One of the major constraints to papaya (Carica papaya) production agroecosystems is the disease caused by the Papaya ringspot virus (PRSV-P) (^{Rivas-Valencia et al., 2008}). This virus belongs to the Potyvirus genus and is transmitted in a non-persistent manner transmitted by different aphid species present in weeds, in the plot or nearby areas. Symptoms of the disease are chlorosis on young leaves, yellow and green mottling, clearing along leaf veins, and oily spots on the petioles, stems, and fruit. In advanced stages, the disease causes deformation and reduction of the leaf area (^{Chalak et al., 2017}). These symptoms reduce the quality of leaves and cause production losses ranging from 30 to 100% (^{Hernández-Castro et al., 2015}). Chemical control to eliminate the vectors has proven to be ineffective. Cultural control seeks to identify and eliminate plants that have been recently infected acting as a source of inoculum. These measures are intended to delay viral incidence and partially reduce crop damage (Hernández-Castro et al., 2010). In Mexico, the genetic variability of PRSV-P can be as wide as the diversity of ecological niches where papaya is grown (^{Ordáz-Pérez et al., 2017}). This variability can cause some strains to develop different symptoms (^{Spetz et al., 2003}). ^{Cabrera-Mederos et al. (2008}) state that the symptoms depend on the viral isolate. On their part, ^{González et al. (2003}) were able to distinguish differences in the symptomatology produced by attenuated and severe strains of PRSV-P when they were mechanically inoculated in different host species. ^{Noa-Carrazana et al. (2006}) reported at least three different virus isolates collected in Tierra Blanca, Cotaxtla, La Antigua and Paso de Ovejas municipalities, all of them located in the central zone of the State of Veracruz, which include the main papaya producing area. Therefore, the objective of this study was to characterize the diversity of symptoms using radial graphics and analyze the pathogenic evidence to support the variability of PRSV-P populations found in commercial orchards of papaya Maradol Roja variety in the central zone of Veracruz.

For the experiment, foliar tissue of 8-15-month-old plants of papaya Maradol Roja variety was collected in the municipalities of La Antigua, Cotaxtla, Tlalixcoyan and Tierra Blanca, Veracruz, Mexico. The plants had the following symptoms characteristic to PRSV-P: clearing and ramification of the main leaf veins, smooth mosaic, green patches and isles, streaks, general and sectorial chlorosis, bunchy appearance, epinasty and filiformity. In the five plots that were inspected in each municipality, ≈200 infected plants were observed, which made it possible to distinguish the differences or similarities of the symptoms in the field. Two leaves per infected plant showing differential disease severity were collected. They were kept in hermetic plastic bags in a cooler with cooling gels until they were used later for mechanical transmission. In the laboratory, six groups of leaves with symptoms and differential severity were formed. From each group of similar symptoms, the most representative leaf was taken for mechanical transmission in 10 three-month-old healthy papaya plants. For this, papaya seeds of the Maradol Roja variety were sown (Semillas del Caribe®). Seedbed trays were washed and disinfected with 5% NaClO, and then filled with Cosmo Peat^® substrate. Papaya seedlings were transplanted to black plastic bags (40 x 40 cm, 600 gauge) filled with a 1:1 mixture of Cosmo Peat^® substrate and soil rich in organic matter. Later, they were taken to a greenhouse with anti-aphid mesh at Campus Veracruz of Colegio de Postgraduados. Imidacloprid was applied in drench to the plants to protect them against aphids, and abamectin was applied every seven days to protect them against mite attack.

For inoculation, 2 g of infected leaves were macerated, and 10 mL of a pH 7, 0.01 M potassium phosphate buffer solution were added. A lesion to the first three completely expanded leaves of healthy plants was made with carborundum, and a buffer solution containing viral particles was immediately applied using a cotton swab (^{Valderrama et al., 2015}). A total of 60 plants were inoculated, 10 plants per group of symptoms; 10 healthy plants were separated and used as the control. The virus inoculated in 10 plants was considered as a virus collection, which was corroborated by conducting a molecular analysis. In Table 1 we propose a nomenclature for each foliar symptom produced by PRSV-P in the plants that were inoculated. To observe if the symptoms characterized during the plant field-collection could be replicated in the greenhouse, they were ordered based on a scale for disease severity (Table 2) (^{Flores-Bautista et al., 2018}). Radial graphics were constructed using Sigma Plot^® software to facilitate the characterization of the symptoms system and associate it with each collection. The graphics make it possible to observe and compare the relative values among collections with an initial central point that indicates a leaf with no-symptoms.

For molecular identification, a RT-PCR test was conducted using the plants inoculated in the greenhouse to detect the presence of PRSV-P. For the test, a Multigene Labnet® thermocycler and the Promega RT-PCR System® product were used. The viral RNA was obtained using the Zymo Research® extraction kit, following the manufacturer’s instructions. To amplify the capsid protein (CP) gene, the primers described by ^{Noa-Carrazana et al. (2006}) were used: 3F(5´ GACCATGGTCCTAGAATGAAGCTGTGGATG 3´) and 11R (3´TTTTTTTTCTCTCATTCTA AGAGGCTC 5’). The amplification program consisted of one cycle at 45 ° for 45 min, one cycle at 94 °C for 2 min, 40 cycles at 94 °C for 30 s, 1 min at 60 °C and 2 min at 68 °C; and one final extension cycle at 68 °C for 7 min. The amplified products were visualized by electrophoresis in 1% agarose gel. The amplified fragments were purified using the Zymo Research® kit, sequenced with an AB 3130® equipment applying the Sanger technique and capillary technology at Instituto Potosino de Investigación Científica y Tecnológica, A.C., Mexico. The sequences obtained were compared to other sequences of Mexican isolates stored in the GenBank^® (DQ008449.1, DQ008448.1 and DQ00847.1), and 92-98% identity was found, corroborating the virus identity.

The presence of PRSV-P was confirmed by observing positive amplicons of 1071 base pairs that corresponded to the region of the viral capsid (CP) (Figure 1). The first symptoms appeared 40 days after mechanical inoculation (dai). Changes in symptomatology and a severity increase in some of the symptoms were not observed until 60 dai. ^{Chávez-Calvillo et al. (2016}) also observed the highest level of damage caused by PRSV-P at 60 dai, associated with the highest level of leaf deformation, clearing along leaf veins and severe mosaic. ^{Singh et al. (2017}) mention that PRSV-P caused systemic mosaic and leaf deformation symptoms in papaya and other hosts. The severity scales of different authors catalog the symptoms in a generic way, while our study provide a detailed characterization of each foliar symptom caused by PRSV-P (Figure 2). Some of the symptoms produced by PRSV-P are similar to those recorded by ^{Hernández-Castro et al. (2010}), including chlorosis, mosaic and leaf blade reduction. Conversely, the characterization proposed in this study shows two types of chlorosis and four symptoms associated with mosaics.

Figure 1. Positive amplicons to the capsid protein of PRSV-P, analyzed by RT-PCR. Electrophoresis in 1X agarose gel, run in TAE buffer. (1 kb): molecular weight marker; (+): positive control; (-): negative control; (C4Ant14, C5TB1, C6Tla3, C1Cot4, C2Ant5): Virus collections with a differentiated symptoms system (Table 1). 

Figure 2. Characterization of PRSV-P foliar symptoms mechanically-inoculated in three-month-old plants of papaya Maradol Roja variety under greenhouse conditions, from December 2018 to May 2019. Campus Veracruz, Colegio de Postgraduados. A) Clearing of the main veins; B) clearing of ramified leaf veins; C) smooth mosaic; D) green patches; E) green isles; F) streaks; G) general chlorosis; H) sectorial chlorosis; I) bunchy appearance; J) epinasty; K) filiformity; L) healthy leaf. 

^{Rodríguez et al. (2014}) observed clearing of leaf veins, mosaic, blisters, and foliar deformation symptoms at 45 dai. In the present study, smooth mosaic, green isles, three types of leaf deformation, and two types of clearing of leaf veins also were characterized (Figure 2). Additionally, a differentiation of symptomatology was made between each plant inoculated in the greenhouse and the plants collected in the field (Table 3). Representing the symptoms in radial graphics (Figures 3 and 4) made it possible to characterize each collection in a differential way and observe the different levels of severity of each symptom. Figure 3 shows the symptoms that appear in fall-winter; where collections C4Ant14 (36% severity in the clearing of the main and ramified nerves) and C5TB1 (36% severity in clearing of the main nerves) can be differentiated, even when the length of the curves is concentrated in the upper right-hand side, where moderate symptoms that cause less damage to the plant are found.

Figure 3. Radial diagrams of foliar symptoms severity produced by six PRSV-P collections in C. papaya in the 2018 fall-winter cycle, 55 days after mechanical inoculation. 

Figure 4. Radial diagrams of foliar symptoms severity produced by six PRSV-P collections in C. papaya in the 2019 spring-summer cycle, 195 days after mechanical inoculation. 

The collections C1Cot4, C2Ant5, C3Ant1 and C6Tla3 show curves that tend to concentrate in the upper left-hand side of the graphic, where the typical symptoms of foliar area deformation are plotted. Also, an association of symptoms was observed in these collections. As suggested by ^{Rodríguez et al. (2014}), there was also a relation between the severity of symptoms and the temperature, with less severe symptoms at temperatures higher than 35 °C. In the 2019 spring-summer cycle (Figure 4), “streaks” were observed in collections C1Cot4 and C5TB1, a symptom that was not observed during the cool temperature season (23 °C, fall-winter).

The reduction of severity and mitigation of symptoms could be associated with temperatures higher than 35 °C, as mentioned by ^{Ordáz-Pérez et al. (2017}). The C5TB1 collection showed the highest level of severity during the first 60 dai of this season with filiformity and epinasty symptoms, which caused the most damage to the plant. ^{Cabrera-Mederos et al. (2010}) observed similar PRSV-P symptoms, with slight mosaic and no filiformity when the infected plants were placed in a greenhouse at 38 °C. Later, when the temperature was reduced to 20 °C under controlled conditions, the symptoms became severe again. ^{Bau et al. (2004}) observed variation in the expression of PRSV-P symptoms, according to the year’s season, with an increase in the cold (19 °C) and rainfall seasons (26 °C). Overall, the development of viral diseases is associated with temperatures between 16 and 30 °C (Cabrera-Mederos et al., 2010); higher temperatures cause a low viral concentration, which mitigates the symptoms and the plant apparently recovers from the disease.

The six collections of PRSV-P could be separated by foliar symptomatology through the characterization of symptoms and the use of radial graphics proposed in this study. The highest level of severity was observed in the lowest environmental temperature of the season compared to the spring-summer season. The differences found among virus collections could be an indicator of the virus genetic variability. For this reason, further studies must be conducted using indicator plants to determine whether the symptomatology produced by the collections is replicated in different hosts. Besides, molecular studies in the regions involved in the development of symptomatology and severity, such as the viral capsid (CP) and the auxiliary component (HC-Pro), might show if there is a difference in nucleotides that makes a difference in the expression of symptoms and severity caused by the virus. Together, biological and molecular assays could determine different viral isolates, including attenuated and severe isolates.