SciELO - Scientific Electronic Library Online

 
vol.36 número3Evaluación de nanoformulaciones en el desarrollo in vitro de hongos fitopatógenos índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Revista mexicana de fitopatología

versão On-line ISSN 2007-8080versão impressa ISSN 0185-3309

Rev. mex. fitopatol vol.36 no.3 Texcoco Out./Dez. 2018

http://dx.doi.org/10.18781/r.mex.fit.1803-1 

Reporte Fitopatológico

Confirmación de la identidad de Exserohilum turcicum, agente causal del tizón foliar del maíz en Sinaloa

Rubén Félix-Gastélum1  * 

Glenda Judith Lizárraga-Sánchez1 

Ignacio Eduardo Maldonado-Mendoza2 

Karla Yeriana Leyva-Madrigal2 

Gabriel Herrera-Rodríguez3 

Silvia Espinoza-Matías4 

1 Universidad de Occidente, Unidad Los Mochis, Departamento de Ciencias Biológicas, Bulevard Macario Gaxiola y Carretera Internacional s/n Los Mochis, Sinaloa, CP. 81223, México

2 Instituto Politécnico Nacional. Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional-IPN Unidad Sinaloa. Departamento de Biotecnología Agrícola. Bulevard Juan de Dios Bátiz Paredes No. 250. Guasave, Sinaloa, CP. 81101, México

3 Junta Local de Sanidad Vegetal del Valle del Fuerte. Lázaro Cárdenas, PTE. 315, Colonia Centro, Los Mochis Sinaloa, CP. 81200, México

4 Laboratorio de Microscopía Electrónica de Barrido, Facultad de Ciencias, Universidad Nacional Autónoma de México. Delegación Coyoacán. CDMX, CP. 04510.

Resumen:

Las enfermedades de origen fungoso constituyen una limitante en la producción de maíz en Sinaloa, México. En ciclos agrícolas recientes, una enfermedad foliar ha ocurrido en niveles epidémicos en la región costera del Norte de Sinaloa. Los síntomas de la enfermedad se asemejan a los causados por Exserohilum turcicum previamente reportados en los valles altos en estados de la Mesa Central de México y otras partes del mundo con clima subtropical o templado. El objetivo de ésta investigación fue confirmar la identidad de E. turcicum asociado al tizón foliar del maíz y evaluar la severidad de la enfermedad en 17 híbridos de maíz en lotes comerciales. Variación en color y morfología de los aislados se observó en diferentes medios. El medio extracto de maíz-agar fue el más favorable para el desarrollo micelial de los aislados. En pruebas de patogenicidad, los aislados exhibieron variación en patogenicidad en el híbrido comercial de maíz DK-3000. Los postulados de Koch se cumplieron mediante el re-aislamiento del patógeno de las plantas inoculadas. Aun cuando el teleomorfo (Setosphaeria turcica) no se observó, estudios morfométricos y moleculares confirmaron la identidad de E. turcicum como agente causal del tizón del maíz. Los híbridos de maíz mostraron una severidad diferencial de la enfermedad, lo cual estuvo relacionado con periodos prolongados de alta humedad relativa. Estudios futuros deberían enfocarse a la determinación de las formae specialis importantes para la implementación de un programa de mejoramiento genético para el control de la enfermedad.

Palabras clave: hongo; patogenicidad; severidad; anamorfo; identificación; morfología

En ciclos agrícolas recientes, una severa enfermedad foliar atacó a varios híbridos de maíz en niveles epifíticos en las regiones costeras del norte de Sinaloa en los meses entre noviembre y enero, que incluyeron periodos diarios con humedad relativa ≥ 90% por 13-17 h, y una temperatura diaria promedio de entre 18 y 26 °C. Los síntomas de la enfermedad se desarrollaron inicialmente en las hojas inferiores, causando lesiones ovaladas, largas, elípticas, verde grisáceo o marrones de diferentes tamaños. Más tarde, los síntomas alcanzaron a las hojas medias y superiores de las plantas. Si bien todavía están por determinarse las pérdidas de rendimiento, observaciones personales del autor indican que la enfermedad ha destruido hasta 65% del follaje de algunos híbridos comerciales de maíz sembrados en la región costera del norte del estado. Aunque el tizón foliar del maíz causado por Exserohilum turcicum (Et) es una de las enfermedades foliares más importantes en el maíz sembrado en México, hoy en día no existe suficiente evidencia científica acerca de la etiología de la enfermedad, aunque los productores de maíz y asesores de campo demuestran interés en determinar su etiología. En consecuencia, el objetivo principal del presente estudio fue confirmar la identidad del agente causal del tizón foliar del maíz a nivel de especie, con base en datos morfométricos y moleculares del anamorfo.

Quince muestras sintomáticas fueron colectadas del mismo número de campos de maíz en los municipios de Ahome y El Fuerte, Sinaloa, entre el 16 de diciembre de 2013 y el 15 de enero de 2014. Una muestra de cada campo consistió en cinco hojas sintomáticas recolectadas de las esquinas y el centro de cada campo (n=25). Fragmentos de hojas sintomáticas (5-6 cm de longitud) fueron desinfestados en una solución de hipoclorito de sodio al 0.5% por 2 min, lavados por 3 min en agua destilada estéril y secados con papel de filtro Whatman Núm. 1. Los fragmentos fueron colocados en una cámara húmeda por 48 h a 25 °C. De los conidios formados en el tejido de las hojas se obtuvieron cultivos monospórico a través de su transferencia con una aguja de disección a placas de Petri con papa dextrosa y agar (PDA), bajo un microscopio de disección.

Se evaluó el crecimiento micelial de ocho aislados monoconidiales del hongo en los siguientes medios de cultivo: papa dextrosa agar (PDA), Czapek-Dox Agar (CDA), glucose peptona agar (GPA), agar sintético de Richard´s (ASR) y extracto de hoja de maíz agar (EHMA) (Dhingra y Sinclair, 1985). Después de ocho días de incubación, bajo un régimen de luz por14 h y 10 h de oscuridad a 25 °C, el color de la superficie de las colonias del hongo en los diferentes medios de cultivo variaron de oliváceo y verde olivo grisáceo.

Todos los aislados presentaron una pigmentación de color verde oliva claro en el reverso del cultivo en CDA y ASR, aunque no se observó pigmentación en otros medios. La tasa de crecimiento micelial radial de los aislados en EHMA fue de entre 3.7 y 4.9 mm/día y fue significativamente (P≤0.05) mayor al crecimiento en los otros medios. Hubo una interacción significativa (P<0.0001) entre los medios de cultivo y el crecimiento radial de los aislados, indicando que las tasas de crecimiento de los aislados dependieron del medio. En PDA, los aislados produjeron de 1 a 3 conidios en la punta del conidióforo (Figura 1). Los conidios eran curvos, ahusados y alargados, con un promedio de cinco septas y una longitud de 44 a 110 µm (promedio de 85.3 µm) de 10 a 21 µm de ancho (promedio de 14.8 µm). No se observaron diferencias en la morfología entre aislados de Et obtenidos de hojas sintomáticas del maíz, y las características fueron consistentes con reportes previos (Tang et al., 2015; Shi et al., 2017).

Figura 1 Análisis filogenético de aislados asociados al tizón foliar del maíz de Sinaloa. A) Árbol de verosimilitud (Log likelihood=-1276.64) basado en el traductor interno de espacios (ITS) de cuatro aislados de Exserohilum (Setosphaeria se refiere al telomorfo of Exserohilum). El árbol fue construido con Mega 6.06 (bootstrap = 1000), usando el modelo de sustitución Jukes-Cantor (JC) con sitios invariados (+I). Los aislados caracterizados en este estudio aparecen en negritas. La secuencia correspondiente de Pleospora tomatonis fue usada como un grupo externo Et =E. turcicum. Numero de accesión en la base de datos de las secuencias precede el nombre científico de los organismos. Los valores de bootstrap se muestran como porcentajes. La barra de escala indica le número esperado de sustituciones de aminoácidos. Morfología de E. turcicum del maíz (aislado Et-2). B) Lesiones de forma elíptica del tizón foliar del maíz en el híbrido DK-300 inoculado artificialmente con E. turcicum en invernadero. C) Mono conidióforo recto o curvo con uno a tres conidios. D) Conidio con forma de mazo, con célula basal protuberante en el punto de conexión. E) Micrografía con microscopio electrónico de barrido de un conidio liso con un hilum protuberante en un cultivo de 8 días en PDA. 

Para observar los conidios bajo el microscopio electrónico, se cortaron fragmentos de 3.5 cm2 de una colonia de un aislado (Et3) en PDA de 8 días de edad y se sumergieron en una solución (FAA: 10% formaldehído, 5% ácido acético, 50% dilución de etanol 96%, y 35% agua). Después de 48 h, las muestras fueron lavadas con agua de la llave por 10 minutos y enseguida fueron deshidratadas incrementando las concentraciones de etanol. Las muestras fueron deshidratadas hasta un punto crítico con CO2 en una desecadora BAL-TEC CPD030. Las muestras fueron montadas en portaobjetos de aluminio sobre una tira de carbón conductivo y cubiertas con una fina capa de oro en un ionizador Denton Vacuum Desk II (Hofstra Group, Ltd. Co; Boston MA, USA). Finalmente, se tomaron fotografías de conidios bajo un microscopio electrónico JEOL JSM-53110 LV (Bozzola and Russell, 1999). Mediante estos procedimientos, las imágenes revelaron conidios lisos con un hilum prominente (Figure 1).

Para las pruebas de patogenicidad, se cultivaron ocho aislados monoconidiales del hongo en PDA a 24 °C en la oscuridad por 9 días. Se agregaron tres mL de agua destilada estéril a los cultivos y el micelio y los conidios fueron desprendidos del medio usando un asa bacteriológica; enseguida se distribuyeron 0.2 mL de las suspensiones conidiales sobre una placa de Petri con PDA de un diámetro de 90 mm e incubadas a la misma temperatura. Las placas inoculadas fueron selladas con película selladora (Parafilm®) y colocadas invertidas a 24 °C en la oscuridad por 9 días. Los conidios fueron raspados de la superficie del medio usando una espátula esterilizada y la suspensión de conidios fue filtrada a través de dos capas de malla quesera esterilizada para remover el micelio. Se probó la patogenicidad de ocho aislados fúngicos monoconidiales asociados con el tizón foliar del maíz en el híbrido comercial de maíz DK-3000, que presentó una alta incidencia de la enfermedad en el ciclo agrícola previo. Se ajustó cada suspensión de conidios a una concentración de 2 x 104 conidios/mL con agua destilada estéril y fueron asperjadas sobre cuatro plantas de maíz en estado de desarrollo VS5-6. Las plantas control fueron asperjadas con agua destilada estéril. Después de la inoculación, las plantas fueron colocadas en bolsas de plástico negras para asegurar una humedad relativa (HR) del 100% por 48 h e incubadas a una temperatura de entre 12 y 15 °C. Las plantas inoculadas y las testigo se distribuyeron en un arreglo completamente al azar con cuatro repeticiones (4 macetas 25 x 20 cm, cada una con una planta). Después, las plantas se sometieron a una HR de 100% por cinco días consecutivos por 12 h al día. La patogenicidad de los aislados fue determinada 14 días después de la inoculación, considerando el porcentaje de área foliar afectada (AFA). El experimento se realizó dos veces en un invernadero. La temperatura del invernadero fluctuó entre 8 y 26 °C, y 12 y 30 °C en el primer y segundo experimento, respectivamente. Para estandarizar los datos, los porcentajes de AFA fueron transformados usando la función de arcoseno. Los datos transformados fueron analizados usando ANOVA y la separación de medias se realizó mediante el procedimiento de Tukey (Little y Hills, 1973). Para cumplir el postulado de Koch, al concluir los de los periodos experimentales, el hongo fue aislado de las plantas inoculadas y su identidad fue confirmada por medio de la identificación morfológica de veinte conidios por aislado. Los ocho aislados de Et probados fueron patogénicos en el híbrido de maíz DK-3000. Se detectó variación en virulencia entre los aislados. Diez días después de la inoculación, las hojas de maíz presentaban lesiones típicas y síntomas de tizón foliar similares a los observados en campo (Figura 1). El AFA en las plantas inoculadas varió entre 9.5 y 54.1% y entre 9.0 y 26.9%, con diferencias significativas (P=0.05) entre aislados en el primer y segundo experimento, respectivamente. Las plantas control asperjadas con agua destilada estéril permanecieron asintomáticas a lo largo del estudio.

Para la caracterización molecular, la región ITS rDNA fue amplificada usando los primers universales ITS1 (5’ TCCGTAGGTGAACCTGCGG 3’) e ITS4 (5’ TCCTCCGCTTATTGATATGC 3’). La PCR se realizó en un volumen de 25 μL con un template de ADN de 1 ng, 1.5 mM MgCl2, 0.5 mM de cada dNTP, 0.4 μM de, cebadores sentido y antisentido y 1 U de Taq DNA polimerasa (Invitrogen, Brazil, Cat. No. 11615-050). El termociclador se programó para la desnaturalización inicial a 95 °C por 4 min, seguido de 35 ciclos de desnaturalización a 94 °C, anillado a 54 °C, extensión a 72 °C, cada uno por 1 min y una extensión final a 72 °C por 5 min. Los productos de PCR fueron separados por electroforesis en gel de agarosa (1% w/v en 0.5 X TAE) y visualizados por tinción de bromuro de etidio. Los productos de PCR fueron purificados con el equipo de purificación de PCR QIAquick (Qiagen, Cat. No. 28106) y cuantificados usando un Nanodrop 2000. Los productos de PCR fueron secuenciados en ambas direcciones con un secuenciador ABI 3730XL (Applied Biosystems, USA). Las secuencias fueron editadas en CHROMAS Pro 1.6 (Technelysium Pty Ltd, South Brisbane, Queensland, Australia) y comparados con las secuencias en el NCBI (Centro Nacional para la Investigación Biotecnológica) usando el software BLAST-N y el algoritmo Megablast. Todas las secuencias fueron depositadas en el GenBank bajo los números de accesión KT253948-KT253952. Para la alineación y el análisis filogenético se usó el MEGA 6.06. Las secuencias fueron alineadas con las secuencias de referencia de especies Exherohilum/Setosphaeria (Tang et al., 2015), usando el programa de alineación MUSCLE. Múltiples alineaciones fueron sujetas a un análisis de modelo de sustitución de ADN en MEGA para seleccionar el modelo que mejor se ajustara a los datos. Se creó un árbol filogenético usando el modelo Jukes-Cantor (JC) y el modelo de verosimilitud (ML). La variación de la tasa entre sitios fue modelado por una proporción de sitios invariantes (I). El apoyo de la topología del árbol fue evaluado por 1000 réplicas bootstrap.

Secuencias de S. turcica (teleomorfo de Et) y de diferentes especies de Setosphaeria/Exserohilum (E. oryzicola, S. monoceras, S. pedicellata) fueron usadas para llevar a cabo el análisis filogenético. Las secuencias de S. turcica incluyeron aislados obtenidos del maíz (HF934950, KF278460; secuencia del cultivo de referencia, ATCC64835), algunos de éstos fueron identificados como formae specialis zeae (todos los números KJ Genbank excepto por KJ922752) y de sorgo identificadas como formae specialis sorghi (KJ922752) (Tang et al., 2015). El árbol filogenético de verosimilitud generado con las secuencias ITS rDNA demostraron que los aislados de Sinaloa guardan estrecha relación con secuencias de S. turcica obtenidas de maíz y sorgo (Tang et al., 2015). Estas secuencias están claramente separadas de otras especies Exherohilum/Setosphaeria (Figura 1). Los aislados Et-6 y Et-7 fueron diferentes del resto de las secuencias Et incluidas, aunque igualmente agrupadas dentro de S. turcica.

Las características de las colonias y la morfometría de los conidios, y la secuenciación de la región ITS rDNA del anomorfo indicaron que E. turcicum [(Pass.) (Leonard y Suggs)] (syn. Helminthosporium turcicum Pass.) es el agente causal del tizón foliar del maíz en Sinaloa, tal como se ha reportado en otras áreas productoras de maíz del mundo (Shi et al., 2017). El análisis llevado a cabo no permite discriminar al nivel del formae specialis. Estudios recientes han demostrado la utilidad de la reacción en cadena de polimerasa cebada universalmente (UP-PCR) para caracterizar la diversidad genética y las relaciones filogenéticas entre los formae specialis de Et (Tang et al., 2015). En el futuro, este enfoque será útil en el proceso de discriminación de la existencia de formae specialis en Sinaloa.

La severidad del tizón foliar de maíz fue evaluado en 115 parcelas comerciales que variaban desde el estado de espigamiento hasta grano masoso en los municipios de Ahome y El Fuerte, Sinaloa en la temporada de cultivo 2013-2014. Las parcelas inspeccionadas iban desde las 10 hasta las 50 ha. Cada parcela fue muestreada en las 4 esquinas y en el centro para la severidad de la enfermedad; diez plantas fueron extraídas de cada punto de muestreo y una hoja fue tomada al azar de las plantas, para un total de 150 hojas por cada parcela. El porcentaje promedio de área foliar afectada (AFA) fue determinado usando una escala del 0 al 4, donde 0= ninguna lesión detectable, 1= algunas lesiones en las hojas (≤ 5%), 2= varias lesiones pequeñas y grandes en muchas hojas (5.1-10%), 3= lesiones en muchas hojas (10.1-15%), 4= muchas lesiones grandes (15.1-20%). Diez hojas sintomáticas de cada parcela fueron colocadas en una hielera (8-10 °C) y llevadas al laboratorio para determinar si E. turcicum estaba asociada a la enfermedad. La presencia del hongo en tejido sintomático fue confirmada por la observación de conidios bajo el microscopio estereoscópico y compuesto.

La severidad de la enfermedad, reflejada como porcentaje de AFA, varió con los híbridos y las ubicaciones. El híbrido P3254W presentó la severidad más alta, particularmente en los sectores de Despensa-Bolsa de Tosalibampo No. 2, Olas Altas-Bachomobampo, San Isidro-Grullas Derecha, Ahome-Grullas Izquierda y Concheros-9 de Diciembre, con porcentajes de AFA de 17.3, 13.3, 9.0, 7.6 y 3.5%, respectivamente. El mismo híbrido presentó una severidad reducida de la enfermedad en los sectores Águila Azteca-El Guayabo, El Fuerte, 5 de Mayo-Sufragio, Santa Rosa-Los Tercos con un AFA de 3.2, 0.8, 0.4, 0.0 %, respectivamente. Los híbridos XR56 y Máximo presentaron un AFA de 11.0% en el sector Olas Altas-Bachomobampo, donde el híbrido P3254W presentó la mayor severidad. Los híbridos DK 2030, Sultán, Gorila, DK.2038, N1R01, P3254W, XR47, Garañón, MN1078, Caribú, DK3000, Máximo, DK 2036, Máximo y DS2301 presentaron un porcentaje promedio de AFA de entre 0.0 y 4.6 %. Los episodios diarios acumulados, en horas, con la humedad relativa (HR) ≥90% en el sector Despensa-Bolsa de Tosalibampo No2 del 16 de diciembre de 2013 al 1 de enero de 2014, donde el híbrido P3254W mostró la mayor severidad de tizón foliar, alcanzó las 317 hr mientras que en el sector 5, de Mayo-Sufragio, dichos periodos de fueron de 184 hr y el mismo híbrido presentó un AFA de 0.4%. En general, se observó una reducción gradual de tizón foliar del maíz, independientemente del híbrido a medida que aumentaba la distancia a partir de la costa y la elevación de 4 a 100 km y de 0 a 80 msnm, respectivamente.

CONCLUSIONES

La identidad de E. turcicum, consistentemente asociado al tizón foliar del maíz en Sinaloa, fue confirmado mediante medidas morfométricas de los conidios, morfología de las colonias, técnicas moleculares y pruebas de patogenicidad. El presente estudio establece el punto de partida para investigaciones futuras orientadas a la variación patogénica de Et, que es fundamental en programas de mejoramiento para obtener híbridos de maíz resistentes para el manejo de la enfermedad.

La alta dependencia del patógeno de la humedad relativa alta fue evidente, ya que la severidad de la enfermedad en el híbrido más susceptible fue conspicuo en sectores con periodos prolongados de humedad relativa ≥90%, aunque se redujo paralelamente con la reducción de periodos con humedad relativa a dichos niveles.

LITERATURA CITADA

Bozzola JJ and Russell LD. 1999. Electron Microscopy. Principles and Techniques for Biologists. Jones and Bartlett Publishers. London, UK. 670 p. [ Links ]

Dhingra OD and Sinclair JB. 1985. Basic plant pathology methods. CRC Press, Inc. Boca Raton, Florida, USA. 355p. [ Links ]

Little TM and Hills FJ. 1973. Agricultural Experimentation and Analysis. John Wiley and Sons, New York, USA. 350p. [ Links ]

Shi NN, Du YX, Ruann HC, Yang XJ, Dai YL, Gan L, Chen FR and Liu XZ. 2017. First report of northern corn leaf blight caused by Setosphaeria turcica on Corn (Zea mays) in Fujian Province, China. Plant Disease 101:831. https://doi.org/10.1094/PDIS-07-16-0942-PDN [ Links ]

Tang L, Gao ZG, Yao Y and Liu X. 2015. Identification and genetic diversity of formae speciales of Setosphaeria turcica in China. Plant Disease 99:482-487. https://doi.org/10.1094/PDIS-06-14-0570-RE [ Links ]

Recebido: 09 de Março de 2018; Aceito: 03 de Julho de 2018

*Autor para correspondencia: ruben.felix@udo.mx.

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons