Isolations

In August 2012, isolations were obtained from pathogenic fungi from GrandPrix commercial variety gladiolus corms, with a circumference of 10/12 cm (Grupo Nedermex, S.A. de C.V. del Estado de México) that presented severe damage caused by Penicillium. In a laminar flow cabinet, the characteristic dust of this type of rotting was placed in Petri dishes with potato dextrose agar (PDA) medium and incubated for 10 d at 27 °C in complete darkness. The diverse cultures were isolated and purified until monosporic cultures were obtained in water-agar medium using the decimal serial dilution method (^{Villanueva Arce et al., 2005}), and incubated under environment conditions for 36 h. Some germinated spores were transferred to Petri dished with PDA. The fungal strains were conserved using the silica-gel technique (^{Chan and Elander, 1986}).

Pathogenicity tests

Four healthy corms were used for every isolation, which presented no visible damages, of the variety GrandPrix 10/12, and four more without inoculating as a control treatment. The tunics were removed from the corms, which were washed with a soapy solution, and rinsed with tap water. In a laminar flow bell, the corms were disinfected with a sodium hypochlorite solution at 1.5% for 2 min, rinsed three times and placed on sterile drying paper contained in new and disinfected polystyrene trays. Once the surface water was discarded, each tray was placed in airtight bags with jagged zippers. The corms were inoculated with 10 d old Penicillium cultures and incubated for 8 d at 8 °C plus 22 d at room temperature. The inoculation methods used were two: by the infiltration of a suspension of spores following the method proposed by ^{González-Pérez (2011)}, which consists in adjusting the suspension to a concentration of 1x10⁵ spores mL^-1 plus a Tween 20 aliquot, adjusting to a concentration of 0.1%. Later, 2 mL were infiltrated, one in the apical bud and another in the basal disc; by inoculation with mycelia, the latter was placed in an incision made with a hole puncher, 3 mm in diameter near the apical bud. The evaluation was based on a visual appreciation using a seven-point scale (Table 1). This evaluation was complemented by performing a vertical cut in the center of each corm. The total exposed surface of each half was measured in mm² along with the damaged surface with the aid of images and the program ImageJ (^{Rasband, 2006}). Values were reported as a percentage of tissue affected in respect to the total area.

Table 1 Visual scale for the damage of Penicillium on gladiolus corms. 

Cultural and morphological characterization

In malt extract agar (MEA) and czapek agar (Cz’) we observed color, texture, exudates, and maximum culture growth from a saturated spore solution from the monosporic cultures as recommended by ^{Frisvad and Samson (2004)}. For morphometric measurements, growth microchambers were set up (^{Moreno et al., 2005}), and from there, assemblies were prepared to observe the mycelium, conidophora, and conidia in retail under the compound microscope (Olympus CX31, lens 40X). The preparations were made with lactophenol, measuring an average of 50 fruit bodies and 100 spores per isolation. We considered the length and width of the stipe, metula, and phialide, as well as the diameter of the conidium; we also determined the shape, texture and ramification pattern of the conidiophore. To evaluate the growth rate (TC), as a physiological and differential characteristic between species, 5 mm discs from monosporic Penicillium cultures were used to place them in Petri dishes, 50 mm in diameter, with PDA, and incubated at room temperature until the mycelium reached its maximum growth area. Mycelial growth considered the evaluation of the maximum daily area using images and the program ImageJ (^{Rasband, 2006}); finally, the following equation was used to determine the TC:

The cultural and morphological characterization of each isolation was compared with the referent species obtained from molecular characterization using the taxonomic codes described by ^{Frisvad and Samson (2004)} and ^{Pitt and Hocking (2009)}.

DNA Quantification

The DNA concentration was determined in the Nano Drop® (ND-1000), to later adjust to 50 ng mL^-1, as established by the method for quantification and sequencing.

Amplification by PCR

The primers used to amplify the ITS region of the ribosomal DNA were ITS1, with the sequence 5’TCCGTAGGTGAACCTGCGG3’, and ITS4 5’TCCTCCGCTTATTGATATGC3’ (^{White et al., 1990}). The Polymerase Chain Reaction (PCR) was carried out with a final volume of the mixture of 50 µL and run in a thermocycler (Bio Rad DNA engine®). The reaction mixture was composed of: 5.0 µL of buffer solution for the PCR, 3.0 µL of MgCl₂ (50 mM), 2.0 mL of the mixture of dNTPs (10 mM), 1 mL of each one of the ITS’s (50 pmol µL^-1) and 0.5 µL of Taq-DNA polymerase (Invitrogen® 94 kDa). The program for the PCR consisted of 30 cycles: initial denaturalization 95 °C for 5 min; denaturalization 95 °C for 1 min; alignment at 57 °C for 40 s; extension 72 °C for 1 min. The amplified fragments were verified by gel electrophoresis in agarose gel at 1% stained with 1 µL of GelRed 10, 000x (0.1 µg mL^-1) and compared with the molecular weights with the marker TriDye 1kb DNA. The products of the amplified PCR were purified with the kit GeneJet ™ (Fermentas, USA).

Sequencing

The DNA was quantified and sequenced in both ways to avoid assembly and comparison errors in the Institute of Biotechnology of the National Autonomous University of Mexico (Instituto de Biotecnología de la Universidad Nacional Autónoma de México), Cuernavaca, Morelos. The sequences were aligned and compared with the National Center for Biotechnology Information (Centro Nacional para la Información de Biotecnológica) using BLAST.

Isolations

Out of the isolations obtained from the corms with symptoms of rotting in storage, four cultures, representative of Penicillium, were selected according to their cultural behavior in PDA; the cultures were labeled as 1P, 2P, 3P, and 4P.

Pathogenicity tests

The evaluation of the percentage of the surface infected and of the visual damage indicated that the four Penicillium isolations, inoculated in gladiolus corms of the variety GrandPrix 10/12, were pathogenic with different degrees of virulence, and isolations 1P and 4P were the most aggressive (Table 2). Differences were noticed between inoculation of spores and of mycelia. Visual damage was greater in the inoculation with mycelia. The evaluation of external damage reported the necrosis of anchor roots, spots and brown-colored collapses, with the presence of mycelia, although the presence of mycelia was greater in roots. In general, internal damage presented tissue discoloring. In both cases, the fungus was reisolated and its characteristics and cultural behavior were verified to comply with the postulated by Koch. Despite the aggressiveness of Penicillium as a phytopathogen being considered low, the pathogenicity tests carried out in this study show that the infection level increases depending on the places with lesions and the natural rupture of the corm. ^{González-Pérez et al. (2009)} reported an isolation of Penicillium affecting the production area of Puebla with a aggressiveness that mainfests itself in only 2.7% of the exposed area of the corms. The behavior of the isolations found in this investigation resemble descriptions by ^{Overy et al. (2005)}, who point out that in their pathogenicity test, corms presented spots, external discoloring, root necrosis, and in their case, internal damage.

Table 2 Pathogenicity of four Penicillium sp. isolations in gladiolus corms, var. GrandPrix® 10/12. 

Values with the same letter represent statistically equal values. One-way test of analysis of variance with one F = 4.206, F = 8.55, gl (4, 35) y P ≤ 0.007 determined with a Tukey comparison of averages (P≥0.05). The value shown for visual damage corresponds to the average.

Cultural and morphological characterization of isolations

The cultural behavior and the morphological characteristics of the Penicillium isolations are summarized in Tables 3 and 4. We can observe that the characteristics described coincide with most of the points referred to by the bibliography for the species reported in the molecular identification (^{Crous et al. 2004}; ^{Pitt and Hocking, 2009}; ^{Frisvad and Samson, 2004}). The morphological characteristics of the conidiophore and the behavior of the cultures in specific media have been acknowledged as the main taxonomic characteristics (^{Comerio, 2000}). Figures 1, 2, 3, and 4 show the cultural behavior in media Cz’, MEA, and PDA. Isolations 1P, 2P, and 4P belong to the same species P. verrucosum, although the cultural characteristics differe between isolation 1P and isolations 2P y 4P, probably considering the presence of two varieties, since they presented lower growth rates (.12 to .55 cm² d^-1 ) and this physiological characteristic helps separate individuals of the same species. On the other hand, the ITS region and the subunit 5.8s of the rDNA used in this type of analyses are very preserved instraspecifically, and they are therefore not the most adequate to carry out studies of subspecific groups. Regarding isolation 3P, it belongs to the species P. rugulosum. The difference lies in the maximum growth of the culture. The bibliography reports behavior characteristics for the reference species in a czapek yeast agar (CYA) medium and the medium used for this characterization was czapek agar medium (Cz’). However, the behavior displayed in malt extract agar (MEA), reported in the bibliography, also differs. Therefore, the use of culture media is not considered a part of the explanation in the discrepancy in the size of the cultures. This discrepancy may also be justified by the difference in growth rates.

Table 3 Comparison of the cultural and micromorphologic behavior of Penicillium isolations in gladiolus var. GrandPrix® corms in their time of storage with the species P. verrucosum (KC009832). 

Characteristics in Czapek (Cz) agar medium and malt extract agar (MEA) at 25 °C 7 days in darkness. Presence of exudates at 25 °C 14 days in darknes in Cz medium and MEA; Np: not present; Nr: not reported. Mounted on potato dextrose agar (PDA), observations at 3 - 5 days under Olympus CX31 compound microscope, lens 40X. x ^{Crous et al.2004}; ^{Pitt and Hocking, 2009}; ^{Frisvad and Samson, 2004}.

Table 4 Comparison of the cultural and micromorphologic behavior of Penicillium isolations in gladiolus var. GrandPrix® corms in their time of storage with the species P. rugulosum (GU566230.1). 

Figure 1 Cultures of isolate 1P identified as 7-day old P. verrucosum, at 25 °C in (A) PDA, (B) Cz and (C) MEA. (D) Conidiophora and conidia. 

Figure 2 Cultures of isolate 2P identified as 7-day old P. verrucosum, at 25 °C in (A) PDA, (B) Cz and (C) MEA. (D) Conidiophora and conidia. 

Figure 3 Cultures of isolate 4P identified as 7-day old P. verrucosum, at 25 °C in (A) PDA, (B) Cz and (C) MEA. (D) Conidiophora and conidia. 

Figure 4 Cultures of isolation 3P identified as 7-day old P. rugulosum, at 25 °C in (A) PDA, (B) Cz’ and (C) MEA. (D) Conidiophora and conidia. 

Molecular characterization of isolations

Table 5 shows the results of the amplification and sequencing in both directions of the rDNA of the four Penicillium isolations. This teste reported that the causal agents of the rotting of gladiolus agents in storage are P. verrucosum and P. rugulosum. Traditionally, this pathology is related to P. gladioli (^{McCulloch and Thom, 1928}). However, ^{Frisvad and Samson (2004)} mention that this species could be extinct due to the chemical management given to plants. On the other hand, there are reports of other species of Penicillium related to the rottinf of gladiolus corms: P. funiculosum (^{Singh, 1970}), P. hirsutum, P. venetum and P. tulipae (^{Overy et al., 2005}), Penicillium sp. (^{González-Pérez et al., 2009}) and P. brevicompactum (^{González-Pérez, 2011}). ^{Crous et al. (2004)} mention in the mycobank database, that the species P. verrucosum, reported in the molecular analysis, is related to P. hirsutum and P. verrucosum var. corymbiferum, and therefore associated as being one of the main agents of the rotting of flower bulbs (^{Chauhan and Saaltink, 1969}; ^{Smid et al., 1995}; ^{Overy et al., 2005}). On the other hand, P. rugulosum is known as a widely distributed species; isolated from diseased or healthy tissues of diverse products. ^{Prince et al. (1988)}, isolated this species from tulip bulbs; however, to date there are no reports found of its presence in gladiolus corms.

Table 5 Molecular identification of Penicillium isolations in gladiolus var. GrandPrix® corms 10/12. 

x NCBI: National Center for Biotechnology Information / NCBI: National Center for Biotechnology Information.