The municipality of Los Reyes, Michoacán, Mexico is the main producer of blackberries (Rubus subgénero Eubatus) in the country, providing over 80% of the national yearly production, which amounts to over 260 thousand tons (^{SIAP-SAGARPA, 2012-2018}). Blackberry production is affected by several species of fungi, causing losses in production, as well as economic losses of up to 25%, equal to 2,540 million pesos per year. Among the main diseases that impact blackberry crops are the gray mould (Botrytis cinerea), orange rust (Arthuriomyces peckianus), leaf spot (Cercospora sp.), anthracnosis (Colletotrichum gloeosporioides), mildew (Peronospora sparsa), and root rot (Fusarium sp.) (^{Fernández-Pavía et al., 2012}). However, soil and weather conditions that are changing as a consequence of the intensive agricultural practices and climate change, have exerted an influence on the appearance of diverse emerging phytopathogens with negative impacts on the production of agricultural crops of economic, social and cultural interest. Therefore, the correct identification and characterization of said emerging phytopathogens is important to propose efficient control strategies.

In 2017, blackberry farms located in the municipalities of Los Reyes and Peribán, Michoacán (19° 32’ 3.728’’ N and 102° 31’ 12.503’’ W) presented plants in a vegetative state, diseases with leaf, branch and stem necrosis (with a basipetal progression), followed by defoliation and the death of the plant (Figure 1A). These symptoms had not been described by causal pathogens normally reported for blackberry crops, therefore affected plant tissue was gathered, mainly necrotic stems from 5 plants. The samples gathered were kept in humid chambers at 4 °C and later transported to the lab for their immediate analysis in order to identify the biological agent that caused such symptoms. For the isolation of the pathogen, the samples were disinfected superficially, washing with 2% chlorine 3 times, and rinsing with sterile distilled water; later, the tissue was grinded in a sterilized mortar. Sections measuring 0.5 cm were planted in Petri dishes with Potato Dextrose Agar (PDA) to promote fungal growth. The inoculated Petri dishes were incubated at 30 °C in the dark for 48 hours. The fungal isolates observed were cultured under the same growing conditions in order to purify the isolations, which showed a rapid mycelial growth (1.5 cm in 6 h), white in color (24 h) (Figure 1B), and later turning black (³48 h) (Figure 1C). In addition, preparations were carried out, using bromophenol blue (observed under an optic microscope) to determine the reproductive structures reported for the genus Lasiodiplodia, such as abundant mycelial growth, composed of mature septated hyphae and conidia (Figure 1D and 1E), ovoidal to elliptical in shape, with a grainy content and an round apex (^{Alves et al., 2008}). A monosporic fungal isolation, AB1, was stored with the code ZPQ1 in the Collection of Native Edaphic and Endophytic Microorganisms-COLMENA (^{de los Santos-Villalobos et al., 2018}).

The molecular identification of AB1 began with the extraction of the deoxyribonucleic acid (DNA) from the mycelium of the fungus (1 mg), which was placed in 0.2 mL of TES buffer, mixing the suspension vigorously; next, 5 mg mL^-1 of K proteinase were added, along with ammonium acetate, and it was washed with ethanol at 70% and isopropanol in ice. Finally, the residual ethanol was evaporated from the pellet and the DNA was resuspended in deionized water. The quality and concentration of the extracted DNA were verified using an agarose-TAE gel at 1 % and a Thermo Scientific NanoDrop 2000c spectrophotometer. The fungal DNA extracted was used for the amplification of the ribosomal RNA 18S gene using the universal oligonucleotides NS1 (GTAGTCATATGCTTGTCTC) and NS8 (TCCGCAGGTTCACCTACGGA); as well as the intergenic region (ITS) with oligos ITS4 (TCCGTAGGTGAACCTGCGG) and ITS5 (TCCTCCGCTTATTGATATGC) (^{Toju et al., 2012}). The resulting amplicons were analyzed by electrophoresis in an agarose-TAE gel at 1% and later purified using the kit The Wizard^® SV Gel and Promega PCR Clean-Up System, to then sequenced by a commercial company (Macrogen, Korea). The DNA sequences obtained were analyzed using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to obtain the taxonomic identity/affiliation of the fungal isolate. The sequence of gene 18S RNAr of the isolation AB1 obtained was 1,050 base pairs (bp) (NCBI Access num.: MG757345.1). This sequence displayed a high coverage (100%) and similarity (99.52%) with Lasiodiplodia theobromae and Lasiodiplodia parva. The ITS sequence has a length of 539 bp (NCBI Access num: MK841036.1), displaying an identity of 99.81% with multiple Lasiodiplodia theobromae and Lasiodiplodia parva isolations (Table 1). Lasiodiplodia is a fungal genus that comprises at least 30 species (^{Rodríguez-Gálvez et al., 2017}), which have been related to several economically important diseases in agricultural crops, where the causal agent is found as a latent endophyte. Based on the molecular identification of the gene 18S RNAr and the ITS region ADNr, the AB1 isolation has been affiliated to the genus Lasiodiplodia sp., until further studies are carried out to classify this isolation at a species level.

Figure 1 Isolation and morphological and infection characterization of the phytopathogen Lasiodiplodia sp. AB1. A) Nec rotized blackberry tissue, material obtained from the isolation of Lasiodiplodia sp. AB1. B) Lasiodiplodia sp. AB1 mycelium at 5 days of growth. C) Lasiodiplodia sp., strain AB1 mycelium after 10 days of growth. D) Mature co nidia. E) Portion of the Lasiodiplodia sp., strain AB1 mycelium, stained with bromophenol blue. F) Blackberry var. ‘Tupi’ seedling planted in vitro. G) F) Blackberry var. ‘Tupi’ seedling infected with Lasiodiplodia sp., strain AB1; arrows indicate nectrotized areas. 

In addition, pathogenicity tests were carried out in the isolation AB1 to corroborate its role as a causal agent of the symptoms observed in blackberry plants. To confirm the Koch postulates, an in vitro infection test was carried out, in which blackberry seedlings of the “Tupi” variety were micropropagated, placing three plants per jar, which were then inoculated 1x10⁶ spores of the isolation AB1 (control plants were sprayed with sterile distilled water). The plants were incubated for 5 days in a Percival AR66L growth chamber at a constant temperature of 22 °C and a light period of 16 hours and 8 hours of darkness. After the time of inoculation of isolation AB1, all inoculated plants displayed similar symptoms to those observed in commercial farms, chlorosis, as well as areas with leaf and stem necrosis. Also, strain AB1 was re-isolated and characterized from the symptomatic plants. This shows that Lasiodiplodia sp., strain AB1 has the ability to infect blackberry var. “Tupi” plants, the crop it was isolated from (Figures1F and 1G). Additional studies are in process to determine the pathogenicity in older plants in greenhouses and its biocontrol with antagonistic bacteria.

In conclusion, based on morphological observations, the molecular characterizations and the compliance with the Koch postulates, it was possible to identify, for the first time in Mexico - as far as we know - according to the revision of technical literature, that the isolation AB1 belongs to the genus Lasiodiplodia, and is the causal agent of the symptoms observed in blackberry plants in commercial farms located in the municipality of Los Reyes, Michoacán. This information will provide important information for the integrated management of this disease, in order to avoid possible epidemiological outbreaks in the crop, and economic losses.