Sclerotia collection

Sclerotia collected in the municipalities of Almoloya de Juárez (19° 33’ 01” N - 99° 56’ 13” O), Calimaya (19° 10’ 25” N - 99° 37’ 02” O) and Villa Victoria (19° 26’ 00” N - 100° 00’ 00” O), State of Mexico, during November and December 2012, were used to induce germination of sclerotia in the lab. Sclerotia collected were stored at 4 °C for three months. They were classified by size, washed with detergent, disinfected with a 1.5 % sodium hypochlorite (NaClO) solution for 2 minutes, rinsed three times with distilled water, and dried on paper towels for 24 hours (^{CMI, 1974}).

Sclerotia germination in the lab

Polyethylene terephthalate glycol 500 mL bottles (PET, manufactured by Amacor Plastic Containers de México, S. A. de C. V) were disinfected with 96 % ethyl alcohol. 20, 35 and 70 g of the following substrates were added to the bottles: 1) soil from Almoloya, Calimaya or Villa Victoria, 2) commercial charcoal, 3) residual charcoal, 4) oat flakes, and 5) a witness without substrate. To all bottles, 75 ml of sterile distilled water was added. Three sclerotia were placed in each bottle. The bottles were stored in a cold room at 4 °C for 1, 2, 3, 4 and 6 months. Then they were incubated at room temperature (22-24 °C) for 2 months and all the variables were daily monitored.

The assessed variables were time to stipes emergency (germination), time for stipes to develop and time for heads to form. Ascospore discharge was monitored following three methods: 1. Direct observation every 2 h using a stereoscopic microscope (Olympus SL2 ILST); 2. Observation of ascospores captured on a slide (Corning 75x25 mm) and covered with lactophenol cotton blue stain placed in PET bottle caps every 8 h; and 3. Observation of spores captured in 6 ml of sterile distilled water in a Petri dish cap every 24 h (6 cm diameter); spores were placed at the bottom of inverted PET bottles and sclerotia were fixed to the base using paraplast.

The experimental design was a factorial trial 5x3 with substrates and incubation periods at 4 °C as factors. Three replications were used for each treatment. The experiment unit was a cylindrical bottle with substrate and three sclerotia. The whole experiment was repeated twice.

Sclerotia germination in the field

In June 2013, sclerotia that had been stored at 4 °C for three months were placed on cultivated soil at El Rosedal Ranch (Km 13.5 carretera Toluca-Atlacomulco, Atlacomulco Municipality, State of Mexico. (19° 24’ 19.28’’ N and 99° 43’ 12.84” W), three weeks after maize (Aspros HC8) was sown. Four 40x40x40 cm frames with wire mesh (1 cm²) were randomly distributed within the field. Each frame contained 30 sclerotia (^{Pedroza-Sandoval, 2010}). Variables of the sclerotia placed in the field were monitored on a weekly basis. Germinated sclerotia were transferred to a 2 L PET bottle containing 3 cm of soil at the bottom; variables were observed every day. Climate data were obtained from the Arroyo station, one of the INIFAP´s National Stations Network, located in the municipality of Almoloya de Juárez, Mexico (19° 24’ 34.92’’ N, 99° 44’ 12.12’’ O). The variables observed daily were time to stipes emergence, full development of stipes, heads and perithecia, and ascospores discharge, using the methods previously mentioned.

Histological cuts of stromatic heads

To observe the sexual structures (perithecia, asci and ascospores) formed on the heads obtained, histological sections were made manually using a razor blade. The cuts were placed on a slide with lactophenol cotton blue stain to be documented using a photomicroscope III Carl Zeiss adapted with a PAXcam3 digital camera. Additionally, the heads were fixed to FAA (formaldehyde : glacial acetic acid : alcohol, 1:1:1) during 24 h (^{Kulkarni, 1963}). The samples were rinsed with running water during 20 min to remove the fixative and dehydrated in ethanol concentrations (10 %, 20 %, 30 %, 50 %, 70 %, 80 %, 90 % and 100 %) for 3 h in each concentration. For dehydration and immersion in paraffin, the protocol described by ^{López et al. (2005)} was followed. Tissue cuts were made using a rotation microtome (American Optical Mod. 820) at 10 µm thickness. The sections were fixed to glass slides, the paraffin was removed and the sections were stained with fast-green safranin (^{López et al., 2005}). Sections were observed and measured using an optical microscope (VELAB model: VE-B6) equipped with a Moticam 2300 digital camera (3.0 M Pixel USB 2.0) and image processing software Motic MC Camera 1.1. The length and width of asci, ascospores and perithechia were evaluated in a sample of 30 individuals (^{Pedroza-Sandoval, 2010}), and both length and width were compared to the ones reported in literature (^{Fuentes et al., 1964}).

Growth in a culture medium

To evaluate the in vitro growth of the fungus, and stromatic heads while discharging ascospores were washed with powder detergent, rinsed with sterile water, disinfected with 1.5% sodium hypochlorite during 2 min, and rinsed with sterile distilled water. The heads were cut with a razor blade and the sections were placed in 5 mL of sterile distilled water. To observe the effect of the thermal treatment on ascospores germination, once their presence was confirmed, the sample was divided in two equal portions using a sterilized Pasteur pipette. Only one of the portions was thermally treated (50 °C during 3 min). 100 µL of ascospore suspension of each treatment were taken and poured on Petri dishes with the following culture media: 1) potato dextrose agar (PDA; Bioxon^®), 2) corn meal agar (AHM; Bioxon^®), 3) malt extract agar (EMA; Difco^®), 4) agar-agar (Difco^®), 5) agaragar with dextrose (Difco^®) and 6) agar (Difco^®) with a mixture of fresh maize grains and silks. The dishes were incubated at 22 °C and observed daily to determine the effect of the treatments on in vitro fungus germination and development. The experiment was performed under lab conditions based on a factorial design 6x2 (culture medium and thermal treatment) with three replications.

Morphological-molecular identification

Extraction of total fungal DNA was done using heads and stipes and a QIAGEN DNeasy Plant Minikit (50) extraction kit, according to the manufacturer’s protocol (Dneasy^® Plant Handbook, 2012). Sequenced DNA samples were KJ543564 (celes1), KJ543565 (celes2), KJ543566 (onesi1) and KJ543567 (onesi2). To ensure the quality of the DNA extracted, the samples were placed in 1 % agarose gel and electrophoresed at 88 volts for 30 min. All the DNA extracted was delivered to Macrogen Inc., Korea, for ITS region amplification and simultaneous sequencing with ITS1 primers (5´TCCGTAGGTGAACCTGCGG 3´) and ITS 4 (5´TCCTCCGCTTATTGATATGC 3´), according to the protocol described by ^{White et al. (1990)}, ^{Glass and Donaldson (1995)}, and ^{Pazoutová (2001)}. The amplified fragments were sequenced, and the sequences obtained were stored at NCBI (National Center for Biotechnology Information) to be subsequently compared with sequences available in the data bank with the “Nucleotide BLAST” tool. For the phylogenetic analysis, the sequences obtained in this study were compared with the sequences reported by Pazoutová for Claviceps gigantea and C. sorghi using the Mega 7 program and according to the UPGMA procedure.

Sclerotia germination in the lab

Sclerotia germination was observed only in the treatment containing residual charcoal during a three-month incubation period at 4 °C and a two-month period at 22-24 °C (Figure 3C); for this reason no statistical analysis were performed. The only sclerotia that germinated were the ones which had received the treatment containing residual charcoal during a three-month incubation period at 4 °C and a two-month period at 22-24 °C (Figure 2C); for this reason, no statistical analysis was performed. Under this treatment 55.5 % of sclerotia germinated. ^{Osada (1984)} obtained only 47 and 48 primordia of stipes from sclerotia placed at 18 °C that were pre-treated at 4 °C for 8 and 16 d, respectively. Regarding C. purpurea, ^{Hadley (1968)} reported 50 % germination mostly due to low soil moisture during sclerotia germination. A three-month cold treatment (4°C), residual charcoal moisture and temperature change to 22-24 °C during two months simulated natural field conditions where the sclerotia are found, to facilitate their germination.

Figure 3. Claviceps gigantea: A) Germination begins where primordia of stromatic heads are visible 64 days after field establishment; B) stipe and stromatic heads; C) fully developed stipes of sclerotia; D) sclerotia with thin and wilt stipes and heads after ascospores release (1 cm scale). 

For the laboratory experiment, the only substrate that facilitated sclerotia germination was residual charcoal. According to ^{Villamagua et al. (2008)}, in greenhouse tomato experiments (Solanum lycopersicum L.), vegetal charcoal added to the soil increased production of tomatoes due to increased soil porosity and structure, as well as N, P, K, Zn, Ca, Mg, Mn and Cu availability. These elements may act as nutrients during seed germination and plant nutrition, so they probably had the same effect on sclerotia used in this study.

Sclerotia germination in the field

From the sample placed in El Rosedal Ranch to determine sclerotia germination in the field, 46 % germination was reported. These germination averages are low but they are similar to those reported by ^{Pazoutová et al. (2011)}, who stated that germination for stromatic heads formation is difficult in most of the Claviceps species given that different treatments to stop dormancy are required (^{Kunfer and Seckring, 1977}). The study showed that, among treatments, low temperatures have important effects on the physiological processes of scleriotia because they increase 1) absorption of water from the environment; 2) respiration rate, and 3) metabolism of stored lipids. The presence of lipids in sclerotia suggests that just after, or during, the cold activation treatment, enzymes are activated that hydrolyze lipids probably to convert them into manitol (^{Mitchell and Cooke, 1968}).

In the field, emergence of primordia in sclerotia was observed after 3 months of incubation at 4 °C and 64 d after sclerotia were placed in the field at 14 °C average temperature, 76 % relative humidity and 705 mm accumulated precipitation during June-September 2013 (Figure 3A). Fully developed structures were observed 23 d after primordia emergence (Figure 3B). For the municipality of Almoloya de Juárez, ^{Mucikovsky and Moreno (1971)} reported 13-15 °C annual temperature and 1000 mm annual precipitation when they observed horse’s tooth in the State of Mexico, while in this study the annual average relative humidity was 65.26 % and total accumulated precipitation was 832.8 mm. According to ^{Cooke and Mitchell (1967)}, in nature it takes around one week from germination of C. purpurea sclerotia to stromal maturity.

In the field, when maize is harvested, between autumn and winter, sclerotia fall down. From autumn to spring, sclerotia are exposed to low temperature and frequent frosts for a 6-9 month period. At the end of this period, temperature and moisture increase, and the host is available; this means the life cycles of the pathogen and host are synchronized, allowing disease development.

Stipe emergence and development, and head formation

The first signs of sclerotia germination, both in the lab and the field, were emergence of stromatic heads five months after the experiment began (three months at 4 °C and two at 22-24 °C) (Figure 3A). Primordia emerges from sclerotia in the form of light colored globose protuberances. The germination period was at least 6 months faster than the period reported by ^{De la Isla and Fuentes (1963)} and ^{Fuentes et al. (1964)}, who observed C. gigantea sclerotia germination after 12 months under an alternate temperature treatment (4-2 °C and 22-28 °C from 1 to 2 periods of 8 months) and constant periods (12 °C during 4 months in darkness).

^{Cooke and Mitchell (1967)} mentioned that in nature the inoculum potential of sclerotia populations depends on the number of heads produced, which is related to the size of the sclerotium. In this study sclerotia produced from three to nine heads, with an average of five heads per sclerotium. Protuberances were constrained to the base to form the body of the stipe. Stromatic heads were formed on the tip of the stipe and matured after 15 days under lab conditions, and 23 days in the field, after primordia emergence (Figures 3B and C). As the stromatic head matured, its color changed from light to dark brown; it also showed points or papilla that were actually the ostioles of the perithecia immersed in the head, from which they protruded slightly. These observations were similar to germination of C. purpurea, C. sorghicola and C. africana described by ^{Hadley (1968)}, ^{Loveless and Peach (1986)} and ^{Tsukiboshi et al. (2001)}.

We observed that the germination of sclerotia and the formation of primordia, stipes and heads are not synchronized, which suggests that ascospores are released over a long period of time (Figure 3D)

Ascospore production and release

For the first time, it was possible to record ascospore release using (Sony Cyber-shot (modelo DSC-W120) (Figure 4). Under a stereoscopic microscope, we observed ascospores emerging from the ostioles of the perithecia; they were very thin, long structures that floated in space due to their lack of weight or, possibly, to geotropism.

According to ^{Loveless and Peach (1986)}, C. purpurea ascospores can be easily observed floating in the air over the stromatic head. ^{Lutrell (1977)} and ^{Prakash et al. (1983)} reported that they observed C. paspali and C. fusiformis ascospores discharge under the microscope by focusing on the ostioles of the perithecia (Figure 4), while ^{Pazoutová and Parbery (1999)} also observed asci tips emerging from ostioles. Ascomycetes are able to discharge ascopores either by ejecting them into the air several centimeters away or exuding them slowly as a mucilaginous mass accumulated around the ostiole (^{Loveless y Peach, 1986}).

Figure 4. Sexual structures from scleortia germination under lab conditions. Stromatic head longitudinal cuts show: A) Perithecia with different development level; B) Perithecia with asci and ascospores stained with lactophenol cotton blue; C) Asci interspersed with paraphyses; D) Asci with ascospores; and E) Ascospores ejected from perithecia. 

No ascospores were observed on inverted sclerotia immersed in distilled water for night monitoring. When germinated and differentiated stromas in the stipe and strome were inversely placed into bottles, the structures turned dark and porous, and stopped their normal development and maturity. However, no ascospores were captured on slides with lactophenol cotton blue stain or distilled water even when the distance between heads and slides was only about 10 cm.

According to outputs of this study, C. gigantea germination, formation of stipes, perithecia and ascae, and ascospores release, took about 175 days.

Ascospores growth in culture medium

No growth was observed in the 6 media used in this study (PDA, AHM, EMA, AA, AAD and Agar-Maize) and the thermal treatment at 50 °C. ^{Deacon (2006)} states that for ascospores in vitro germination and growth some stimulants are needed, such as carbohydrates and heat shocks to interrupt ascospores dormancy and induce germination. However, in this study we were not able to obtain pure crops from ascospores.

Morphological and molecular identification

Longitudinal sections of fine sections of heads showed a number of pyriform perithecia embedded in the peripheral region of the tissue. Perithecia showed asci, paraphyses and ascospores. Perithecia ostioles reached the head surface (Figures 4A, B). ^{Pazoutová and Parbery (1999)} stated that the size and form of perithecia depend on their maturity level. Young perithecia are small, oblong-to-oval shaped, while old perithecia are often elipsoildalto-pyriform; these features are also shown in this study (Figure 4B)

Measurements of perithecia (Figure 4C) were 404.9-569.3 x 151.3-284.4 µm, with 187-265.3 µm long asci containing 8 ascosposres of 169.6-263.7 x 1.0-2.1 µm. The size of these structures was larger than the one reported by ^{Fuentes et al. (1964)}. According to ^{Loveless (1964)} and ^{Pazoutová and Parbery (1999)}, the length of stringy ascospores of the Claviceps genus is a taxonomically reliable attribute, provided that measures are taken soon after they are ejected from asci (Figures 4E, F). The size of perithecia is also taxonomically reliable because it is a constant characteristic of mature stromas (^{Loveless, 1967}).

The sequence analysis of the partial region of the 18s gen, full ITS1, full 5.8s, full ITS2 and partial 28s, showed that the four sequences stored in NCBI No. KJ543564 (celes1), KJ543565 (celes2), KJ543566 (onesi1) and KJ543567 (onesi2) are 99 % identical to AJ133394.2 (Claviceps gigantea Pazoutová). The five samples were compared with Claviceps sorghi from another phylogenetic group (Figure 5) (^{Pazoutová, 2001}). Both characteristics, morphological and molecular, confirmed the Claviceps gigantea species. Fuentes, De la Isla, Ullstrup and Rodríguez.

Figure 5. Phylogenetic relation of the sequences of four C. gigantea DNA samples compared with sequences of C. gigantea and C. sorghi previously reported by ^{Pazoutová (2001)} at NCBI.