Vanilla (Vanilla planifolia) is a hemiepiphyte plant of the Orchidaceae family native to Mesoamerica, whose domestication and diversification center is located in the central-northern zone of the state of Veracruz, Mexico. This orchid grows in warm climates at temperatures between 20 and 30 °C, under specific light-shade conditions, and requires a “tutor,” that is, a plant or an artificial construction to support it. Vanilla plants require two years of vegetative growth, and the first fruits are not produced until the third year. In Mexico, vanilla plants are sown to 874.50 ha, where 494.69 annual tons of processed or “benefitted” fruits are harvested. The major vanilla producing states are Veracruz, Oaxaca, Puebla, and San Luis Potosí. In San Luis Potosí, the vanilla producing region is located in the southern Huasteca Potosina, which includes the municipalities of Axtla de Terrazas, Tamazunchale, Aquismón, Matlapa, Coxcatlán, Huehuetlán and Xilitla (Figure 1).

It is known that vanilla plants can be susceptible to infection caused by the Fusarium oxysporum fungus, which produces leaf chlorosis and root and stem rot, and eventually the loss of the whole plant (^{Adame-García et al., 2015}). For several decades, vanilla (V. planifolia Jacks. ex Andrews) has been cultivated under traditional systems in the southern Huasteca in San Luis Potosi, producing quality fruits with no apparent symptoms of infection. However, in the summer 2018, a group of vanilla producers from that region detected wilt and chlorosis, which are characteristic symptoms of infection caused by fungi, on several vanilla plants in production age. In order to identify the possible fungi associated with those plants, in September and October 2018, three independent samplings were conducted using plants from two fields of approximately 1.5 ha (coordinates 21.316651, -98.831236) at the community of Cuichiapa, Matlapa, San Luis Potosí, Mexico. In the sampling sites, vanilla is grown in the open field and under a system called “mesh house.” For the samplings, each plot was divided in four quadrants, and samples of leaves, stems, and fruits of five plants with infection symptoms from each quadrant were collected. The samples were placed in humid chambers at 4 °C and immediately taken to the laboratory to be processed. The vanilla tissues were washed with 10% sodium hypochlorite, rinsed with abundant sterile distilled water, and dried with sterile paper towels. Transverse and longitudinal cuts were made to the plant tissues and then small tissue fragments approximately 1 cm² in size were placed on agar-potato-dextrose (PDA) culture medium to which carbenicillin (100 µg mL^-1) was added to prevent bacterial contamination. Three tissue segments were placed on each Petri dish with culture medium; all the samples were sown in triplicate and then incubated at 28 °C in darkness. The cultures were monitored every day for eight days until fungal colonies started to grow at the contact sites of the tissue sample and the culture medium. From the Petri dishes where fungi grew, mycelium samples were taken and placed on new Petri dishes with PDA medium to obtain cultures with the same colony morphology, and then from these obtain monosporic cultures which were later used to conduct morphological and molecular identification of fungi. To obtain monosporic cultures, the fungus spores were collected using a 0.1% Tween 80 sterile solution; a suspension of 100 spores mL^-1 was prepared, and using a spatula Drigalski, 100 µL of the suspension were sown in PDA culture medium. The Petri dishes were incubated under the above described conditions until fungal colonies started to grow; the new colonies were transferred to new Petri dishes with culture medium. Three colonies from three different fungi isolates with similar morphological characteristics (macroscopic and microscopic) were later used to extract DNA and amplify and sequence the ITS.

Figure 1. Location of the vanilla producing municipalities in the southern Huasteca Potosina and study site. 1) Tamazunchale, 2) Aquismón, 3) Huehuetlán, 4) Axtla de Terrazas, 5) Matlapa, 6) Tancanhuitz de Santos, 7) Coxcatlán, 8) Xilitla. The number five in black indicates the municipality where the study site is located.  

The microscopical identification of the fungi isolates was performed using the microculture technique. The fungi hyphae and structures were stained with lactophenol cotton blue solution (Sigma-Aldrich, 113741) and directly observed under a light field microscope (Carl Zeiss, Oberkochen). Their morphological characteristics were determined using the taxonomic keys described by ^{Leslie and Summerell (2006}). Mycelium of the three different fungi isolates that had grown for six days in PDA solid culture medium was also collected and frozen with liquid nitrogen. The mycelium was pulverized with a mortar, and 100 mg were used to extract genomic DNA. The DNA was extracted using phenol-chloroform, washed with 70% ethanol, and re-suspended in sterile deionized water. The DNA integrity was observed using 1% ultrapure agarose gel electrophoresis (Sigma, MA) and its concentration was determined in a NanoDrop Thermo Scientific spectrophotometer (Waltham, MA). Later, the Internal Transcribed Spacers (ITS) region of the genomic DNA samples was amplified by PCR. The amplification was carried out using Taq DNA polymerase Platinum High Fidelity (Invitrogen, MA), the oligonucleotides ITS1 CTTGGTCATTTAGAGGAAGTAA and ITS2 GCTGCGTTCTTCATCGATGC (^{Bellemain et al. 2010}), and 100 ng of genomic DNA of each fungus. The conditions for PCR were as follows: initial denaturation temperature at 94 °C for 2 min; 35 cycles with denaturation at 94 °C for 15 s, alignment at 55 °C for 30 s, extension at 68 °C for 20 s, and one final extension at 72 °C for 1 min. The PCR products were visualized in 1% ultrapure agarose gel (Thermo Fischer Scientific), purified with a D4033 kit from Zymo Research (Irvine, CA), and their concentration was quantified in a NanoDrop Thermo Scientific spectrophotometer (Waltham, MA). The PCR products were sequenced with the ITS1 oligonucleotide and the Sanger platform (ABI 3730 XL, Applied Biosystem) in the Genomic Services Laboratory of UGA-CINVESTAV, in Irapuato, Guanajuato, Mexico. The sequences were edited with the BioEdit 7.2.5 software and subsequently analyzed with BLAST on the online site of the National Center for Biotechnology (NCBI) (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Finally, spores of the three pure isolates were cryopreserved in tubes containing 25% glycerol at -80 °C in the strain pool of the Fungi Development and Differentiation Laboratory of CINVESTAV, Irapuato Unit.

Based on the guidelines to determine the damage caused to agricultural crops described by ^{Gabriel et al. (2017}), it was observed that approximately 70% of the vanilla plants with symptoms showed general wilt. In addition, some leaves and fruits had chlorotic areas and necrotic or rotten spots (Figures 2A and 2B). Interestingly, the leaves and fruits with symptoms were easily detached from the stem at different times during the sampling. Five days after the tissue segments were sown in PDA medium, the growth of filamentous fungal colonies was observed at the contact areas between the plant tissue and the culture medium. After obtaining fungal isolates with similar macroscopic characteristics, approximately 15 fungal isolates per sampling were taken, which were then used to obtain monosporic cultures. The pure fungal colonies developed filamentous, scattered, and abundant mycelium, with slight accumulation of macronidia and microconidia in the middle of the colony. The production of pigments violet in color was observed on the front of the colony, and yellow-brown coloration on the back of the culture medium (Figure 2E). Abundant septate and hyaline mycelium was observed under the microscope and, after one week of growth, the formation of chlamydospores approximately 8 µm in diameter was also observed (Figure 2F), as well as kidney-shaped or oval microconidia approximately 7 µm long (Figure 2G).

The ITS sequences of the three isolates were deposited in the GenBank of the NCBI with accession numbers MT573368, MT573369, and MT573370. Those sequences were approximately 230 nucleotides in length, and had 100% coverage and 99.55% similarity with the Fusarium oxysporum species complex, in particular with the O309 isolate reported in NCBI under code MT032690.1, which was isolated from roots, leaves and stems of pumpkin plants. These results prove that the three fungal isolates that were sequenced correspond to the same species of the Fusarium genus, but conducting more robust molecular and phylogenetic studies would make it possible to confirm the species, as well as the forma specialis (f. sp.) of the fungus, that is, the taxonomic group within the F. oxysporum species to which the isolated fungus belongs considering its range of host plants.

Fusarium oxysporum is a group with over 100 formae speciales (ff. spp.) of phytopathogenic and highly virulent fungi that can saprophytically survive for long periods in soil organic matter waiting for weak plants or hosts. Many of these fungi are pathogen agents of economically important plant species worldwide. In Mexico, different species of the Fusarium genus have been reported in economically important crops with infection symptoms, for example, in Valencia var. orange trees and mango plants. Infection caused by F. oxysporum has also been previously reported on vanilla plants cultivated in the states of Veracruz (^{Adame-García et al., 2015}) and Nayarit (^{Casillas-Isiordia et al., 2017}), where plants that had been directly inoculated with the fungus isolates showed significant chlorotic and necrotic or rotten areas, symptoms that were also observed on the plants used in this study. This study reports for the first time the isolation and identification of Fusarium isolates associated with vanilla plants cultivated in the Huasteca region of the state of San Luis Potosí. Therefore, based on the results of this study, further research is proposed to evaluate infection on healthy vanilla plants using the reported Fusarium isolate, under in vitro and in vivo conditions, as well as conducting more robust molecular experiments that make possible to define the forma specialis of the fungus.

Figure 2. Infection symptoms observed on vanilla plants cultivated in the southern Huasteca Potosina, and images of the isolated Fusarium fungus. A: Vanilla leaf with chlorotic and necrotic spots (red arrow). B: Vanilla fruits with chlorosis and important areas with necrosis (red arrow). C and D: Leaves and fruits of vanilla plants with no infection symptoms. E: Fusarium growth in PDA medium and in darkness. F: Fusarium mycelium and chlamydospores. G: Fusarium microconidia.