SciELO - Scientific Electronic Library Online

 
vol.33 número1Análisis por microscopía electrónica de barrido de granos de cuarzo de dunas desérticas y costeras (Desierto de Altar, NW México) índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Ciencias marinas

versão impressa ISSN 0185-3880

Cienc. mar vol.33 no.1 Ensenada Mar. 2007

 

Artículos

 

Distribución de la bacteria causante de la necrosis hepatopancreática (NHPB) en cultivos de camarón blanco, Litopenaeus vannamei, en México

 

Distribution of necrotizing hepatopancreatitis bacterium (NHPB) in cultured white shrimp, Litopenaeus vannamei, from Mexico

 

JC Ibarra-Gámez1, L Galavíz-Silva2, ZJ Molina-Garza2

 

1 Laboratorio de Sanidad Acuícola, Dirección de Recursos Naturales, Instituto Tecnológico de Sonora, Cd. Obregón, Sonora, México, CP 85000. *E-mail: jibarra@itson.mx.

2 Centro Nacional de Sanidad Acuícola, Facultad de Ciencias Biológicas, Universidad Autónoma de Nuevo León, Nuevo León, 66451, México.

 

Recibido en mayo de 2006;
Aceptado en noviembre de 2006
.

 

Resumen

Se realizó el primer monitoreo sistemático en granjas camaronícolas de Sinaloa y Sonora (México) para el diagnóstico presuntivo y confirmativo de la necrosis hepatopancreática (NHP), el primero por microscopía de luz (análisis en fresco y cortes histológicos con hematoxilina y eosina) y el segundo mediante el aislamiento de la bacteria en gradientes de Percoll, reacción en cadena de la polimerasa (PCR) y tinciones negativas al microscopio electrónico de transmisión (MET). Al microscopio óptico, los hepatopáncreas presentaron atrofia, estrangulamientos y necrosis en túbulos, con infecciones agudas por colonias bacterianas en el citoplasma del epitelio tubular, infiltración hemocítica y melanización. Mediante la PCR, los cebadores f 27 y r 235, dirigidos a una región específica del 16S rDNA, amplificaron un segmento de 209 pb en las extracciones de DNA de las muestras analizadas. Al MET se observó la presencia de bacterias pleomórficas, la mayoría ovoides o cilíndricas, de 0.2 µm de ancho y 0.6-0.9 µm de longitud, y con menor frecuencia la de formas helicoidales, con siete a doce giros o torciones, de 0.23 µm de ancho por 2.43-5.27 µm de longitud. Las herramientas de diagnóstico tradicional y molecular permitieron identificar con certeza al agente causal de epizootias como la causada por la bacteria NHPB en la región. Se describe también su prevalencia y distribución geográfica, además de descartar, mediante la PCR y los análisis microbiológicos, otros agentes etiológicos como el virus del síndrome de mancha blanca, el virus de la necrosis hipodérmica y hematopoyética infecciosa, el parvovirus hepatopancreático y la vibriosis.

Palabras clave: Litopenaeus vannamei, necrosis hepatopancreática, hibridación in situ, PCR, MET.

 

Abstract

This paper describes the first systematic monitoring conducted in 2002 at shrimp farms in Sinaloa and Sonora (Mexico) for the presumptive and confirmative diagnosis of necrotizing hepatopancreatitis bacterium (NHPB) in Litopenaeus vannamei. Light microscopy (wet mounts and hematoxilin-eosin-stained sections of hepatopancreas) showed atrophy of the hepatopancreas, strangulation and necrosis of the hepatopancreatic tubules, with masses of NHPB within the tubular epithelium, hemocytic infiltrates and tubular melanization. The gene encoding the 16S rRNA (16S rDNA) of NHPB was amplified by polymerase chain reaction (PCR) from clinical specimens and the bacteria isolated using Percoll density gradient centrifugation. Negative-stain transmission electron microscopy revealed pleomorphic bacteria, most of them ovoid or rod-shaped (0.2 µm wide and 0.6-0.9 µm long), and a helical form demonstrating seven to twelve spiral turns (0.23 µm wide and 2.43-5.27 µm long). Several severe epizootics of commercially grown L. vannamei occurred during the study period and the mortality was attributed to NHPB infection. Using PCR and microbiological analyses, other etiologic agents, such as white spot syndrome virus, infectious hypodermal and hematopoietic necrosis virus, hepatopancreatic parvovirus and vibriosis, were ruled out as contributory factors.

Key words: Litopenaeus vannamei, necrotizing hepatopancreatitis, in situ hybridization, PCR, MET.

 

Introducción

En México, el cultivo de camarón es una industria muy importante ya que genera empleos en zonas no productivas para la agricultura. Actualmente existen 482 granjas con un área estimada en 41,750 ha y una producción de 78,000 TM por año. La mayoría de las granjas se concentran en los estados de Sonora y Sinaloa (Gutiérrez-Venegas 2005).

La bacteria causante de la necrosis hepatopancreática (NHPB) tiene una distribución geográfica documentada en los Estados Unidos de América, Perú, Ecuador, Venezuela, Brasil, Panamá, Costa Rica y Colombia (Lightner 1996, Briñez et al. 2003); afecta al camarón blanco del Pacífico, Litopenaeus vannamei, la especie de mayor importancia económica en América. La NHPB fue descrita por primera vez en Texas (EUA) en 1985 (Johnson 1990), donde provocó un impacto severo en la producción de camarón cultivado, con mortalidades que oscilaron del 20% al 90% (Loy et al. 1996a,b).

Como los signos clínicos no son específicos, el diagnóstico presuntivo de la necrosis hepatopancreática (NHP) se basa en el examen en fresco del tejido del hepatopáncreas, donde se observa una reducción o ausencia de vacuolas lipidícas en el epitelio, túbulos melanizados y tejido atrofiado (Lightner 1996). Para el diagnóstico confirmativo se requiere del uso de sondas moleculares y reacción en cadena de la polimerasa (PCR), lo cual es posible en laboratorios convencionales. En este estudio ambas técnicas fueron complementadas con la microscopía electrónica de transmisión y ultracentrifugación para verificar la presencia de las formas helicoidales y bacilares de la rickettsia y comprobar que se trata del mismo patógeno.

La etiología de la NHP, según estudios histopatológicos y ultraestructurales, corresponde a bacterias intracelulares, Gram negativas, pleomórficas, similares a rickettsias, que residen y se multiplican en células epiteliales del hepatopáncreas (Krol et al. 1991, Lightner et al. 1992, Loy et al. 1996a, b). Asimismo, los estudios moleculares basados en el análisis de la secuencia del 16S rDNA, identificaron al agente etiológico como un miembro de la subclase a de las proteobacterias. Además, con base en la secuencia del mismo gen, particularmente de las regiones variables V5, V8 y V9, se diseñó un par de cebadores con fines de diagnóstico basados en la PCR, y se confirmó la identificación del mismo agente causal en lesiones hepatopancreáticas de L. vannamei cultivado en Texas y Perú (Loy y Frelier 1996, Loy et al. 1996a, b).

Un microorganismo rickettsial aún sin clasificar, pero diferente al agente etiológico de la NHP, se reportó en un solo caso de L. vannamei cultivado en México (Lightner 1996). Asimismo, otros casos recientes de bacterias similares a rickettsias, llamadas RLB (rickettsia-like bacterium) han sido identificados en cultivos de Penaeus monodon cultivado en Madagascar, donde han causado severas mortalidades desde 1999. El análisis por PCR e hibridación in situ de la región 16S RNA, permitió diferenciar las RLB de NHPB (Nunan et al. 2003).

Por lo anterior, se realizó un estudio sistemático para identificar y determinar la distribución y el impacto del agente causal de la NHP en L. vannamei de cultivos mexicanos de los estados de Sonora y Sinaloa.

 

Materiales y métodos

Camarones

Se analizaron un total de 649 muestras (la unidad de muestra fue de 10 camarones) de 9 granjas de Sonora (tabla 1) y 144 muestras de 42 granjas de Sinaloa (tabla 2), durante los ciclos de cultivo de 2002. Se registraron lecturas de salinidad (g L-1) y temperatura del agua, para determinar el grado de asociación con la NHPB. Los organismos moribundos o con signos macroscópicos indicativos de NHP fueron transportados al laboratorio donde se les realizó un análisis cuantitativo para Vibrio en TCBS (Gómez Gil et al. 1998) y análisis en fresco al microscopio de luz (ML). Una parte de las muestras de hepatopáncreas se preservaron etiquetadas en nitrógeno líquido.

Análisis en fresco

La identificación preliminar de la NHPB se realizó en especímenes con hepatopáncreas atrofiado, túbulos hepatopacreáticos con disminución o ausencia de vacuolas lipídicas, estrangulamiento o necrosis de los túbulos hepatopancreáticos y tiempo de coagulación para diferenciar las infecciones por Vibrio de las ocasionadas por NHPB (Lightner 1996).

Histopatología

Las muestras seleccionadas se fijaron inmediatamente en fijador AFA de Davidson para el examen histopatológico de acuerdo a los procedimientos de Bell y Lightner (1988).

Diagnóstico confirmativo por PCR

En los hepatopáncreas con atrofia, el diagnóstico molecular se realizó con la extracción del DNA total de estos órganos con el kit de preparación de placas PCR de alta pureza (High Pure PCR Template Preparation Kit) de Roche Diagnostic, de acuerdo a las instrucciones del fabricante. El PCR fue verificado con el par de cebadores internos 143F y 145R, que amplifica un producto de 848 pb del gen 18S rDNA conservada en decápodos (Kim y Abele 1990). Las reacciones se realizaron con el kit PuReTaq Ready-To-Go PCR (Amersham Biosciences, Piscataway, Nueva Jersey, EUA), en mezclas de reacción de 25 μL, según las instrucciones del fabricante. En cada reacción se depositaron 0.5-2 μL del DNA purificado (10-100 ng), 0.5 mM de los cebadores F27 (5'-ACATGCA-AGTCGAACGCAATAGG-3') y R235 (5'-ACAGATCATA-GGCTTGGT AGGCTG-3), que amplifican una región específica del 16S rDNA de 209 pb de NHPB (Loy y Frelier 1996, GenBank número de acceso U65509). Los cebadores fueron sintetizados por Invitrogen (Carlsbad, California, EUA). El programa de amplificación consistió de 35 ciclos de 30 seg a 94°C, 30 seg a 58°C y 1 min a 72°C, con un ciclo adicional de 5 min a 72°C (Loy et al. 1996a, b). Los productos de PCR fueron analizados por electroforesis en geles de agarosa al 1%, conteniendo 0.5 μg mL-1 de bromuro de etidio en amortiguador TBE al 0.5 × (Sambrook y Russell 2001). Se ejecutó una prueba adicional de PCR para la detección del virus del síndrome de la mancha blanca (WSSV), parvovirus hepatopancreático (HPV) y virus de la necrosis hipodérmica y hematopoyética infecciosa (IHHNV) con el kit PCR multiplex (Diagxotics Inc., Wilton, Connecticut, EUA). A los hepatopáncreas positivos a NHPB se les procesó para el aislamiento de la bacteria.

Aislamiento de la bacteria NHPB

Se depositaron 10 hepatopáncreas conservados en nitrógeno líquido en 5 mL de NaCl al 1.6% para homogeneizarlos mecánicamente (Polytron PT 1200, Suiza). El homogeneizado fue centrifugado a 325 g por 10 min en un rotor IEC 878. El sobrenadante fue recuperado para el proceso de purificación en gradiente de densidades en Percoll (Amersham Biosciences, Piscataway, Nueva Jersey, EUA) a una concentración final de 38.8% (33.8 mL de Percoll, 10 mL de NaCl 1.5 M, 56.2 mL de agua estéril) para centrifugar a 790 g por 2 h a 4°C (Frelier et al. 1993). Las bandas fueron centrifugadas nuevamente a 790 g por 20 min a 4°C y 14000 g por 15 min a 4°C (rotor IEC 875) en NaCl al 1.6% y los precipitados se conservaron en alícuotas a -70°C. De cada alícuota, se realizaron frotis para teñirlos con el colorante de Gram para verificar la presencia de bacterias en las bandas de Percoll (Loy et al. 1996a, b) y posteriormente analizarlas por PCR y microscopía electrónica de transmisión.

Microscopía electrónica de transmisión (MET)

Se fijaron alícuotas de los purificados bacterianos en gluteraldehido al 6% y posteriormente se depositaron en rejillas de cobre cubiertas con colodión y teñidas negativamente con ácido fosfotúngstico (PTA) al 2% a pH 7 para examinarlo al MET (Lightner 1996).

 

Resultados

Al iniciar este estudio se esperaba que los agentes causales de los brotes epizoóticos fueran bacterias del género Vibrio, sin embargo éstas no sobrepasaron las lecturas de riesgo (5,20095,000 UFC por gramo de hepatopáncreas). Además, los resultados por PCR fueron negativos para los virus hepatopancreáticos (HPV, MBV), IHHNV y WSSV.

En cambio, los resultados de este primer estudio sistemático realizado por ML (preparaciones en fresco e histopatológicas), MET y PCR, demostraron la amplificación del DNA de la rickettsia NHPB en las localidades de estudio.

La mayor prevalencia se ubicó en las granjas de San Ignacio Río Muerto (zona norte), con intervalos que oscilaron del 59.5% al 86.2%, coincidiendo los rangos de salinidad más elevada (43.9 a 45.5 g L-1), seguida por las granjas de la región de Cajeme con prevalencias de 28.5 a 48.7% y salinidad de 42 a 45.5 g L-1. En la zona sur de Huatabampo se observó la menor prevalencia (14.6%, tabla 3).

En Sinaloa, las prevalencias más altas se presentaron en la región central, en Navolato (30-42%) y Cospita (20-21.2%), con salinidades de 36 a 41 g L-1. Las menores prevalencias, el 5-7%, se presentaron en el la zona sur (tabla 4).

En los análisis al ML, los camarones cultivados en granjas de Sonora y Sinaloa presentaron atrofia del hepatopáncreas, estrangulamiento y necrosis en túbulos hepatopancreáticos (fig. 1a). Las colonias de bacterias en el citoplasma del epitelio tubular se observaron en infecciones agudas (fig. 1b, c), con focos de descamación de células epiteliales, infiltración hemocítica y melanización (fig. 1d).

Los análisis de PCR revelaron la presencia de productos que coincidieron con el tamaño esperado para la NHPB. La coincided with the size expected for NHPB. The sequence of secuencia de los amplicones está constituida por 209 pb: the amplicons is formed by 209 bp:

3-ACAGATCATAGGCTTGGTAGGCTGTTACCCCACCAACGACCTAATCTGGCACGGGCTCCTCTCTAGGCGATAAATCTTTGATGTTTGCACATATTATAAGGTATTACCTACAGTTTCCCGTAGCTATTCCTTACCTAGAGGTAGATTCCCGTGTAT TACTCACCCGTCTGCCACTCAATAGGCGAACCTATTGCGTTCGACTTGCATGT-5'

En la figura 2 se observa una muestra de los productos amplificados en las reacciones de PCR representativos de Sinaloa y Sonora, junto con los productos de 848 pb correspondientes a una región amplificada de la subunidad ribosomal 18R de camarón, anteriormente descritos.

Las bandas de Percoll de las 12 localidades muestreadas, mediante la tinción negativa al MET, demostraron la presencia de bacterias pleomórficas, la mayoría ovoides y cilindricas de 0.2 μm de diámetro por 0.6 a 0.9 de longitud. Con menor frecuencia se presentaron formas helicoidales con siete a doce giros o torsiones (fig. 3) que midieron 0.23 de ancho y de 2.43 a 5.27 de largo. Los acercamientos al MET de las preparaciones con tinción negativa permitieron apreciar hasta ocho flagelos en el extremo basal de la bacteria y torsiones en hélice (fig. 4a-c).

El análisis de las bandas de Percoll por PCR mostró la amplificación de los productos de 209 pb en las 12 localidades de estudio de Sonora y Sinaloa, confirmándose los resultados previamente observados, pero sin la presencia de los productos de PCR correspondientes al DNA de camarón (fig. 5), el cual fue eliminado en los procesos de ultracentrifugación con Percoll.

 

Discusión

Las infecciones causadas por organismos rickettsiales o similares en camarón silvestre o cultivado P. marginatus y P. merguiensis, así como infecciones experimentales en L. stylirostris, han sido descritas desde 1985 en Singapur y Malasia (Lightner et al. 1985, Brock et al. 1986). Sin embargo, las patologías severas o epizootias asociadas específicamente a la RLB NHPB, se encuentran documentadas en Estados Unidos de América, Centro y Sudamérica desde 1985 hasta años recientes (Johnson 1990, Lightner 1996, Loy y Frelier 1996, Loy et al. 1996a, b, Briñez et al. 2003), con excepción de las granjas camaronícolas localizadas en México, donde sólo se menciona la presencia de organismos similares a las rickettsias (Lightner 1996).

Por medio de la ML, en los análisis en fresco y las preparaciones teñidas con hematoxilina-eosina se apreció la patología propia de la NHP y la presencia de colonias de bacterias Gram negativas, cuyas características han sido descritas por Frelier et al. (1992, 1993) y Loy y Frelier (1996). Al MET se demuestra su similitud con las que han sido reportadas para el agente causal de la NHP en Texas, con formas cilíndricas predominantes que coinciden con la morfometría reportada para microorganismos similares a rickettsias en L. vannamei cultivados en Texas, donde Krol et al. (1991) y Lightner et al. (1992) las describen como formas primarias. Las formas intermediarias no se observaron al MET, siendo difícil su identificación dado que se analizaron sólo tinciones negativas. La forma helicoidal (terminal) presentó un máximo de ocho flagelos en el extremo basal de la bacteria en los acercamientos realizados al MET y coincide en morfometría a la descrita por Lightner et al. (1992).

La secuencia de los productos de la PCR obtenidos en las amplificaciones de los aislados bacterianos de Sonora y Sinaloa, aunada a las observaciones ultraestructurales y al ML, indican como único agente etiológico a NHPB, la cual está distribuida extensamente en las granjas camaroneras del Pacífico mexicano y no se asoció a infecciones por WSSV, IHHNV y HPV.

Las salinidades en las áreas de estudio fueron muy elevadas, con un mínimo de 42 g L-1 en Sonora y de 35 g L-1 en Sinaloa, y asociadas a temperaturas mayores a los 28°C. Al respecto se ha reportado en Texas (EUA), Perú, Venezuela, Ecuador, Costa Rica y Panamá, que la temperatura y salinidad son factores ambientales que juegan un papel muy importante en el desarrollo de la necrosis del hepatopáncreas provocado por NHPB, donde los periodos muy prolongados de temperaturas elevadas (>29-30°C), aunados a altas salinidades (20-40 g L-1), precedieron el desarrollo de epizootias por NHPB de 1993 a 1995 (Lightner 1996).

Lo anterior indica que es necesario implementar programas de monitoreos sanitarios desde el inicio de la siembra, aunados a diagnósticos confirmatorios por PCR (Loy et al. 1996a, b, Briñez et al. 2003), antes de iniciar con la aplicación de tratamientos con antibióticos u otras medidas de manejo recomendadas para enfermedades bacterianas, pues esta patología puede pasar desapercibida por días y repentinamente convertirse en un evento fuera de control. En resumen, la aplicación de ML, MET y PCR aunado a la técnica de ultracentrifugación en Percoll, permitió identificar al agente causal de la NHP en México y conocer su distribución e impacto en los cultivos mexicanos.

 

Agradecimientos

A CL Badillo e I Cárdenas-Vallarta del ITSON por el apoyo en los procesos de análisis de muestras. A JC Martínez-Alvarez por el apoyo técnico en Acuadiag, Culiacán. A J Piñeiro-López de la Unidad de Microscopía Electrónica de la FCB y a E Ramírez-Bon del Hospital Universitario, de la UANL, por su apoyo para la realización de la microscopía electrónica de transmisión.

 

Referencias

Bell TA, Lightner DV. 1988. A Handbook of Normal Shrimp Histology. Special Publication No. 1. World Aquaculture Society, Baton Rouge.         [ Links ]

Briñez B, Aranguren F, Salazar M. 2003. Fecal samples as DNA source for the diagnosis of necrotizing hepatopancreatitis (NHPB) in Penaeus vannamei broodstocks. Dis. Aquat. Org. 55: 69-72.         [ Links ]

Brock JA, Nakagawa LK, Hayashi T, Teruya S, VanCampen H. 1986. Hepatopancreatic rickettsial infection of the penaeid shrimp Penaeus marginatus (Randall) from Hawaii. J. Fish Dis. 9: 73-77.         [ Links ]

Frelier FP, Sis RF, Bell TA, Lewis DH. 1992. Microscopic and ultrastructural studies of necrotizing hepatopancreatitis in Pacific white shrimp (Penaeus vannamei) cultured in Texas. Vet. Pathol. 29: 269-277.         [ Links ]

Frelier FP, Loy KJ, Kruppenbach B. 1993. Transmission of necrotizing hepatopancreatitis in Penaeus vannamei. J. Invertebr. Pathol. 61: 44-18.         [ Links ]

Gomez-Gil BL, Tron-Mayen JF, Turnbull V, Inglis AL, Guerra-Flores. 1998. Species of Vibrio spp. isolated from hepatopancreas, hemolymph and digestive tract of a population of healthy juvenile Penaeus vannamei. Aquaculture 163: 1-9.         [ Links ]

Gutiérrez-Venegas JL. 2005. La industria del cultivo de camarón en México, su historia, presente y proyección al futuro. Industria Acuícola 1: 6-22.         [ Links ]

Johnson SK. 1990. Digestive gland manifestation. In: Johnson SK (ed.), Handbook of Shrimp Diseases. Sea Grant Publication No. TAMU-SG-90-601, Texas A & M University, Galveston.         [ Links ]

Kim W, Abele LG. 1990. Molecular phylogeny of selected decapod crustaceans based on 18S rRNA nucleotide sequences. J. Crust. Biol. 10: 1-13.         [ Links ]

Krol RM, Hawkins WE, Overstreet RM. 1991. Rickettsial and mollicute infections in hepatopancreatic cells of cultured Pacific white shrimp (Penaeus vannamei). J. Invertebr. Pathol. 57: 362-370.         [ Links ]

Lightner DV. 1996. A Handbook of Shrimp Pathology and Diagnostic Procedures for Diseases of Cultured Penaeid Shrimp. World Aquaculture Society, Baton Rouge.         [ Links ]

Lightner DV, Redman RM, Williams, Mohney RR, Clerx LL, Bell TA, Brock JA. 1985. Recent advances in penaeid virus disease investigations. J. World Maricult. 16: 267-274.         [ Links ]

Lightner DV, Redman RM, Bonami JR. 1992. Morphological evidence for a single bacterial etiology in Texas necrotizing hepatopancreatitis in Penaeus vannamei (Crustacea: Decapoda). Dis. Aquat. Org. 13: 235-239.         [ Links ]

Loy JK, Frelier PF. 1996. Specific, nonradioactive detection of the NHP bacterium in Penaeus vannamei by in situ hybridization. J. Vet. Diagn. Invest. 8: 324-331.         [ Links ]

Loy JK, Frelier P, Varner P, Templeton JW. 1996a. Detection of the etiologic agent of necrotizing hepatopancreatitis in cultured Penaeus vannamei from Texas and Peru by polymerase chain reaction. Dis. Aquat. Org. 25: 117-122.         [ Links ]

Loy JK, Dewhirst EF, Weber W, Frelier PF, Garbar LT, Tasca IS, Templeton JW. 1996b. Molecular phylogen and in situ detection of the etiologic agent of necrotizing hepatopancreatitis in shrimp. Appl. Environ. Microbiol. 69: 3439-3445.         [ Links ]

Nunan ML, Poulos B, Redman R, Groumellec LM, Lightner DV. 2003. Molecular detection methods developed for a systemic rickettsia-like bacterium (RLB) in Penaeus monodon (Decapoda: Crustacea). Dis. Aquatic Org. 53: 15-23.         [ Links ]

Sambrook J, Russell DW. 2001. Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.         [ Links ]

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons