Sample collection

The collection of fruits with symptoms of soft rot (Figure 1A) was carried out based on its incidence on cv. Maradol papaya orchards during different sample collections in 2014: two in Tecomán, Colima in May and August in the orchard El Trébol (18° 53’ 04.9” N, 103° 56’ 33.7” O), one in October in Oaxaca in the town of San José Río Verde Jamiltepec (16° 08’ 12’’ N, 97° 45’ 11’’ O), and two more carried out in October in Veracruz, in the El Diamante orchard in Cotaxtla (18°52’25’’ N, 96° 12’ 2’’ O) and in Tlalixcoyan (21° 50’ 3’’ N, 96° 10’ 35’’ O).

Figure 1 Pathogenicity of mucoralean strains in Maradol papaya fruits. (A) Fruit with signs and symptoms in field, (B and G) Control fruit sprayed with distilled water without symptoms, (C) Fruit with dark-brown colored morphotype 1 Gilbertella persicaria sporangia, (D) Fruit with gray to black-colored morphotype 2 Gilbertella persicaria sporangia, (E) Fruit with light brown-colored Mucor irregularis sporangia, (F) Fruit with gray to brown colored Rhizopus oryzae sporangia, and (H) Cross section of a fruit with visible internal soft rot and detachment of tissues due to enzymatic action. 

Isolation, purification, and conservation of mucoralean fungi

For each fruit with symptoms, the area with lesions was divided into quadrants and a section was taken from the edge, (approximately 0.5 cm of tissue from each section) and were washed with ethyl alcohol at 70% for 1 min, followed by a later wash with distilled water. They were then placed in plates with PDA (Potato Dextrose Agar, Bioxon) and incubated at 27 °C. They were purified by transferring hyphal tips onto new PDA plates and monosporic cultures were then obtained (^{Chukwuka et al., 2010}; ^{Suárez-Quiroz et al., 2013}). The isolates were preserved in glass tubes with sterile distilled water, and for this 20 discs of 6 mm diameter of mycelium in active growth were placed in a PDA medium from 5-day old cultures. The lid was sealed with parafilm, and they were placed at 4 °C (^{Ryan et al., 2012}).

Pathogenicity test

Koch's postulates for selected isolates were carried out on healthy cv. Maradol papaya fruits in a comercially ripe state; initially, the fruits were disinfested with ethyl alcohol at 70% and then washed with distilled water. Each isolate was inoculated in 3 fruits, selecting three inoculation sites for each one, where incisions were made using a sterile needle and they were inoculated by spraying a sporangiospore solution at a concentration of 5 x 10⁵ sporangiospores/mL. In addition, 3 healthy fruits were included, all free of lesions and sprayed with the same sporangiospore solution and 3 control fruits, on which lesions were made and which were sprayed with sterile distilled water only. All fruits were placed in polyethylene bags (three fruits per bag), with paper towels dampened with sterile distilled water to produce a relative humidity of about 80%, and they were incubated at 25 °C for 5 days. Finally, the fungus was reisolated from the lesions and the morpological characteristics were confirmed with the fungus inoculated at the beginning of the experiment (^{Beales, 2012}).

Morphological Characterization

The macroscopic and microscopic cultural characteristics of the isolates grown in PDA were recorded. For this purpose, preparations were made and stained with lactophenol blue-cotton, and observed under an optic microscope (Carl Zeiss Imager A2, Germany). The appendages of sporangiospores and sporangial spines were observed using a differential interference contrast microscope (Leica DMI 6000 B, Alemania) connected to a camera (Leica DFC450C). The measurement of 100 morphological structures was recorded, and included the diameter and branching pattern of sporangiophores, columellae and chlamydospores, size and presence/absence of appendages, as well as the type of mycellium (^{Campbell et al., 2013}).

Mycelial development rate

In the center of petri dishes, 90 mm in diameter and containing PDA, a 6 mm disc was placed, taken from the edge of fungal cultures of the isolates grown for 3 days in PDA, and they were incubated at 4, 10, 15, 25, and 40°C. The diameter of the culture was recorded on a daily basis until it covered the entire plate. Later, a relation was made between the diameter and the number of days of the test (^{Michailides, 1991}).

Molecular Characterization

Extraction of DNA, amplification with PCR and sequencing. Each isolate’s mycelium was produced in a PDA medium for two days at 27 °C; later, it was collected with a sterilized slide and the genomic DNA was extracted according to the CTAB (cetyltrimethylammonium bromide) method, following the procedure described by ^{Voigt et al. (1999)} with slight modifications: briefly, 30 mg of mycelia were placed in 1.5 mL microcentrifuge tubes and 700 μL of CTAB buffer solution were added [100 mM Tris-Cl (pH 8.0), 1.4 M NaCl, 25 mM of EDTA, 2% CTAB], it was macerated and placed in a vortex for 10 s. Next, 700 μL of choloform-isoamylic alcohol was added (24:1) (Sigma-Aldrich) per tube; it was vortexed for 10 s and centrifuged at 12,300 x g for 10 min. A 500 μL portion of the top section was recovered and placed in a new tube; the same amount of isopropanol (Sigma-Aldrich) was added at -20 °C, and mixed softly. Later, it was centrifuged again at 12,300 x g for 2 min and the supernatant was discarded. The DNA pellet was washed with 500 μL of ethanol at 70%, centrifuged at 12,300 x g for 2 min. The ethanol was discarded and allowed to evaporate completely. Finally, the pellet was resuspended in 200 μL of Tris EDTA buffer solution [10 mM Tris-Cl (pH 8.0), 1 mM EDTA (pH 8.0)].

Amplification was carried out in accordance with Walther et al. (2013), where ribosomal DNA, including the complete region of ITS1-5.8S-ITS2 and the region D1/D2 of the subunit 28S (LSU) were amplified with the pair of oligonucleotides V9G (5’TTACGTCCCTGCCCTTTGTA3’) (^{de Hoog y van den Ende, 1998}), and LR3 (5’-GGTCCGTGTTTCAAGAC3’) (^{Vilgalys and Hester, 1990}). The mixture of the PCR reaction (25 μl), included 20 ng of ADN, 0.4 μM of each oligonucleotide, 0.185 mM of each deoxynucleotide triphosphate (dATP, dTTP, dGTP, dCTP), 5X reaction buffer, 1.5 mM of MgCl₂ and 0.8 U of the enzyme Taq ADN polymerase using the kit GoTaq® PCR Core Systems (Promega, USA). The amplification reaction was carried out in a BioRad T100™ (Singapore) thermocycler, with the following cycles: an initial step of denaturalization for 5 min at 94 °C, followed by 35 one minute cycles at 94°C, 1 min at 53 °C, and 2 min at 72°C, with a final extension of 7 min at 72 °C. To observe the bands of the amplified DNA products, the products were run in agarose gel at 0.8%, stained with ethidium bromide. The estimation of the molecular weights of the amplified products was carried out by comparison with a 1 Kb molecular marker (Promega, USA). Afterwards, the amplified products were viewed using a Molecular Imager® Gel Doc™ XR+ photodocumenter (BioRad, USA). PCR products were purified using the Wizard® SV Gel kit and the PCR Clean-Up System (Promega, USA) following the manufaturer’s instructions. Sequencing was carried out in the National Genomics Laboratory for Biodiversity, CINVESTAV Irapuato, using oligonucleotides ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’TCCTCCGCTTATTGATATGC-3’) (^{White et al.,1990}) for the ITS region, and for region D1/D2 28S (LSU), oligonucleotides NL1 (5′-GCATATCAATAAGCGGAGGAAAAG3’) (^{O’Donnell, 1993}) and LR3 (^{Vilgalys and Hester, 1990}); the sequencing process was carried out for both directions of the amplicon.

Phylogenetic analysis of the sequences

The sequences were edited using the program Bioedit Sequence Alignment Editor, version 7.2.5. (^{Hall, 1999}). The alignment was carried out using the program ClustalW, and the consensus sequences obtained were compared with the basic local alignment search tool BLASTN of the NCBI (National Center for Biotechnology Information). The perform the evolutionary analyses, the sequences obtained were saved in the FASTA format, and the alignment was carried out using the program ClustalW included in the software MEGA 6.0 (^{Tamura et al., 2013}). The evolutionary history was inferred using the Maximum Likelihood Method, based on the Tamura-Nei model (^{Tamura and Nei, 1993}). The graphic representation of the dendrogram based on region ITS and 28S (LSU) was carried out with the Neigborh-Joininig method, with a bootstrap analysis of 1000 repetitions to determine the trust values for the clades (^{Felsenstein, 1985}), using reference strains available from the GenBank of the NCBI.

Pathogenicity tests

All Maradol papaya fruits inoculated through lesions with the mucoralean species presented, 24 h after inoculation, symptoms that included humid-looking lesions of approximately 1 cm in diameter; white mycelia developed 48 h later, and after 72 h, sporangia were produced. Finally, 5 d after inoculation, the development of abundant light to dark brown mycelia and sporangia (Figures 1E and 1C), and gray to black (Figures 1D and 1F) was observed. By contrast, the fruits without lesions did not show symptoms of disease (Figures 1B and 1G). Internal damage in the infected fruit consisted of a soft rot that caused detachment of tissues (Figure 1H).

Morphological characteristics of Mucor irregularis

Cultures from isolation HP160, identified as M. irregularis, were circular, uniform, and with abundant, pale yellow aerial mycelia (Figure 2A), a color which was also observed on the reverse side of the plate (Figure 2B). The rate of mycelial growth was 1.48 cm/day at 25 °C; it did not develop at 4 °C, but it did between 10 and 40 °C (Table 2). The sporangiophores, mostly not branched, presented globular sporangia on their tips, of less than 80 μm, and which contained hundreds of elliptical sporangiospores inside them (Figure 2E and 2C). The columella with an almost spherical hyaline appearance presented a collarette, remanent of the sporangial wall (Figure 2D).

Figure 2 Morphological characteristics of Mucor irregularis. (A) Circular, pale yellow mycelial growth and abundant aerial mycelia, (B) Inverted plate showing a light-yellow color, (C) Globose sporangium with sporangiospores, (D) Release of sporangiospores and presence of columella with an almost spherical shape and a distinctive collarette, and (E) Non-branched hyalin sporangiophores. 

Morphological characteristics of Gilbertella persicaria

G. persicaria displayed two types of cultural morphology (Figures 3A and 3E). In the first one, the culture is petaloid with yellow to brown sporangia (Figure 3C), and with a mycelial growth of 1.48 cm/day at 25 °C (strains HP09 and HP114), whereas the second type presents circular cultures, with a more dense mycelia and gray to black sporangia (Figures 3G and 3H), with a mycelial growth rate of 2.46 cm/día (HP15, HP19, HP167, HP178, HP183 and HP211). None of the strains grew at 4 °C, although they did show development between 10 and 40 °C. Other characteristics in G. persicaria include the release of sporangiospores by the breaking of the sporangial wall in two halves (Figure 3I), the presence of small hyalin spines in the walls of the sporangia (Figure 3K), and the presence of hyaline appendages in the sporangiospores (Figure 3J). In the microscopic structures of both types of cultures, no relevant morphological differences were observed (Table 2). The sporangiophores are scarcely branched (four to six in every 100 analyzed); the ovoidal columella with a residual collarette, and cylindrical chlamydospores (Figure 3D), abundant in PDA in 5-day-old cultures.

Figure 3 Morphological characteristics of Gilbertella persicaria. (A) Culture in PDA with irregular mycelial growth in petaloid colonies, (B) Reverse side of the culture, (C) Yellowish-brown, multispored globose sporangium, (D) Cylindrical chlamydospore, (E) Culture in PDA with a circular myceliar growth, (F) Reverse side of the culture, (G) Black sporangia, (H) Dark mature multispored globose sporangium, (I) Opening of the sporangial wall in two halves, showing the ovoidal columella, (J) Sporangiospore with polar hyalin appendages, (K) Sporangial wall covered with small hyalin spines. Figures (J and K) bar=20 μm. 

Table 2 Morphological characteristics of mucoralean species isolated from papaya fruits with soft rot. The measurements shown were carried out from cultures in PDA and incubated at 27 °C. 

x Average values and ranges in parentheses (n=100).

Morphological characteristics of Rhizopus oryzae (syn. R. arrhizus)

Cultures of strain HP25 identified as Rhizopus oryzae showed an abundance of initially white aerial mycelia that later turned grayish (Figure 4A and 4B), dark brown to black sporangia that contained sporangiospores with a striated appearance (Figure 4C and 4E). Upon the release of sporangiospores, the light brown globular columella was observed (Figure 4D). The sporangiophores emerge from basal rhizoids (Figure 4F). R. oryzae presented a mycelial growth of 2.46 cm/day at 25 °C; it did not grow at 4°C, but it did between 15 and 40°C (Table 2).

Figure 4 Morphological characteristics of Rhizopus oryzae. (A) Culture in PDA with abundant cotton-like mycelia, (B) Culture with black sporangia, (C) Black multispored globoser sporangium, (D) Subglobose to globose columella, (E) Sporangiospores with a striated appearance, and (F) Basal rhyzoid. 

Molecular identification

The reaction of amplification with the oligonucleotides V9G and LR3 generated an approximate fragment of 1500 pb, which included the complete region of ITS1-5.8S-ITS2 and the region D1/D2 of the ribosomal subunit 28S (LSU). The consensus sequences obtained varied for the region ITS1-5.8S-ITS2 from 543 to 751 pb and for the partial region of ribosomal subunit 28S (LSU) from 632 to 711 pb.

The comparison in the data base showed, for the sequencing of the strain HP160 (Access N° KR076763 and KR076764), a percentage of identity of 99% and 96% for the region ITS with strains identified as Mucor sp. (Access N° HM770967 and KP714393, respectively), showing an identity of 91% with the strain of M. irregularis (Access N° JX976251) (Figure 5). However, for the partial ribosomal region 28S (LSU), it showed an identity of 99% with different strains of M. irregularis, which show an alignment of 100% (Figure 6).

Figure 5 Dendrogram based on the method of highest verosimilitude from sequences obtained for the region ITS1-5.8S-ITS2 of isolations of species of Mucorales and NCBI reference strains; the Access N° are in parentheses. The probability values of the nodes for each clade indicate the percentage of the replications of the analysis of 1000 bootstraps that support that clade. Rhizomucor pusillus was used as an outgroup. The scale represents the number of substitutions per site. 

Figure 6 Dendrogram based on the method of highest verosimilitude from the region 28S (LSU) for the strain HP160 and NCBI reference strains; the Access N° are in parentheses. The probability values of the nodes for each clade indicate the percentage of the replications of the analysis of 1000 bootstraps that support that clade. Rhizomucor pusillus was used as an outgroup. The scale represents the number of substitutions per site. 

The comparison of the sequences of the region ITS1-5.8S-ITS2 of the strains HP09, HP15, HP19, HP114, HP167, HP178, HP183, and HP211 showed an identity of 100% with sequences deposited in the NCBI (Access N° JN206224 y KC683539) of the species G. persicaria, where we can observe in the phylogenetic analysis the formation of two groups that correspond to the two morphotypes found (Figure 5). The confirmation of this species was carried out by analyzing the sequences of the partial ribosomal region 28S (LSU) (Table 1), which also showed an identity of 100% with the strains (Access N° JN206517 and JN939197) of G. persicaria. Finally, the comparison of the sequence of the strain HP25 of the region ITS1-5.8S-ITS2 and partial region 28S (LSU) (Access N° KT899481 and KT899482) showed an identity of 100% with sequences published in the NCBI (Access N° KJ417552 and AY213624), respectively, of the species R. oryzae (Figure 5). The coverage of the consultations of all the consensus sequences in the NCBI data base varied between 91 and 100%.