SciELO - Scientific Electronic Library Online

 
vol.34 número2Detección de Pineapple mealybug wilt-associated virus 1 y 3 en MéxicoRevisión de técnicas de diagnóstico de Brenneria spp en nogal ( Juglans regia ) índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • No hay artículos similaresSimilares en SciELO

Compartir


Revista mexicana de fitopatología

versión On-line ISSN 2007-8080versión impresa ISSN 0185-3309

Rev. mex. fitopatol vol.34 no.2 Texcoco  2016

http://dx.doi.org/10.18781/R.MEX.FIT.1509-2 

Artículos científicos

Pruebas de patogenicidad de Phytophthora cinnamomi Rands. en Pseudotsuga mensiezii

Alejandra Almaraz-Sánchez1 

Dionicio Alvarado-Rosales1  * 

Gerardo Leyva-Mir2 

Armando Equihua-Martínez1 

Sergio Aranda-Ocampo1 

Javier Hernández-Morales1 

1 Programa de Fitopatología, Colegio de Postgraduados, km 36.5 carr. México-Texcoco. Montecillo, Texcoco, Edo. de México. 56230

2 Departamento de Parasitología Agrícola, Universidad Autónoma Chapingo, km 38.5 carr. México-Texcoco. Chapingo, Texcoco, Estado de México. 56230

Resumen:

Phytophthora cinnamomi Rands es un microorganismo del suelo que ha causado grandes pérdidas económicas y ecológicas a nivel mundial, en una amplia gama de hospedantes. Es por esto que se identificó y evaluó la patogenicidad de cinco aislados de P. cinnamomi, procedentes de cinco regiones de México, en plantas de Pseudotsuga mensiezii. Los aislados se obtuvieron de suelo, raíz y cancros de árboles de Quercus salicifolia, de El Arrayanal, Col. (COL-A); Quercus elliptica de Tecoanapa, Gro. (GRO-P), Quercus peduncularis de Manántlan, Jal. (JAL-C), Pseudotsuga mensiezii del Edo. de México (EDO-T) y Persea americana, de Peribán Mich. (MICH-P). A través de un análisis morfológico a género y molecular a especie (No Accesión: KP773290, KP773291, KP773292, KP773293, KP773294) se corroboró la identificación de los aislados con los análisis moleculares que indican una homología de 99 % de identidad con P. cinnamomi. La patogenicidad se probó en plantas sanas de P. menziesii de tres años de edad. Para cada aislado se utilizaron cinco plantas con su respectivo testigo de cinco plantas sin inocular, las plantas se mantuvieron bajo condiciones de invernadero y las observaciones de síntomas se realizaron semanalmente durante ocho meses. Los resultados obtenidos indicaron que los cinco aislados de P. cinnamomi son capaces de infectar a las plantas de P. menziesii.

El aislado COL-A, de la región del Arrayanal Col., se comportó como el más patogénico, causando la muerte en un periodo más corto de las plantas a los 120 ddi, le siguieron los aislados GRO-P a los180 ddi, JAL-C y EDO-T a los 210 ddi, y MICH-P a los 240 ddi. Para analizar los datos obtenidos en el ensayo se llevó a cabo la prueba de Kruskall-Wallis detectando diferencias estadísticas significativas de los aislados sobre el hospedante. El testigo no presentó síntoma alguno. Este es el primer reporte de P. cinnamomi aislado de Q. salicifolia, Q.elliptica, Q.peduncularis, P. mensiezii y P. americana evaluado en plantas de P. mensiezii, donde se corrobora la patogenicidad del patógeno.

Palabras clave: P. cinnamomi; identificación; morfológica; molecular; Pseudotsuga mensiezii; Persea americana; Quercus spp

Phytophthora cinnamomi es un microorganismo del suelo que provoca grandes pérdidas económicas y daños ecológicos; causante de pudriciones radicales, cuello, tronco y ramas. Afecta a muchas especies de plantas en la agricultura, horticultura y especies forestales, que incluye a más de 1000 especies y cuenta con una amplia distribución geográfica, en todo el mundo (Crone et al., 2013; Erwin y Ribeiro, 1996; Garbelotto et al., 2006; Philip et al., 2009; Zentmyer, 1980). La primera descripción de Phytophthora cinnamomi la realizó Rands, en 1922, como el agente causal del cancro en tallo de árboles de canelo, en Sumatra (Erwin y Ribeiro, 1996). Desde entonces sus daños se han reportado en diferentes hospedantes. En México, los primeros reportes de P. cinnamomi fueron realizados por Zentmyer en 1952, causando daños severos en áreas productoras de aguacate y pérdidas de hasta 90 % (Pérez, 2008; Téliz y Mora, 2007; Tamayo, 2007). Así mismo, se ha reportado en bosques naturales de Quercus spp, a principios del año 2000, en El Arrayanal, Col., ocasionando la muerte y daños en árboles de encino (Tainter et al., 2000). Posteriormente se le encontró afectando árboles del mismo género en la Reserva de la Biosfera, en Jalisco (Davidson et al., 2003) y en Tecoanapa, Gro. (Alvarado et al., 2007 y 2008).

También se reporta que afecta árboles de Pseudotsuga menziesii en los estados de Jalisco, Edo. de México y Veracruz (García, 2007). Los síntomas causados por el patógeno son clorosis, defoliación, muerte de ramas, cancros en la corteza y pudrición de raíz, lo que ocasiona la muerte del árbol (Dos Santos et al., 2011; Erwin y Ribeiro, 1996). La patogenicidad del género de Phytophthora, está influenciada por condiciones de temperatura, precipitación, humedad, textura del suelo, pH y disponibilidad de nutrientes (Shew y Benson, 1983; Balci et al., 2008; Jonsson et al., 2005; Sánchez et al., 2005; Thompson et al., 2014). La patogenicidad depende del tipo de cepa y adaptación de los patógenos en la planta, y puede ser estimada por la rapidez del patógeno en dañar al hospedante (Pariaud et al., 2009; Robin and Desprez., 1998)

En México se han realizado pruebas de patogenicidad de P. cinnamomi en variedades de aguacate, sin embargo, no hay reportes de estas con aislados de P. cinnamomi procedentes de distintas regiones de México, obtenidas de especies forestales. Este patógeno representa una amenaza para especies de plantas tanto comerciales como bosques naturales, que se encuentran en otras partes del país, ya que el desconocimiento de esta información puede traer como consecuencia una importancia económica y ecológica de la especie afectada. La identificación de este patógeno ha sido a través del uso de claves taxonómicas, medios selectivos y muy recientemente se ha caracterizado empleando diferentes técnicas moleculares mediante PCR (Polymerase Chain Reaction), con iniciadores específicos para cada especie obteniendo resultados importantes sobre la taxonomía, filogenia y variabilidad del hongo (Gallegly y Hong, 2008; Tsai et al., 2006; Martín et al., 2000). Por lo anterior, el objetivo de este estudio fue identificar y evaluar la patogenicidad de cinco aislados de P. cinnamomi, procedentes de cinco regiones de México obtenidos de árboles de Quercus elliptica, Q salicifolia, Q. peduncularis, Pseudotsuga mensiezii y Persea americana., en plantas de P. mensiezii.

Materiales y métodos

Aislamiento del patógeno

Los aislados empleados en esta investigación se obtuvieron de suelo, raíz o cancros de árboles de Quercus salicifolia, de El Arrayanal, Col. (COL-A); Quercus elliptica de Tecoanapa, Gro. (GRO-P), Quercus peduncularis de Manantlán, Jal. (JAL-C), Pseudotsuga mensiezii del Edo. de México (EDO-T) y Persea americana, de Peribán Mich. (MICH-P), los cuales fueron identificados a través de un análisis morfológico a género y molecular a especie.

Los árboles mostraban síntomas característicos que causa P. cinnamomi, entre estos muerte regresiva, marchitez, clorosis, defoliación prematura, cancros y exudado color oscuro en la corteza. Para obtener al patógeno directamente en campo, a partir de cancros, se utilizó medio selectivo PARPH (pimaricina-ampicilina-rifampicina-PCNB e himexazol) (Jeffer y Martín, 1986; Erwin y Ribeiro, 1996. En laboratorio las muestras de raíz, se desinfectaron y sembraron en medio selectivo PARPH. Para las muestras colectadas de suelo, se utilizó un método de trampeo con discos de camelia, una suspensión de agua suelo + raíz y medio selectivo (Almaraz et al., 2013). El aislado de aguacate, fue proporcionado por el Dr. Salvador Ochoa Ascencio de la Facultad de Agrobiología "Presidente Juárez" de la UMSNH. El aislado de planta de aguacate se obtuvo por los síntomas característicos de la enfermedad tristeza del aguacatero por P. cinnamomi.

Identificación morfológica

Las colonias obtenidas de Phytophthora se les realizó punta de hifa y se transfirieron a cajas Petri con medio de cultivo PDA (papa-dextrosa-agar) y se incubaron durante siete días en oscuridad, a una temperatura de ± 25 °C (Zentmyer, 1980). Posteriormente se caracterizaron a género con base en la morfología de la colonia y estructuras de reproducción. El desarrollo de las colonias se midió diariamente de cada uno de los aislamientos, hasta que el oomyceto llenó la caja Petri. Para la producción de esporangios se realizó una suspensión de extracto de suelo + agua destilada estéril, en la cual se colocó discos de micelios de 5 mm de diámetro en cajas Petri (Romero, 1996), estas cajas se colocaron a una temperatura de ± 25 °C bajo condiciones de luz continua por seis días. Los esporangios se observaron al microscopio y se realizaron las descripciones de cada aislamiento así como sus mediciones de la relación largo y ancho, se midieron 100 esporangios de cada aislamiento.

Una vez identificados a género todos los aislamientos, se procedió a conservarlos en tubos de ensayo que contenían PDA agregando aceite mineral. Todo esto se realizó en el laboratorio de Patología Forestal del Colegio de Postgraduados.

Caracterización molecular

El ADN de cada aislamiento que se utilizó para la identificación a especie se extrajo de colonias miceliales desarrolladas en medio de cultivo PDA de aproximadamente siete días de crecimiento. Para la extracción del ADN se empleó la técnica de Sambrook y Russell (2001). El ADN total obtenido se visualizó por electroforesis en gel de agarosa al 0.8 % y se cuantificó en un espectrofotómetro Nanodrop 1000 (Termoscientific).

PCR. Para realizar el análisis por PCR del ADN extraído, se amplificaron las regiones ITS con los primers ITS'5 (GGAAGTAAAAGTCGTAACAAGG) e ITS'4 (TCCTCCGCTTATTGATATGC) de genes rRNA de las subunidades 18S-5.8S y 5.8S-28S (White et al., 1990). Para la reacción de PCR se utilizó un volumen final de 25 μL con la siguiente formulación: 13.22 μL de agua ultrapura estéril, 2.5μL con solución amortiguadora de buffer 5X, 2.08 μL de MgCl2 a 2.5 mM, 2 μL dNTPs a 2.0 mM, 2 μL de cada primers a 20 ρMol, 0.2 μL de Taq-DNA polimerasa a 1.5 U y 1 μL de muestra de ADN 80 ng. La amplificación de los iniciadores se realizó en un termociclador Perkin-Elmer (Mod. CT 2400), con el siguiente programa: un ciclo inicial de desnaturalización del ADN a 95 °C por 2 min; 30 ciclos a 95 °C por 1 min, alineación a 50 °C por 30 s y extensión a 72 °C por 2 min; la extensión final fue a 72 °C por 10 min. El fragmento amplificado se purificó con el KIT Quiagen® y la calidad se verificó por electroforesis en gel de agarosa al 1 % teñido con bromuro de etidio. La banda se visualizó en un transiluminador (GelDoc 2000, BIO RAD®), y se analizó con el programa Quantity One 4.0.3 (Sambrook y Russel, 2001). El producto de PCR se envió a la compañía Macrogen, E.U.A, para su secuenciación (Automatic Sequencer 3700xl DNA Analyzer).

Las secuencias obtenidas con los iniciadores ITS5-ITS4 se alinearon con las disponibles en el banco de genes del Nacional Center for Biotechnology Information (NCBI), de E.U.A. (http://www.ncbi.nlm.nih.gov). De los valores cuantitativos generados, solo se bajaron las secuencias con el valor más alto, para su comparación con las que se obtuvieron en este estudio. Las secuencias se alinearon con Clustal W versión 1.6. y se depositaron en la base de datos del Gen Bank para obtener su número de acceso.

Pruebas de patogenicidad

Una vez desarrolladas las colonias en medio de cultivo PDA con siete días de edad, se procedió a realizar las pruebas de patogenicidad. De cada uno de los aislamientos obtenidos se procedió a realizar las pruebas bajo condiciones de invernadero en árboles cultivados en macetas de Pseudotsuga menziesii de tres años de edad, con una altura de 45 a 47 cm. La inoculación se realizó con el método de disco de micelio en tallo (O'Gara et al., 1996). En el punto de inoculación los tallos de plantas se limpiaron con agua destilada estéril, con una aguja de disección desinfectada con alcohol al 70 % y flameada al mechero, se realizaron 10 punciones, de cada aislado se tomaron discos de 0.5 mm de diámetro con micelio del pseudohongo crecido en medio de cultivo PDA, los cuales se colocaron en el área y se cubrieron con algodón estéril húmedo, y se cubrió con una gasa y cinta de parafilm alrededor del tallo, con el fin de mantener la humedad. Todo esto se realizó bajo condiciones asépticas.

Se inocularon cinco plantas para cada uno de los aislamientos (repeticiones), así mismo, se contó con un testigo, al que sólo se le aplicó medio de cultivo PDA, dando un total de 30 plantas inoculadas. Finalmente, a cada planta se le cubrió con una bolsa de plástico, para generar condiciones de alta humedad relativa. Así permanecieron por una semana y se mantuvieron a una temperatura ambiente ± 25 °C. Las plantas se distribuyeron al azar sobre mesas en el invernadero y se regaron cada tercer día a capacidad de campo. Se evaluó el número de días a la aparición de los síntomas y muerte en la planta, esto se realizó semanalmente durante ocho meses, y los resultados obtenidos se sometieron a un análisis estadístico (prueba de Kruskall-Wallis) utilizando el programa SAS (SAS, 2012) para determinar el comportamiento de los aislados de P. cinnamomi.

Resultados y Discusión

Los aislamientos obtenidos de suelo, raíz y cancros de árboles de las diferentes localidades se muestran en el Cuadro 1.

Cuadro 1 Aislados obtenidos de P. cinnamomi, empleados en las pruebas de patogenicidad en plantas de Pseudotsuga menziesii

Clave Localidad Hospedante Origen Suelo/Raíz/cancro
COL - A El Arrayanal, Col. Quercus salicifolia. cancro
GRO - P Tecoanapa, Gro Quercus elliptica. cancro
JAL - C Manantlán, Jal. Quercus peduncularis. Suelo
MICH- P Peribán, Mich. Aguacate Raíz
EDO -T Tres Encinos. Edo. de México Pseudotsuga menziesii Suelo

Identificación morfológica

Las cinco colonias aisladas de árboles de Q. salicifolia, Q. elliptica, Q. peduncularis, Pseudotsuga mensiezii y Persea americana mostraron un crecimiento uniforme en medio de cultivo PDA observándose el crecimiento micelial de aspecto algodonoso, de color blanco, en forma de camelia (Figura 1) debido al crecimiento deprimido; micelio cenocítico, toruloso, con hifas coraloides y abundantes hinchamientos, todo esto a nivel de género. Se observó que este patógeno produce clamidosporas esféricas, ovales, piriformes, terminales o intercalares, frecuentemente en racimos, algunos autores mencionan que persisten en el suelo por años, las cuales constituyen un órgano de conservación y supervivencia como lo reportan Erwin y Ribeiro (1996); Jung et al., (2013) y Zentmyer et al., (1996).

Figura 1 A) Colonias de los aislados heterotálicos de P. cinnamomi de seis días con clave: A) COL-A y siete días de edad con clave: B) GRO-P, C) EDO-T encinos, D) JAL-C y E) MICH-P en forma de camelia desarrollándose en medio de cultivo PDA. 

Además, se midió el largo y ancho promedio de 100 esporangios de cada aislamiento, éstos fueron los siguientes: COL-A 40.49 x 28.19, JAL-C 40.81 x 28.63 μm, GRO-P 48.24 x 31.47 μm, EDO-T 43.2 x 32.9 μm y MICH 56.23 x 33.8 μm, por su parte Erwin y Ribeiro (1996), reportan valores de 75 x 40 μm, por lo que no concuerdan con las obtenidas en este estudio. En cuanto al tamaño de los esporangios, estos varían con las condiciones ambientales y solo se producen en extracto de suelo (Sánchez et al., 2002b). En las características morfológicas de los esporangios de P. cinnamomi, ovoides a elongados y ápice no papilado, concuerdan con las reportadas por Erwin y Ribeiro (1996), Gallegly y Hong (2008) y Waterhouse (1963).

Caracterización molecular

La banda del producto de PCR fue de aproximadamente 1200 a 1500 pb (Figura 3). Los resultados de la secuenciación de cada aislado se compararon con las secuencias reportadas en el banco de genes (NCBI). Las secuencias por aislamiento tuvieron 99 % de índice de similaridad para la especie P. cinnamomi. Al comparar los nucleótidos de cada aislamiento e identificados morfológicamente con las reportadas en el banco de genes (NCBI), estas correspondieron a la misma especie. Esto corroboró la identificación morfológica de cada aislado (Cuadro 3).

Figura 2 A) Desarrollo de síntomas en plantas de Pseudotsuga menziesii de tres años de edad inoculadas con los diferentes aislados de P. cinnamomi clave (COL-A, GRO-P, EDO-T, JAL-C, y MICH-P). B) Cancro en plantas. C) Resinación en la base del tallo. D) Progreso de la enfermedad en la planta E) Cancro de coloración café claro a oscuro causado por el aislamiento COL-A. F) Testigo y plantas inoculadas durante las pruebas de patogenicidad. G) Tejido enfermo del aislado COL-A y micelio del organismo en medio selectivo PARHP. H) Reaislamiento COL-A de P. cinnamomi de siete días en PDA. 

Figura 3 Electroforesis en gel de agarosa al 1 % que muestra una banda de aproximadamente 1500 pb del producto amplificado por PCR con los iniciadores ITS4 e ITS5; M. Marcador molecular de 1 kb, carril 1. COL-A., 2. GRO-P., 3. JAL-C., 4. MICH-P y 5. EDO-T. 

Cuadro 2 Prueba de Kruskal-Wallis para evaluar número de días en síntomas y la muerte en las plantas inoculadas con los cincos aislamientos de Phytophthora cinnamomi

Tratamiento Hongo Medias de rangos Grupos
Testigo P. cinnamomi 31.50 A
MICH-P P. cinnamomi 60.68 B
EDO-T P. cinnamomi 64.85 B
JAL-C P. cinnamomi 64.85 B
GRO-P P. cinnamomi 66.52 B
COL-A P. cinnamomi 97.00 C

Letras iguales no difieren significativamente entre tratamientos.

Cuadro 3 Identificación morfológica y molecular de aislados de Phytophthora cinnamomi, número de nucleótidos, especie alineada con el 99 % de confiabilidad y número de acceso en la base de datos del National Center for Biotecnology Information (NCBI). 

Clave de Aislamiento Identificación Morfológica No. de nucleótidos Especie alineada Núm. de acceso a especie alineada NCBI
Col-A P. cinnamomi 1046 P. cinnamomi KP773290
GRO-P P. cinnamomi 925 P. cinnamomi KP773291
JAL-C P. cinnamomi 940 P. cinnamomi KP773292
MICH-P P. cinnamomi 926 P. cinnamomi KP773293
EDO-T P. cinnamomi 952 P. cinnamomi KP773294

Pruebas de patogenicidad

Las plantas de Pseudotsuga mensiezii que se les colocó el patógeno empezaron a presentar síntomas de marchitez de brotes, flacidez en las puntas, clorosis en las acículas, muerte de ramas en la base de la planta. Acompañado del desarrollo de cancro en el tallo, el cual se caracterizó por la presencia de necrosis en la epidermis del mismo y desprendimiento de la corteza, dando una coloración de color café claro a oscura.

Los aislados presentaron una patogenicidad diferente en el hospedante inoculado. El aislado COL-A del Arrayanal, Col., procedente de Quercus salicifolia, fue el primero en causar síntomas visibles a los 67 ddi y la muerte de la plantas a los 120 días después de la inoculación. Además se observó que el aislamiento procedente del El Arrayanal, Col. (COL-A) fue el primero en cubrir la caja Petri a los cinco días; así mismo, el primero en la formación de esporangios en seis días en solución de suelo. El aislado GRO-P, procedente de Q. elliptica, ocasionó los síntomas 93 ddi y la muerte 180 días después de la inoculación; en el caso del EDO-T, de Pseudotsuga mensiezii, se requirieron 135 ddi lo mismo que para JAL-C, obtenido de Q. peduncularis y la muerte de la plantas 210, y para MICH-P, aislado de Persea americana 160 ddi y 240 días para la muerte (Figura 2). Los resultados anteriores muestran que todos los aislamientos fueron capaces de causar enfermedad pero el aislado COL-A se comportó como el más patogénico en las plantas de Pseudotsuga menziesii, por lo que fue evidente que hay variación de patogenicidad entre los aislamientos de P. cinnamomi de las diferentes regiones de México.

Los datos anteriores, específicamente determinan la muerte en base a patogenicidad de los aislamientos, estos resultados se sometieron a un análisis estadístico utilizando la prueba de KrusKallWallis. Se obtuvieron diferencias significativas entre los aislados (P 0.0001) (Cuadro 2). El aislado COL-A fue estadísticamente diferente al resto de los demás, mostrando una media de rango mayor a la de los otros.

A partir del tejido infectado de las plantas inoculadas con cada aislado, se re aisló el patógeno P. cinnamomi. Las plantas de Pseudotsuga menziesii que se emplearon como testigo no presentaron ningún síntoma. No se encontraron estudios similares en especies forestales, sin embargo, estos resultados concuerdan con lo obtenido por Ceja et al., (2000) en plantas de aguacate inoculadas con P. cinnamomi quienes observaron que el patógeno provocó marchitez en el follaje, presencia de cancro de color oscuro en tallo con una lesión interna de color café y finalmente la muerte de las plantas.

En este estudio se relacionó la sintomatología causada por los aislados en plantas de Pseudotsuga mensiezii, la cual coincide con lo reportado por Erwin y Ribeiro (1996).

Por otra parte, Jordan y Tainter (1996) observaron que al inocular plantas de robles blancos y rojos, estas especies son muy susceptibles a P. cinnamomi y que los síntomas pueden tardar de meses a años para ser evidentes.

De igual manera, Robin y Desprez-Loustau (1998), quienes inocularon discos de agar de micelio de P. cinnamomi en plantas de castaño y roble rojo, probaron su patogenicidad, encontrando que todas las plantas manifestaron síntomas de amarillamiento, defoliación, agrietamientos, coloración color marrón y cancros pero con diferente nivel de virulencia. Sin embargo, Chastagner (1997), hace mención que la formación o desarrollo del cancro no siempre se forma ya que este dependerá del mecanismo del patógeno y del ambiente.

Podger (1989) por su parte, menciona que cuando utilizó 14 aislados australianos de P. cinnamomi, aisladas de 10 especies de plantas hospederas, causaron enfermedad en especies de dicotiledóneas y el síntoma principal consistió de una coloración anormal en raíz y finalmente la muerte. Los aislados no mostraron diferencia en su patogenicidad.

Los resultados obtenidos en este estudio sobre la patogenicidad de los aislados de P. cinnamomi coinciden con los reportados por Huberli et al., (2001), quienes encontraron que la patogenicidad de aislados australianos en plantas de Eucalyptus marginata y Corymbia calophylla mostraron tres tipos de respuesta: la primera, con alta capacidad para matar plantas, a los 59 días, después de la inoculación; la segunda, de 182, los cuales fueron considerados intermedios y la tercera, los que no inducen muerte de planta, pero son considerados los menos patogénicos.

Por su parte, Dudzinski et al., (1993), encontraron diferencias entre los aislados de P. cinnamomi colectados en Australia inoculados en tallos de Eucalyptus marginata, estos autores detectaron una variación de la patogenicidad en la manifestación de síntomas, desde la inoculación hasta la muerte de la planta. Otros estudio realizado por Brasier et al., (1993) menciona que P. cinnamomi es un patógeno agresivo en árboles de robles y que la introducción y la propagación de suelo de bosque con el patógeno puede ser un factor importante en la declinación y disminución del alcornoques en la Península Ibérica.

Por otra parte Tippett et al., 1985. Evaluaron el método de inoculación por herida en 21 árboles de Eucalytus marginata y con un aislamiento de P. cinnamomi observaron que no existe variación en la patógenicidad de P. cinnamomi en las plantas inoculadas.

Conclusiones

Todos los aislados de Phytophthora correspondieron a P. cinnamomi y mostraron ser patogénicos sobre Pseudotsuga mensiezii de los cuales el aislado COL-A fue el más patogénico.

Este es el primer estudio en México donde se reportan la patogenicidad de aislados de P. cinnamomi procedentes de diferentes lugares y hospedantes sobre P. menziesii.

Agradecimientos

Al Consejo Nacional de Ciencia y Tecnología (CONACYT) y al Colegio de Postgraduados, por el financiamiento y aceptación para realizas mis estudios de postgrado.

Literatura citada

Alvarado-Rosales D, L de L Saavedra Romero, A Almaraz-Sánchez, B. Tlapal-Bolaños, O Trejo-Ramírez, J. M Davidson, J T Kliejunas, S W Oak, J G O'Brien, F Orozco-Torres y Quiroz-Reygadas D. 2007. Agentes asociados y su papel en la declinación y muerte de encinos (Quercus, Fagacaeae) en el centro-oeste de México. Polibotánica 23: 1-21. http://www.redalyc.org/articulo.oa?id=62102301Links ]

Alvarado-Rosales-D, L de L Saavedra y A Almaraz-Sánchez . 2008. Primer reporte de Phytopohthora cinnamomi Rands. asociado al encino Quercus spp., en Tecoanapa, Guerrero, México. Agrociencia 42: 565-572. http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S1405-31952008000500008Links ]

Almaraz-Sánchez-A, Alvarado-Rosales-D, Saavedra-Romero L de L. 2013. Trampeo de Phytophthora cinnamomi en bosque de encino con dos especies ornamentales e inducción de esporulación. Revista Chapingo. Serie Ciencias Forestal y del Ambiente 19: 5-12. http://dx.doi.org/10.5154/r.rchscfa.2011.09.062 [ Links ]

Balci Y, S Balci, W L MacDonald, and Gottschalk K W. 2008. Relative susceptibility of oaks to seven species of Phytophthora isolated from oak forest soils. For. Pathol. 38:394 409. http://dx.doi.org/10.1111/j.1439-0329.2008.00559.x [ Links ]

Brasier C M, Sobredo F Ferraz J F P. 1993. Evidence for Phytophthora cinnamomi involvement in Iberian oak decline. Plant. Pathol. 42, 140-145. http://dx.doi.org/10.1111/j.1365-3059.1993.tb01482.x [ Links ]

Crone M McComb, J A O'Brien P A, Hardy G E St J 2013. Assessment of Australian native annual/herbaceous perennial plant species as asymptomatic or symptomatic hosts of Phytophthora cinnamomi under controlled conditions. For. Pathol. 245-251. http://dx.doi.org/10.1111/efp.12027 [ Links ]

Ceja T L F, Téliz O D, Osada K S, Morales G J L. 2000. Etiología, distribución e incidencia del cancro del aguacate Persea Americana Mill. en cuatro municipios del estado de Michoacán, México. Rev. Mexi. Fitopatol. 18:79-86. [ Links ]

Chastagner G A, (Eds). 1997. Christmas tree diseases, insects, and disorders in the Pacific Northwest: identification and management. Washingtn State University Cooperative, Pullman 156. [ Links ]

Davidson J M, O'Brien, J G, S W Oak and J Kliejunas. 2003. Report on a site visit to México-Muerte del Encino. USDA Forest Service. 9 p. [ Links ]

Dos Santos Á F, D J Tessmann, T C A, Alves J B Vida, and R Harakava. 2011. Root and crown rot of Brazilian pine (Araucaria angustifolia) caused by Phytophthora cinnamomi. J. Phytopathol. 159:194-196. http://dx.doi.org/10.1111/j.1439-0434.2010.01741.x [ Links ]

Dudzinski M L, Old K M, and Gibbs R.J. 1993. Pathogenic variability in Australian isolates of Phytophthora cinnamomi. Aust. J. Bot 17: 35-37. http://dx.doi.org/10.1071/BT9930721 [ Links ]

Erwin D C, and O K Ribeiro.1996. Phytophthora diseases worldwide. APS. USA. 562 Gallegly M.E, and Hong C. 2008. Phytophthora: identifying species by morphology and DNA Fingerprints. APS Press.ST. Paul, MN USA. 158. [ Links ]

Gallegly M E, and Hong M. 2008. Phytophthora: identifying species by morphology and DNA Fingerprints. APS Press. ST. Paul, MN USA. 150 p. [ Links ]

Garbelotto M, Huberli D. 2006. First report on an infestation of Phytophthora cinnamomi in natural oak woodlands of California and its differential impact on two native oak species. Plant Dis. 90:685 http://dx.doi.org/10.1094/PD90-0685C [ Links ]

García D S E. 2007. Pudriciones de raíz por Phytophthora / Root rot by Phytophthora. En: Cibrián T D, Alvarado R.D, y García D S E (Eds). 2007 Enfermedades forestales en México/ Forest Disesases in México. Universidad Autónoma Chapingo y CONAFOR-SEMARNAT, México; Forest Service USDA, E.U.A.; NRCAN Forest Service, Canadá y Comisión Forestal de América del Norte, CONAFOR, FAO Chapingo, México. 587. [ Links ]

Huberli D, Tommerup I C, Dobrowolski M P, Calver M C, and Hardy G E St J . 2001. Phenotypic variation in a clonal lineage of two Phytophthora cinnamomi populations from Western Australia. Mycol. Res. 105:1053-1064. http://dx.doi.org/10.1016/S0953-7562(08)61967-X [ Links ]

Jordan A P and Tainter F H. 1996. The susceptibility of Southern Appalachian Oaks to Phytopthora cinnamomi. Department of Forest Resources, Cleson University,USA. Castanea 61(4): 348-355. http://www.jstor.org/stable/4033859?seq=1#page_scan_tab_contentsLinks ]

Jonsson U Jung T, Sonesson K, and Rosengren U. 2005. Relationships between health of Quercus robur, occurrence of Phytophthora species and site conditions in southern Sweden. Plant Pathol. 54: 502-511. http://dx.doi.org/10.1111/j.1365-3059.2005.01228.x [ Links ]

Jeffer N, Martín JB.1986. Comparison of two media selective for Phytophthora and Pythium species. Plant Dis. 70, 1038-1043. http://dx.doi.org/10.1094/PD-70-1038 [ Links ]

Jung T, Colquhom I J, Hardy G E St J. 2013. New insights into the survival strategy of invasive soilborne pathogen Phytophthora cinnamomi in indifferent natural ecosystems in Wester Australia. Forest Pathol. 43: 266-288. http://dx.doi.org/10.1111/efp.12025 [ Links ]

Martin R R, James D, Levesque. 2000. Impacts of molecular diagnostic technologies on plant disease. Annu Rev Phytopathol. 38: 207-239. http://dx.doi.org/10.1146/annurev.phyto.38.1.207 [ Links ]

Pariaud B, Ravigne V, Halkett F, Goyeau H, Carlier J, y Lannou C. 2009. Aggressiveness and its role in the adaptation of plant pathogens. Plant Pathology, 58:409-424. http://dx.doi.org/10.1111/j.1365-3059.2009.02039.x [ Links ]

O'Gara E, Hardy G E S, and Mc Comb J A. The ability of Phytophthora cinnamomi to infect trough wounded periderm tissue of Eucalyptus marginata. Plant Pathology 45: 955-963. http://dx.doi.org/10.1111/j.1365-3059.1996.tb02906.x [ Links ]

Pérez M, 2008. Significant Avocado Diseases Caused by Fungi and Oomycetes. The European J Plant Sci Biotechnol 2(1):1-24. http://www.globalsciencebooks.info/Online/GSBOnline/images/0806/EJPSB_2(1)/EJPSB_2(1)1-24o.pdfLinks ]

Philip A, O'Brien Nari Williams, and Giles E St J Hardy. 2009. Critical Review in Microbiology 35(3): 169-181. [ Links ]

Podger F D. 1989. Comparative pathogenicity of fourteen Australian isolates of Phytophthora cinnamomi determined on transplants of Tasmanian temperate heathland. Aust. J. Bot. 37: 491-500. http://dx.doi.org/10.1071/BT9890491 [ Links ]

Robin C, and Desprez-Loustau M L. 1998. Testing variability in pathogenicity of Phytophthora cinnamomi. European Journal of Plant Pathology (Buscar abreviatura) 104: 465-475. http://dx.doi.org/10.1023/A:1008649806620 [ Links ]

Romero C S. 1998. Hongos fitopatógenos. Universidad Autónoma Chapingo. Dirección General de Patronato Universitario. 347 p [ Links ]

Sánchez M E, Andicoberry S, and Trapero A. 2005. Pathogenicity of three Phytophthora spp. causing late seedling rot of Quercus ilex ssp. ballota. Forest Pathol 35: 115-125. http://dx.doi.org/10.1111/j.1439-0329.2004.00392.x [ Links ]

Sánchez M E, Caetano P, Ferraz J, Trapero A. 2002b. Phytophthora disease of Quercus ilex insouthwestern Spain. For. Path. 32, 5-18. http://dx.doi.org/10.1046/j.14390329.2002.00261.x [ Links ]

Sambrook J, and Russell D W. 2001. Molecular Cloning: A Laboratory Manual Volumen 1, 3rd. edition. Cold spring Harbour Laboratory Press, NY. USA. 234 p. [ Links ]

Shew H D, and Benso D M. 1983. Influence of soil temperature and inoculum density of Phytophthora cinnamomi on root rot of Fraser fir. Plant Dis. 67:522-524. http://www.apsnet.org/publications/PlantDisease/BackIssues/Documents/1983Articles/PlantDisease67n05_522.PDFLinks ]

SAS Intitute. 2012. GLM Procedure. SAS Institute. Cary, NC, USA. [ Links ]

Tainter F H, O'Brien J G, Hernández A, Orozco and O Rebolledo. 2000. Phytophthora cinnamomi as a cause of oak mortality in the state of Colima, Mexico. Plant Dis. 84(4):394-398. http://dx.doi.org/10.1094/PDIS.2000.84.4.394 [ Links ]

Tamayo P J. 2007. Enfermedades del aguacate. Revista Politécnica 4:52-71. [ Links ]

Tsai H L, Huang L C, Ann P J, and Liou R F. 2006. Detection of orchid Phytophthora diseases by nested PCR. Bot Bull. Acad. Sin. 47: 379-387. http://ejournal.sinica.edu.tw/bbas/content/2006/4/Bot474-03.pdfLinks ]

Téliz O D y Mora A J A. 2007. El manejo integral del aguacate. In Téliz,O D; Mora A. El aguacate y su manejo integral 2a. ed(Eds).Editorial Mundi-Prensa, Méx.D.F., p 287-306. [ Links ]

Tippett J T, Hill T C, and Shearer B L.1985. Resistance of Eculalyptus spp. to invasion by Phytophthora cinnamomi. Australian Journal of Botany 33, 409-18. http://dx.doi.org/10.1071/BT9850409 [ Links ]

Thompson S E, Levin S, and Rodriguez-Iturbe I. 2014. Rainfall and temperatures changes have confounding impacts on Phytophthora cinnamomi occurrence risk in the southwestern USA under climate change scenarios. Glob. Chang. Biol. 20 1299-1312. http://onlinelibrary.wiley.com/doi/10.1111/gcb.12463/abstract [ Links ]

Waterhouse G H. 1963 Key to the species of Phytophthora de Bary. Commonw Mycol. Inst. Kew. UK. 92 p. [ Links ]

White JCH, Bruns, TLee S, Taylor J W. 1990. Amplification and direct sequencing of fungal ribosomaol RNA genes for phylogenetics. P315-322 In: Innis, ma, Gel fand, D.H., Sninsky, J. J., White, J. J. PCR protocols A guide to methods and apllications. Eds. Academic Press, Inc., New York. Pp:315-322 [ Links ]

Zentmyer G A. 1952. Phytophthora cinnamomi on avocado in México and Costa Rica and others avocado diseases in México. Plant. Dis. Rep. 36: 31 p. [ Links ]

Zentmyer A G. 1980. Phytophthora cinnamomi and the diseases it causes. Monograh. 10 APS.Press. St. Paul, MN. USA. 96 pp. [ Links ]

Zentmyer G A, Mircetich S M.1966. Saprophytims and persistence in soil by Phytohthora cinnamomiPhythopathology 56:710-112. [ Links ]

Recibido: 13 de Octubre de 2015; Aprobado: 05 de Mayo de 2016

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons