Roselle (Hibiscus sabdariffa L.) is a shrub with calyces that, when dehydrated, are used to produce foods, medications, cosmetics, and textiles. The main producers of this plant are China, India, and Sudan (^{Galicia-Flores et al., 2008}). Mexico is seventh place, and the state of Guerrero is the main producer nationwide, with a planted surface of14 274 ha (^{SIAP, 2014}). The main phytosanitary problem of this crop in Mexico is "black shank," caused by Phytophthora parasitica, and currently, spots on leaves and calyces caused by Corynespora cassiicola (^{Ortega et al., 2015}). Worldwide there are four viruses that affect roselle: Cotton leafcurl virus (CLCuV), Mesta yellow vein mosaic virus (MeYVMV), Malva vein clearing virus (MVCV), and Okra mosaic virus (OkMV) (^{Fauquet et al., 2005}; ^{Roy et al., 2009}). In recent years in some municipalities of the state of Guerrero, a disease has been found in roselle of an unknown etiology, known locally as "yellowing." The plants affected show symptoms consisting of vein clearing mosaic, and yellowing, and its incidence had been very low. However, it has been increasing considerably, and in the 2014 autumn-winter cycle it reached values of 90 to 100 % on five plots, therefore the aim of this study was to know the agent related to this disease. Ten 2-month old roselle plants were sampled, showing vein clearing, mosaic, and yellowing, as well as three asymptomatic plants in a field in the municipality of Tecoanapa and four fields in the municipality of Ayutla, Guerrero (Figure 1A). Five healthy roselle plants obtained from seed were mechanically inoculated, using roselle leaves with symptoms, as inoculum sampled on the field, grinding in a phosphate buffer solution pH 7.2 and carborundum 400 mesh (^{Dijkstra and de Jager, 1998}). As a control, there were three healthy roselle plants rubbed only with the buffer solution and the carborundum. Leaves from plants with symptoms collected in the field were grafted onto five healthy two-month old roselle plants obtained from seed, and they were kept in a greenhouse to observe the appearance of symptoms every two days for one month. As a control, there was a healthy roselle plant obtained from seeds without grafting. Total nucleic acids were extracted from the leaves from asymptomatic and symptomatic roselle plants collected from the field, and they were analyzed for phytoplasms (^{Teixeira et al., 2008}), Potyviridae family viruses (^{Chen et al., 2001}), Okra mosaic virus (OkMV) (^{Stephan et al., 2008}), and begomoviruses. For the latter, we used the TempliPhi 100 Amplification^® kit (Amersham Biosciences) that amplifies DNA via rolling circle (RCA) following the manufacturer's instructions. For the DNA-A of the begomoviruses, we designed the primers Sense DNA-AC (AAAACTCGAGGATGTGAAGGCCCATG) and Antisense DNA-AC (AAAAGGGAAGACGATGTGGGC), which amplify a fragment of approximately 1400 pb corresponding to genes AV1, AC3, AC2, and AC1. For DNA-B, we used the primers proposed by ^{Rojas et al., (1993)}, which amplify a fragment of 500 pb. The reaction mixture consisted of 1 μL of DNA obtained by RCA, PCR reaction buffer (1X), 0.20 mM dNTPs, 2.0 mM MgCl₂, 10 μM of each primer, 0.5 U of Taq polymerase (PROMEGA®), adjusting to a final volume of 20 μL. The PCR was carried out with the following conditions: initial denaturation 94 °C for 4 min, 30 denaturation cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1.5 min, one final extension cycle of 72 °C for 3 min. The amplified products of 1400 pb were sequenced and compared with the GenBank data base.

Figure 1 Roselle plants showing A. Yellow mosaic (plant sampled from Tecoanapa, Guerrero). B. Mosaic (plant grafted in greenhouse with leaves collected from field). C. Control: Healthy plant obtained from ungrafted seed. 

After 30 days, the mechanically inoculated plants showed no symptoms, possibly due to a low concentration of the virus, as well as the presence of inhibitors such as tannins in the plant material used as a source of inoculum that affect the protein of the capsid, causing the precipitation of the virus (^{Dijkstra and de Jager, 1998}), or of a non-transmissible virus in this way. ^{De La Torre-Almaraz et al., (2004)} point out that many viruses with an RNA genome are easily transmitted mechanically, and most viruses with a DNA genome are not transmitted in this way, or their transmission efficiency is very low. Four of the grafted plants displayed vein chlorisis and mosaic in younger leaves 17 days after grafting (Figure 1B). The symptoms observed in the greenhouse were different to those recorded on the field, due possibly to the different environmental conditions, age in which plants were inoculated (the moment of infection on the field is unknown), the means of inoculation (whether it occurs on the field by vectors or seed, for example, is unknown), the amount of inoculum, or the presence of other viruses in the field. Foliar tissue of the four grafted roselle plants that showed symptoms were used to carry out a total DNA extraction, rolling circle amplification and PCR for begomoviruses as described above.

The expected product amplification was not obtained for phytoplasms, viruses of the family Potyviridae and Okra mosaic virus (OkMV). The ten roselle plants with symptoms obtained on the field and four grafted plants that displayed symptoms in the greenhouse amplified the fragment of component A of the begomoviruses genome (1400 pb) (Figure 2A). Seven plants collected in the field, and four grafted plants that showed symptoms amplified the fragment of the component B of the begomoviruses genome (500 pb) (Figure 2B). These results indicate that most of the plants sampled in Ayutla and Tecoanapa are infected with bipartite begomoviruses and that there is at least one monopartite. Out of the ten plants sampled in the field, eight had a percentage of similarity of 95 % with Okra yellow mosaic Mexico virus (OkYMMV), one had a similarity of 91% with the Chino del tomate virus (CdTV), and the rest had a similarity of 88 % with the Malachra alceifolia virus (MAV). On the other hand, one of the grafted plants with symptoms had a similarity of 91 % with OkYMMV, and the three remaining, a similarity of 86-87 % with Tobacco leaf curl Cuba virus (TbLCCV). The low percentages of similarity obtained in the case of the CdTV, MAV, and TbLCCV are possibly due to yet undescribed begomoviruses. In Mexico there have been reports of the Hibiscus variegado virus (HVV) in Hibiscus sabdariffa in the Yucatan Peninsula (^{Hernández-Zepeda et al., 2007}), while in India ^{Roy et al. (2009)} found the begomoviruses Mesta yellow vein mosaic virus (MeYVMV) in Hibiscus cannabinus e H. sabdariffa, causing a reduction in growth and losses in production. Initially, MeYVMV causes chlorosis in nervations, followed by the yellowing of leaves. These symptoms differ from those observed in roselle plants sampled in Guerrero, in which a clearing of nervations is initially observed, followed by a mosaic that disappears with time, and the leaf turns yellow with some dark green or white areas. There have been reports in the Yucatan Peninsula of OkYMMV causing yellow mosaic and foliar distortion in Abutilon permolle; yellow mosaic, foliar distortion and spotting in Corchorus siliquosus; and yellow mosaic and mottling in Sida acuta (^{Hernández-Zepeda, et al 2007}). In 2009, OkYMMV was reported in Texas in okra (Abelmoschus esculentus) crops causing irregular, yellow-colored foliar spots, yellowing of the edges of leaves, and chlorosis in mature leaves (^{Hernández-Zepeda et al., 2010}). The results obtained in this study indicate that the yellowing of roselle in Guerrero, Mexico, is associated to begomoviruses, including Okra yellow mosaic Mexico virus (OkYMMV).

Figure 2 PCR products obtained with A. primers Sense DNA-AC/Antisense DNA-AC (1400 pb) for the segment A and B. PBL1v2040/PCRc1 (500 pb) for the segment B of bipartite begomovirus, respectively, from DNA obtained by circle amplification. Lanes 1-7, 14-16: Roselle plants with symptoms, collected from field; Lanes 8-10 and 17. Grafted plants that showed mosaic; Lane 11: Negative control (asymptomatic plant); Lanes 12 and 13: Negative control (water); M: Molecular weight marker 1Kb (Promega^®).