SciELO - Scientific Electronic Library Online

 
vol.37 número3Distribución, incidencia y severidad de la muerte descendente (Lasiodiplodia spp.) en lima persa en Morelos, México índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Revista mexicana de fitopatología

versão On-line ISSN 2007-8080versão impressa ISSN 0185-3309

Rev. mex. fitopatol vol.37 no.3 Texcoco Set. 2019  Epub 30-Set-2020

https://doi.org/10.18781/r.mex.fit.1905-4 

Phytopathological reports

First report of Lasiodiplodia on blackberry plants (Rubus subgenus Eubatus) in the Michoacan state, Mexico

Miguel Contreras-Pérez1 

Gustavo Santoyo-Pizano1  * 

Sergio de los Santos-Villalobos2 

María Angélica Gutiérrez-García3 

María del Carmen Orozco-Mosqueda3 

María del Carmen Rocha-Granados3 

1 Instituto de Investigaciones Químico Biológicas, Universidad Michoacana de San Nicolás de Hidalgo. Avenida Universidad S/N, Edificio A1’, Morelia, Michoacán, C.P. 58030, México.

2 CONACYT-Instituto Tecnológico de Sonora, 5 de febrero 818 Sur, Colonia Centro, C.P. 85000, Ciudad Obregón, Sonora, México.

3 Facultad de Agrobiología “Presidente Juárez”, Paseo Lázaro Cárdenas 2290, Uruapan, Michoacán, C.P. 60170, México.


Abstract.

In 2017, there were several outbreaks of diseases caused by phytopathogenic fungi in blackberry of the “Tupi” variety (Rubus subgenus Eubatus) crops in Los Reyes-Periban region, Michoacán. Fungal isolates were obtained from symptomatic plants. In this work, the pathogen AB1 was morphological and molecularly characterized. Through BLAST homology searches of the 18S rRNA marker and the rDNA internal transcribed spacer region (ITS), the fungi AB1 had a high identity with fungus of Lasiodiplodia genus (Lasiodiplodia theobromae and Lasiodiplodia parva), additionally, infection of Lasiodiplodia sp. AB1 in blackberry plants was corroborated in vitro. This is the first report of the isolation of the phytopathogenic fungus Lasiodiplodia sp. in blackberry crops.

Key words: Infection; Tupi; Stem rot; Molecular characterization

Resumen.

En el año 2017 se presentaron diversos brotes de enfermedades causadas por hongos fitopatógenos en cultivos de zarzamora variedad “Tupi” (Rubus subgénero Eubatus) de la región de Los Reyes-Peribán, Michoacán. De las plantas afectadas se realizaron varios cultivos para el aislamiento y caracterización de hongos fitopatógenos. En este trabajo, se caracterizó morfológica y molecularmente la cepa fúngica AB1, mediante la amplificación y secuenciación del gen ribosomal 18S y la región intergénica (ITS). Los análisis BLAST mostraron que el aislado fúngico AB1 tuvo una alta identidad con hongos del género Lasiodiplodia (Lasiodiplodia theobromae y Lasiodiplodia parva), adicionalmente se corroboró in vitro la infección de Lasiodiplodia sp. AB1 en plántulas de zarzamora. Este es el primer reporte de la presencia de Lasiodiplodia sp. en cultivos de zarzamora de la variedad ¨Tupi¨.

Palabras clave: Infección; Tupi; Pudrición del tallo; caracterización molecular

The municipality of Los Reyes, Michoacán, Mexico is the main producer of blackberries (Rubus subgénero Eubatus) in the country, providing over 80% of the national yearly production, which amounts to over 260 thousand tons (SIAP-SAGARPA, 2012-2018). Blackberry production is affected by several species of fungi, causing losses in production, as well as economic losses of up to 25%, equal to 2,540 million pesos per year. Among the main diseases that impact blackberry crops are the gray mould (Botrytis cinerea), orange rust (Arthuriomyces peckianus), leaf spot (Cercospora sp.), anthracnosis (Colletotrichum gloeosporioides), mildew (Peronospora sparsa), and root rot (Fusarium sp.) (Fernández-Pavía et al., 2012). However, soil and weather conditions that are changing as a consequence of the intensive agricultural practices and climate change, have exerted an influence on the appearance of diverse emerging phytopathogens with negative impacts on the production of agricultural crops of economic, social and cultural interest. Therefore, the correct identification and characterization of said emerging phytopathogens is important to propose efficient control strategies.

In 2017, blackberry farms located in the municipalities of Los Reyes and Peribán, Michoacán (19° 32’ 3.728’’ N and 102° 31’ 12.503’’ W) presented plants in a vegetative state, diseases with leaf, branch and stem necrosis (with a basipetal progression), followed by defoliation and the death of the plant (Figure 1A). These symptoms had not been described by causal pathogens normally reported for blackberry crops, therefore affected plant tissue was gathered, mainly necrotic stems from 5 plants. The samples gathered were kept in humid chambers at 4 °C and later transported to the lab for their immediate analysis in order to identify the biological agent that caused such symptoms. For the isolation of the pathogen, the samples were disinfected superficially, washing with 2% chlorine 3 times, and rinsing with sterile distilled water; later, the tissue was grinded in a sterilized mortar. Sections measuring 0.5 cm were planted in Petri dishes with Potato Dextrose Agar (PDA) to promote fungal growth. The inoculated Petri dishes were incubated at 30 °C in the dark for 48 hours. The fungal isolates observed were cultured under the same growing conditions in order to purify the isolations, which showed a rapid mycelial growth (1.5 cm in 6 h), white in color (24 h) (Figure 1B), and later turning black (³48 h) (Figure 1C). In addition, preparations were carried out, using bromophenol blue (observed under an optic microscope) to determine the reproductive structures reported for the genus Lasiodiplodia, such as abundant mycelial growth, composed of mature septated hyphae and conidia (Figure 1D and 1E), ovoidal to elliptical in shape, with a grainy content and an round apex (Alves et al., 2008). A monosporic fungal isolation, AB1, was stored with the code ZPQ1 in the Collection of Native Edaphic and Endophytic Microorganisms-COLMENA (de los Santos-Villalobos et al., 2018).

The molecular identification of AB1 began with the extraction of the deoxyribonucleic acid (DNA) from the mycelium of the fungus (1 mg), which was placed in 0.2 mL of TES buffer, mixing the suspension vigorously; next, 5 mg mL-1 of K proteinase were added, along with ammonium acetate, and it was washed with ethanol at 70% and isopropanol in ice. Finally, the residual ethanol was evaporated from the pellet and the DNA was resuspended in deionized water. The quality and concentration of the extracted DNA were verified using an agarose-TAE gel at 1 % and a Thermo Scientific NanoDrop 2000c spectrophotometer. The fungal DNA extracted was used for the amplification of the ribosomal RNA 18S gene using the universal oligonucleotides NS1 (GTAGTCATATGCTTGTCTC) and NS8 (TCCGCAGGTTCACCTACGGA); as well as the intergenic region (ITS) with oligos ITS4 (TCCGTAGGTGAACCTGCGG) and ITS5 (TCCTCCGCTTATTGATATGC) (Toju et al., 2012). The resulting amplicons were analyzed by electrophoresis in an agarose-TAE gel at 1% and later purified using the kit The Wizard® SV Gel and Promega PCR Clean-Up System, to then sequenced by a commercial company (Macrogen, Korea). The DNA sequences obtained were analyzed using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to obtain the taxonomic identity/affiliation of the fungal isolate. The sequence of gene 18S RNAr of the isolation AB1 obtained was 1,050 base pairs (bp) (NCBI Access num.: MG757345.1). This sequence displayed a high coverage (100%) and similarity (99.52%) with Lasiodiplodia theobromae and Lasiodiplodia parva. The ITS sequence has a length of 539 bp (NCBI Access num: MK841036.1), displaying an identity of 99.81% with multiple Lasiodiplodia theobromae and Lasiodiplodia parva isolations (Table 1). Lasiodiplodia is a fungal genus that comprises at least 30 species (Rodríguez-Gálvez et al., 2017), which have been related to several economically important diseases in agricultural crops, where the causal agent is found as a latent endophyte. Based on the molecular identification of the gene 18S RNAr and the ITS region ADNr, the AB1 isolation has been affiliated to the genus Lasiodiplodia sp., until further studies are carried out to classify this isolation at a species level.

Figure 1 Isolation and morphological and infection characterization of the phytopathogen Lasiodiplodia sp. AB1. A) Nec rotized blackberry tissue, material obtained from the isolation of Lasiodiplodia sp. AB1. B) Lasiodiplodia sp. AB1 mycelium at 5 days of growth. C) Lasiodiplodia sp., strain AB1 mycelium after 10 days of growth. D) Mature co nidia. E) Portion of the Lasiodiplodia sp., strain AB1 mycelium, stained with bromophenol blue. F) Blackberry var. ‘Tupi’ seedling planted in vitro. G) F) Blackberry var. ‘Tupi’ seedling infected with Lasiodiplodia sp., strain AB1; arrows indicate nectrotized areas. 

In addition, pathogenicity tests were carried out in the isolation AB1 to corroborate its role as a causal agent of the symptoms observed in blackberry plants. To confirm the Koch postulates, an in vitro infection test was carried out, in which blackberry seedlings of the “Tupi” variety were micropropagated, placing three plants per jar, which were then inoculated 1x106 spores of the isolation AB1 (control plants were sprayed with sterile distilled water). The plants were incubated for 5 days in a Percival AR66L growth chamber at a constant temperature of 22 °C and a light period of 16 hours and 8 hours of darkness. After the time of inoculation of isolation AB1, all inoculated plants displayed similar symptoms to those observed in commercial farms, chlorosis, as well as areas with leaf and stem necrosis. Also, strain AB1 was re-isolated and characterized from the symptomatic plants. This shows that Lasiodiplodia sp., strain AB1 has the ability to infect blackberry var. “Tupi” plants, the crop it was isolated from (Figures1F and 1G). Additional studies are in process to determine the pathogenicity in older plants in greenhouses and its biocontrol with antagonistic bacteria.

Table 1 Maximum identity found for sequences 18S and ITS of strain AB1 in the GenBank. 

Especie/Cepa Máxima identidad por 18S RNAr Máxima identidad por ITS
(ID GenBank) (ID GenBank)
Lasiodiplodiasp. AB1 99.52% 99.81%
Lasiodiplodia theobromae Lasiodiplodia theobromae
(NG_062745.1) (MK530050.1)
99.52% 99.81%
Lasiodiplodia parva Lasiodiplodia parva
(GQ469913.1) (KX227559.1)

In conclusion, based on morphological observations, the molecular characterizations and the compliance with the Koch postulates, it was possible to identify, for the first time in Mexico - as far as we know - according to the revision of technical literature, that the isolation AB1 belongs to the genus Lasiodiplodia, and is the causal agent of the symptoms observed in blackberry plants in commercial farms located in the municipality of Los Reyes, Michoacán. This information will provide important information for the integrated management of this disease, in order to avoid possible epidemiological outbreaks in the crop, and economic losses.

Acknowledgements

We would like to thank the Coordination of Scientific Research of the Universidad Michoacana for the support provided to our research projects (2018-2019)

REFERENCES

Alves A, Crows PW, Correia A and Philips AJL. 2008. Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae. Fungal Diversity 28:1-13. http://www.fungaldiversity.org/fdp/sfdp/28-1.pdfLinks ]

de los Santos-Villalobos S, Parra-Cota FI, Herrera-Sepúlveda A, Valenzuela-Aragón B y Estrada-Mora JC. 2018. Colección de microorganismos edáficos y endófitos nativos para contribuir a la seguridad alimentaria nacional. Revista Mexicana de Ciencias Agrícolas, 9: 191-202. https://doi.org/10.29312/remexca.v9i1.858 [ Links ]

Fernández-Pavía SP, Rodríguez-Alvarado GR, Gómez-Dorantes N, Gregorio-Cipriano MR y Fernández-Pavía YL. 2012. Enfermedades en plantas en el estado de Michoacán. Biológicas, 14(2): 75-89. https://biologicas.umich.mx/index.php?journal=biologicas&page=article&op=view&path%5B%5D=140&path%5B%5D=139Links ]

Rodríguez-Gálvez E, Guerrero P, Barradas C, Crous PW and Alves A. 2017. Phylogeny and pathogenicity of Lasiodiplodia species associated with dieback of mango in Peru. Fungal Biology. 121:452-465. http://dx.doi.org/10.1016/j.funbio.2016.06.004 [ Links ]

Toju H, Tanabe AS, Yamamoto S and Sato H. 2012. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PloS one 7 (7): e40863. https://doi.org/10.1371/journal.pone.0040863 [ Links ]

SIAP-SAGARPA (2012-2018). Servicio de Información Agropecuaria y Pesquera- Secretaria de Agricultura, Ganadería y Pesca. (Consultado en 2019) https://nube.siap.gob.mx/gobmx_publicaciones_siap/pag/2018/Atlas-Agroalimentario-2018Links ]

Received: May 16, 2019; Accepted: July 01, 2019

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons