215901). Agradecemos a C Yamashiro, R Tafur, V Anislado, E Mojica y E Castillo por la provisión de muestras.

 

Referencias

Anderson CIH, Rodhouse PG. 2001. Life cycles, oceanography and variability: Ommastrephid squid in variable environments. Fish. Res. 54: 133–143.         [ Links ]

Argüelles J, Rodhouse PG, Villegas P, Castillo G. 2001. Age, growth and population structure of the jumbo flying squid Dosidicus gigas in Peruvian waters. Fish. Res. 54: 51–61.         [ Links ]

Brierley AS, Rodhouse PG, Thorpe JP, Clarke MR. 1993. Genetic evidence of population heterogeneity and cryptic speciation in the ommastrephid squid Martialia hyadesi from the Patagonian shelf and Antarctic polar frontal zone. Mar. Biol. 116: 593–602.         [ Links ]

Excoffier L, Smouse P, Quattro J. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131: 479–491.         [ Links ]

Hernández–Herrera A, Morales–Bojórquez E, Nevares–Martínez MO, Balmori–Ramírez A, Rivera–Parra GI. 1996. Distribución de tallas y aspectos de la reproducción del calamar gigante (Dosidicus gigas) en el Golfo de California, México, en 1996. Cienc. Pesq. 12: 85–89.         [ Links ]

Katugin ON. 2000. A new subspecies of the schoolmaster gonate squid, Berryteuthis magister (Cephalopoda: Gonatidae), from the Japan Sea. Veliger 43: 82–97.         [ Links ]

Kumar S, Tamura K, Nei M. 2004. MEGA 3: Integrated software for molecular evolutionary genetic analysis and sequence alignment. Brief Bioinform. 5: 150–163.         [ Links ]

Lipinski MR, Underhill LG. 1995. Sexual maturation in squid: Quantum or continuum? S. Afr. J. Mar. Sci. 15: 207–223.         [ Links ]

Mariátegui L, Tafur R, Morón O, Ayón P. 1997. Distribución y captura del calamar gigante Dosidicus gigas a bordo de buques calamareros en aguas del Pacífico centro oriental y en aguas nacionales y adyacentes. Inf. Prog. Inst. Mar. Perú 63: 35–36.         [ Links ]

Markaida U, Sosa–Nishizaki O. 2001. Reproductive biology of the jumbo squid Dosidicus gigas in the Gulf of California, 1995–1997. Fish. Res. 54: 63–82.         [ Links ]

Markaida U, Quiñónez–Velázquez C, Sosa–Nishizaki O. 2004. Age, growth and maturation of jumbo squid Dosidicus gigas (Cephalopoda: Ommastrephidae) from the Gulf of California, Mexico. Fish. Res. 66: 31–17.         [ Links ]

Merrit TJS, Shi L, Chase MC, Rex MA, Etter RJ, Quattro JM. 1998. Universal cytochrome b primers facilitate intraspecific studies in molluscan taxa. Mol. Mar. Biol. Biotechnol. 7: 7–11.         [ Links ]

Miller MP. 1998. Tools for Population Genetic Analyses (TFPGA), version 1.3: A Windows program for the analysis of allozyme and molecular population genetic data. Northern Arizona University, Flagstaff, Arizona.         [ Links ]

Nei M, Kumar S. 2000. Molecular Evolution and Phylogenetics. Oxford Univ. Press, New York, 333 pp.         [ Links ]

Nesis KN. 1970. The biology of the giant squid of Peru and Chile, Dosidicus gigas. Oceanology 10: 140–152.         [ Links ]

Nesis KN. 1983. Dosidicus gigas. In: Boyle PR (ed.), Cephalopod Life Cycles. Vol. I. Species Accounts. Academic Press, London, pp. 216–231.         [ Links ]

Nigmatullin CM, Nesis KN, Arkhipkin AI. 2001. A review of the biology of the jumbo squid Dosidicus gigas (Cephalopoda: Ommastrephidae). Fish. Res. 54: 9–19.         [ Links ]

Posada D, Crandall KA. 1998. MODELTEST: Testing the model of DNA substitution. Bioinformatics 14: 817–818.         [ Links ]

Raymond M, Rousset F. 1995. An exact test for population differentiation. Evolution 49: 1280–1283.         [ Links ]

Ryman N, Palm S. 2006. POWSIM: A computer program for assessing statistical power when testing for genetic differentiation. Mol. Ecol. 6: 600–602.         [ Links ]

Sandoval–Castellanos E, Uribe–Alcocer M, Díaz–Jaimes P. 2007. Population genetic structure of jumbo squid (Dosidicus gigas) evaluated by RAPD analysis. Fish. Res. 83: 113–118.         [ Links ]

Sato K. 1976. Results of exploratory fishing for Dosidicus gigas (D'Orbigny) off California and Mexico. FAO Fish. Rep. 170: 61–67.         [ Links ]

Sunnucks P, Wilson ACC, Beheregaray LB, Zenger K, French J, Taylor AC. 2000. SSCP is not so difficult: The application and utility of single–stranded conformation polymorphism in evolutionary biology and molecular ecology. Mol. Ecol. 9: 1699–1710.         [ Links ]

Tafur R, Villegas P, Rabí M, Yamashiro C. 2001. Dynamics of maturation, seasonality of reproduction and spawning grounds of the jumbo squid Dosidicus gigas (Cephalopoda: Ommastrephidae) in Peruvian waters. Fish. Res. 54: 33–50.         [ Links ]

Triantafillos L, Jackson GD, Adams M, McGrath Steer BL. 2004. An allozyme investigation of the stock structure of arrow squid Nototodarus gouldi (Cephalopoda: Ommastrephidae) from Australia. ICES J. Mar. Sci. 61: 829–835.         [ Links ]

Weir BS, Cockerham CC. 1984. Estimating F–statistics for the analysis of population structure. Evolution 38: 1358–1370.         [ Links ]

Young J, Olson R. 2007. Workshop report: The ecological role of squid in pelagic ecosystems. GLOBEC International Newsletter 13: 43–44.         [ Links ]

 

Nota

* DESCARGAR VERSIÓN BILINGÜE (INGLÉS–ESPAÑOL) EN FORMATO PDF