Diarrheagenic Escherichia coli pathotypes isolated from a swine farm in a region of Morelos state, Mexico

Tamayo-Legorreta, Elsa; García-Radilla, Alejandro; Moreno-Vázquez, Eduardo; Téllez-Figueroa, Fabián; Alpuche-Aranda, Celia M; Tamayo-Legorreta, Elsa; García-Radilla, Alejandro; Moreno-Vázquez, Eduardo; Téllez-Figueroa, Fabián; Alpuche-Aranda, Celia M

doi:10.21149/11268

Servicios Personalizados

Revista

Articulo

Indicadores

Citado por SciELO
Accesos

Links relacionados

Similares en SciELO

Otros
Otros

Permalink

Salud Pública de México

versión impresa ISSN 0036-3634

Salud pública Méx vol.63 no.1 Cuernavaca ene./feb. 2021 Epub 15-Ago-2022

https://doi.org/10.21149/11268

Artículos originales

Diarrheagenic Escherichia coli pathotypes isolated from a swine farm in a region of Morelos state, Mexico

Patotipos diarreicos de Escherichia coli aislados de una granja porcina en una región del estado de Morelos, México

Elsa Tamayo-Legorreta⁽¹⁾

Alejandro García-Radilla⁽¹⁾

Eduardo Moreno-Vázquez⁽¹⁾

Fabián Téllez-Figueroa⁽¹⁾

Celia M Alpuche-Aranda⁽¹⁾

^⁽¹⁾ Centro de Investigación sobre Enfermedades Infecciosas, Instituto Nacional de Salud Pública. Cuernavaca, Morelos, Mexico.

Abstract:

Objective:

Determine the frequency of diarrheagenic Escherichia coli pathotypes colonizing swine.

Materials and methods:

E. coli strains isolated of fecal samples from 280 swine, produced for local consumption, in a semi-technical farm of Morelos state (central Mexico), were tested to identify the diarrheagenic E. coli pathotypes by multiplex PCR. Pulsed-field gel electrophoresis (PFGE) were determined for the study of genetic diversity between pathigenic E. coli strains.

Results:

Of the 521-diarrheagenic E. coli isolates examined, 50 (9.6%) were positive for at least one virulence gene in 42 different animals. Thus, 15% (42/280) of the swine in this farm were colonized with pathogenic E. coli. Among the E. coli isolates, the pathotype EPEC (6.5%) was the most frequently, followed by EHEC (2.3%), ETEC and EIEC (0.4%). The study of genetic diversity, carried out by PFGE of 40 representative isolates, revealed 25 distinct restriction profiles clustered in 21 groups (A-U).

Conclusions:

In this study, four different E. coli pathotypes were found among swine colonized by E. coli in this farm. Thus, these swine are reservoirs for these virulent bacteria and there is potential risk of causing diarrhea in swine and in the population consuming the meat.

Keywords: Escherichia; coli; diarrhea; swine; Mexico

Resumen:

Objetivo:

Determinar la frecuencia de patotipos diarreicos de Escherichia coli que colonizan cerdos.

Material y métodos:

Se analizaron cepas de E. coli aisladas de muestras fecales de 280 cerdos, producidas para consumo local, en una granja del estado de Morelos (centro de México) para identificar los patotipos diarreicos de E. coli por PCR multiplex. Se determinó la electroforesis en gel de campo pulsado (PFGE) para el estudio de la diversidad genética entre cepas patógenas de E. coli.

Resultados:

De los 521 aislados de E. coli con patotipos diarreicos examinados, 50 (9.6%) fueron positivos para al menos un gen de virulencia en 42 animales diferentes. Así, 15% (42/280 porcinos) fueron colonizados con E. coli patógeno. Entre los aislados de E. coli de porcinos, el patotipo EPEC (6.5%) fue el más frecuente, seguido por EHEC (2.3%), ETEC y EIEC (0.4%). El estudio de la diversidad genética, realizado por PFGE de 40 cepas representativas, reveló 25 perfiles de restricción distintos agrupados en 21 grupos (A-U).

Conclusiones:

En este estudio, se encontraron cuatro diferentes patotipos de E. coli entre los cerdos colonizados por E. coli. Estos cerdos son reservorios de estas bacterias virulentas y existe un riesgo potencial de causar diarrea en los cerdos y en la población que consume la carne.

Palabras clave: Escherichia; coli; diarrea; cerdos; México

Introduction

Diarrheal diseases are still among the main infectious diseases identified by the World Health Organization (WHO), as important public health problem worldwide, and is one of the causes of mortality in children under five years old. Escherichia coli is classified as a major bacterial diarrheagenic agent in developing countries and transmitted by consuming contaminated water or foods.¹^,² E. coli strains causing diarrhea can be grouped into six pathotypes according to the presence of virulence factors and pathogenicity mechanisms specifics: enteropathogenic E. coli (EPEC), enterohaemorrhagic E. coli (EHEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), and diffusely adhering E. coli (DAEC).³^,⁴^,⁵

EPEC contains an intimin (eae) gene, is the pathotype most associated with diarrhea in infants, and is sometimes associated with vomit and fever. EPEC is classified into typical and atypical strains depending upon on the presence eae gene and bfp A gene, which is on a plasmid 90-kb called ‘EPEC adherence factor’ (pEAF) that encodes type IV-like bundle-forming pili (BFP). Typical EPEC (tEPEC) strains are eae + and bfp A +, whereas atypical EPEC (aEPEC) strains are eae + bfp A−, because lack pEAF plasmid.⁶ EHEC, causing abdominal pain, bloody diarrhea and low fever, is the main etiologic agent associated with hemorrhagic colitis and hemolytic uremic syndrome (HUS), characterized by renal damage. This pathogen produces two types of Shiga toxins, sxt 1 and sxt 2.⁷^,⁸ ETEC pathogenicity is determined by the production of heat-stable (est) and labile-stable (elt) enterotoxins. ETEC is most common in children under two years of age, diarrhea may be accompanied by fever and sometimes vomiting, and is the main cause of traveler’s diarrhea.⁹ EIEC carries the gene for the invasive plasmid antigen H (ipaH), is important in six-month-old children, manifested with diarrhea with blood and mucus.¹⁰ EAEC harbors the transcriptional activator-encoding aat A gene, is a major cause of acute diarrhea in children and adults worldwide. DAEC possesses the afimbrial adhesin B (afaB) gene, and may play a role in causing sporadic diarrheal illnesses, particularly in pediatric patients.¹¹

Diarrheagenic E. coli (DEC) is one of the most important causes of post-weaning diarrhea in pigs. This diarrhea is responsible for significant economic losses due to mortality, morbidity, and decreased growth rate.¹² DEC strains in swine include EPEC, ETEC, and EHEC. ETEC infections are responsible for swine diarrhea and the severity of this infection has been associated to stress of weaning, lack of antibodies from the sow’s milk, and dietary changes.⁵ The objective of this study is to determine the frequency of these pathogenicity bacteria colonizing swine. A better understanding of the variety of virulence genes can provide us with important information for diagnosis and prevention of diarrheal diseases in swine, and potential transmission of these bacteria to human.

Materials and methods

Isolation and identification of E. coli

This is a transversal study based on sampling the total number of pigs in a semi-technical farm at Jiutepec, Morelos state, Mexico. This farm is dedicated to swine farming to medium scale where the swine production is for local consumption. In the range of March-April 2015, a stool sample was obtained in the total number of pigs present in the farm (280). Swine feces were collected directly in the anus by rectal swab. Rectal swabs were transported in Cary-Blair medium (DELTALAB, Spain) at 4°C., and MacConkey agar (MCD Lab, Mexico) was used for stool cultures, incubated at 37°C overnight. Three colonies with appearance of E. coli were randomly selected from each stool swabs. The identification of E. coli suggestive colonies was performed by biochemical tests, API 20E (Biomérieux, USA). API 20E strips were been incubated at 35°C for 18 h, and identified according to the manufacturer criteria for reading and interpretation.

Reference strains

A panel of E. coli reference strains was used as positive controls for the multiplex polymerase chain reaction (mPCR). Strains EPEC O127:H6 strain E2348/69 (eae and bfp A), EHEC O157:H7 (eae, stx 1, stx 2), ETEC O78:H11 strain H10407 (elt, est), EIEC O136:NM (ipaH), EAEC O44:H18 strain 042 (aggR), DAEC O75:H- strain E66438 (daa C) (kindly donated by Dr Carlos Eslava, National Autonomous University of Mexico) [Universidad Nacional Autónoma de México, UNAM]. E. coli ATCC 25922 strain served as a negative control for virulence genes in all PCRs. Bacteria were routinely spread on MacConkey agar (MCD Lab, Mexico), and incubated at 37°C overnight.

DNA extraction and multiplex PCR for virulence genes

The boiling method was used to extract bacterial DNA of each E. coli isolates.¹³ Here we describe a mPCR that simultaneously detects nine virulence genes associated with the six DEC pathotypes. The genes selected eae, stx 1, stx 2, elt, est, ipa H, aatA, daa C were amplified using 18 specific oligonucleotides (table I) including those to differentiate typical or atypical EPEC. The previously reported a mPCR reaction for DEC detection¹⁴ was adapted to three reactions multiplex PCR each one with six primers pairs to allow the simultaneous detection of three different virulence genes in each reaction mixture. The reaction I, for tEPEC, aEPEC, ETEC, containing eae (189 pb), pEAF (107 pb), elt (440 pb); reaction II, for ETEC, EAEC, EIEC, including est (191 pb), aat (152 pb), ipa H (619 pb); reaction III, for EHEC, DAEC, including sxt 1 (418 pb), sxt 2 (255 pb), daa (146 pb). Each 50 µ l reaction mixture contained the following: 1X reaction buffer (100 mM Tris/HCl, pH 8.5; 500 mM KCl, 1 % Triton X-100), 2 mM MgCl₂, 0.2 mM each dNTP (dNTP mix, 10 mM, Thermo Scientific, USA), 10 µ M each primer, 1.0 U Taq DNA polymerase (Thermo Scientific, USA), 5 µ l template DNA and nuclease-free water. The PCR conditions for all reactions were: 94 °C for 5 min, 30 cycles of 94°C for 45 s, 58°C for 45 s, and 72°C for 45 s; and a ﬁnal extension at 72°C for 7 min. mPCR-amplified fragments (5 µ l) were separated in a 1.7% (wt/vol) agarose gel and visualized under UV light after staining with ethidium bromide.

Table I: Primers used in the multiplex pcr for amplification of diarrheagenic E. coli isolated of a swine farm in Jiutepec, Morelos, Mexico, March-April 2015

Pathotype	Target gene	Primer name	Primer sequence (5’-3’)	Amplicón size (pb)	Annealing tem (°C)	Reference
EPEC	eae	eae F	ACTGGACTTCTTATTTCCGTTCTATG	189	58	[16]
		eae R	CCTAAACGGGTATAATCACCAGA
tEPEC	bfpA	pEAF F	GTTCTTGGCGAACAGGCTTGTC	107	58	[16]
		pEAF R	TTAAGCCAGCTACCATCCACCC
EHEC	stx-1	stx-1 F	AGTCGTACGGGGATGCAGATAAAT	418	58	[16]
		stx-1 R	CCGGACACATAGAAGGAAACTCAT
	stx-2	stx-2 F	GGCACTGTCTGAAACTGCCC	255	58	[16]
		stx-2 R	TCGCCAGTTATCTGACATTCTG
ETEC	elt	elt F	GGCGACAGATTATACCGTGC	440	58	[16]
		elt R	CGGTCTCTATATTCCCTGTT
	est	est F	ATTTTTMTTTCTGTATTRTCTT	191	58	[16]
		est R	CACCCGGTACARGCAGGATT
EIEC	ipaH	ipaH F	GTTCCTTGACCGCCTTTCCGATACCGTC	619	58	[16]
		ipaH R	GCCGGTCAGCCACCCTCTGAGAGTAC
EAEC	aat	aat F	AGGTTTGATAATGATGTCCTTGAGGA	152	58	[16]
		aat R	TCAGCTAATAATGTATAGAAATCCGCTGTT
DAEC	daa	daa F	ATTACGTCATCCGGGAAGCACACA	146	58	[16]
		daa R	GCTTGCTCATAAAGCCGCAGACAA

EPEC: enteropathogenic E. coli; tEPEC: Typical enteropathogenic E. coli; EHEC: enterohemorrhagic E. coli; ETEC: enterotoxigenic E. coli; EIEC: enteroinvasive E. coli; EAEC: enteroaggregative E. coli; DAEC: diffusely adhering E. coli.

Pulsed-field gel electrophoresis

All MDR strains were genotyped using pulsed-field gel electrophoresis (PFGE).¹⁵^,¹⁶ Brieﬂy, genomic DNA was isolated in an agarose-embedded formand was subjected to enzymatic digestion with 50 U XbaI. Agarose digests were then placed in preformed wells of an agarose gel and separated by electrophoresis in the 0.5X TBE buffer using a CHEF Mapper system (Bio-Rad Laboratories,Inc.). After 23 h, gels were stained with ethidium bromide and PFGE patterns were visualized under UV light. Salmonella serotype Braenderup strain (H9812) was used as the global reference standard and Lambda PFG ladder (New England BioLabs Inc. USA) was used as a size marker. Patterns PFGE were interpreted using Tenover criteria¹⁷ and analyzed with BioNumerics 5.10 software (Applied Maths, Sint-Martens-Latem, Belgium). A dendrogram was constructed using the Dice similarity coefficient, a tolerance coefficient, and un-weighted pair group methods with the arithmetic mean algorithm (UPGMA).

The study protocol was approved by the ethics, research, and biosafety committees of National Institute of Public Health (Instituto Nacional de Salud Pública, INSP). Written informed consent was requested from the owner of the participant farm in this study.

Results

Of the 521 E. coli strains identified in this study, 50 (9.6%) strains isolated of 42 different animals were positive for at least one pathogenicity marker (table I). The highest frequency was observed in EPEC (6.5%), followed by EHEC (2.3%) (figure 1). EIEC and ETEC were the least frequent pathotypes among E. coli-positive samples (0.4%). We did not obtain EAEC and DAEC pathotypes. In order of distribution of virulence genes, the most frequent identified included eae and sxt 1 genes with a frequency of 6.5 and 1.3%, respectively. The lowest frequent virulence genes included ipa H and elt, each having a frequency of less than 1% (table II). We did not obtain amplicons for the bfp B, est, aat A and daa C genes. All EPEC strains were atypical because possess theeae gene but lack bfp A gene located in plasmid pEAF (figure 2).

Table II: Prevalence of six E. coli pathotypes and their virulence genes in a swine farm from Jiutepec, Morelos, Mexico, March-April 2015

Pathotype	Virulence genes	n	Frequency in E. coli-positive samples %*
EPEC	eae	34	6.5
EHEC	sxt1	7	1.3
	sxt2	5	1.0
ETEC	elt	2	0.4
EIEC	ipaH	2	0.4
EAEC	aat	0	0.0
DAEC	daa	0	0.0
Total		50	9.6

^*Frequency is calculated by dividing the numbers to the total number of E. coli-positive strains identified in sampling (N= 521).

EPEC: enteropathogenic E. coli; EHEC: enterohemorrhagic E. coli; ETEC: enterotoxigenic E. coli; EIEC: enteroinvasive E. coli; EAEC: enteroaggregative E. coli; DAEC: diffusely adhering E. coli.

DEC: diarrheagenic E. coli; EPEC: enteropathogenic E. coli; EHEC: enterohemorrhagic E. coli; ETEC: enterotoxigenic E. coli; EIEC: enteroinvasive E. coli; EAEC: enteroaggregative E. coli; DAEC: diffusely adhering e. coli.

Figure 1: Prevalence of diarrheagenic E. coli detected in feces samples. Jiutepec, Morelos, Mexico, March-April 2015

Figure 2: Multiplex polymerase chain reaction (mPCR) analysis of three representative atypical E. coli (aEPEC) strains. Agarose gel electrophoresis of mPCR reaction showing presence of eae and bfpA genes. Lane 1, molecular size marker (100 pb DNA ladder); lane 2, negative control; lane 3, enteropathogenic E. coli (EPEC) strain e2348/69 positive control (eae gene= 189 bp and bfp gene= 107 bp); lane 4-6 swine samples with eae gene. Jiutepec, Morelos, Mexico, March-April 2015

Age-specific prevalence of E. coli pathotypes

The highest frequency of pathogenic E. coli infections was observed in suckling and weaned piglets (14.8 and 12.6%, respectively). EPEC was highly frequent in suckling (12%) and weaned (9.8%). EHEC had a very similar infection frequency in both types of piglets (2.8%). Although the frequency of EPEC and EHEC was higher in piglets, these pathotypes were also common in faecal samples of adult females and males. While EIEC and ETEC only appeared in adult females (table III).

Table III: Age-specific frequency of E. coli pathotypes in 521 strains isolated from 275 swines faecal samples in a farm from Jiutepec, Morelos, Mexico, March-April 2015

Age group	All pathotypes	EPEC	EHEC	ETEC	EIEC	EAEC	DAEC	Total strains
Age group	n (%)	n (%)	n (%)	n (%)	n (%)	n (%)	n (%)	N
Suckling piglets (14-21 days)	16 (14.8)	13 (12)	3 (2.8)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	108
Weaning piglets (>21 days)	22 (12.6)	17 (9.8)	5 (2.9)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	174
Sow (gender)	11 (4.7)	4 (1.7)	3 (1.3)	2(0.9)	2(0.9)	0 (0.0)	0 (0.0)	233
Boar (gender)	1(16.7)	0 (0.0)	1(16.7)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	6
Total	50 (9.6)	34 (6.5)	12 (2.3)	2 (4)	2 (4)	0 (0.0)	0 (0.0)	521

EPEC: enteropathogenic E. coli; EHEC: enterohaem orrhagic E. coli; EIEC: enteroinvasive E. coli; ETEC: enterotoxigenic E. coli.

Genetic diversity of diarrheagenic E. coli strains. PFGE was conducted to determine the clonal-relatedness among diarrheagenic E. coli strains from swine. A representative group of 40 pathogenic E. coli strains, randomly selected of the 50 E. coli strains included in the study, was analyzed by PFGE. The PFGE results showed 25 different pulsotypes that is showed in the similarity dendogram (figure 3), where it is noted a high polymorphism considering as significative a diference of a single band. In the dendogram produced by UPGMA algorithm, the isolates were clustered in 21 clones (A to U, 1 to 16 isolates per clone) of 80% similarity according to the Dice similarity index, with 21 isolates clustering in two clones of closely related (similarity >95%) PFGE profiles. The highest homogeneity (similarity >95%) was observed among a group of 16 isolates (clone A) belonging to pathotype EPEC and a group of five isolates (clone G) with pathotype EHEC (figure 3). The remaining patterns were associated with different enteropathotypes (EPEC, EHEC, ETEC and EIEC).

Figure 3: Dendrogram generated by bionumeric software, showing distance calculated by the dice similarity index of pfge X ba I profiles among 40 diarrheagenic e. coli strains isolated from a swine. the degree of similarity (%) is shown on the scale. jiutepec, morelos, mexico, march-april 2015

Discussion

Suckling and post-weaning diarrheal (PWD) disease affecting pigs during the first weeks after birth result in significant economic losses for the pig industry due to mortality and decreased weight gain.¹⁸^,¹⁹^,²⁰ However, none of the animals colonized with these diarrheagenic E. coli presented diarrhea in the sampling period of this study maybe due to the limitation of a descriptive-transversal study in the farm.

Most samples (76%) were obtained from pigs during suckling and weaning period, and showed to be significantly associated with EPEC (6.5%, 34/521), which was the most frequent pathotype in our study. This is consistent because porcine EPEC is the second type of pathogenic E. coli involved in PWD.²¹ These results are compared to two studies in swine, where only 3.9% (8/206) and 3.3% (15/455) of pathogenic E. coli isolates were carriers of the eae gene.²²^,²³ In another study on the prevalence of virulence genes in E. coli of pigs in Mexico, the frequency of the eae gene was 18.3%.²¹

The estimated frequency for EHEC pathotype was 2.3%, where E. coli strains isolated from swine fecal samples were positive for the stx 1 and sxt 2 genes with an average rate of 1% for both genes. Our results confirm the observation made by other authors that pigs, mainly piglets, are not a potential EHEC reservoir.²⁴ A study conducted in Mexico identified Shiga toxins (sxt 1 and sxt 2) with a frequency of 0.4 and 1% respectively in suckling piglets and weaned.²¹ Another study in northern Italy showed that EHEC strains were present in 7.8% (19/242) of faecal samples obtained from healthy pigs.²⁵^,²⁶ In addition to these two types of diarrheagenic E. coli (EPEC and EHEC), EIEC and ETEC showed a frequency of less than 1%. Although, ETEC is reported as the most important of enteric colibacillosis in pigs, mainly in suckling and weaned piglets. However, the distribution and frequency of the pathologies and virulence genes can vary considerably from one region to another.²¹^,²⁷

The frequency of different pathotypes was variable in this study. EPEC and EHEC were found more frequently in suckling and weaned piglets. This can be explained because piglets in this period lack maternal immunity, which may make them non-immune to pathogenic E. coli. In the same way, the variation in environmental temperature and the stress associated with changes in both accommodation and diet may be important factors that trigger the proliferation of pathogenic E. coli in the intestine.²³^,²⁴^,²⁸ The presence of Shiga toxins in the population of E. coli isolates studied indicates a risk among these strains because E. coli strains that possess sxt 2 are potentially more virulent than those with sxt 1. It should be noted that most EHEC associated with HUS produce sxt 2 and rarely sxt 1.²⁹

On the other hand, none of the EPEC strains analyzed presented the plasmid pEAF, which codes for virulence factors that allow the bacteria to adhere locally, so all EPEC strains were atypical EPEC (aEPEC). Studies of EPEC strains from animals have found that none of the isolates contain the plasmid (aEPEC) and that it is only found in human strains (typical EPEC, tEPEC).⁶^,³⁰^,³¹ In studies to determine the frequency of tEPEC and aEPEC, it has been observed that aEPEC is the most frequent. It is know that when a community begins to develop better distribution systems for drinking water and drainage, a transition occurs and atypical strains begin to be more frequent.³² We might think this is happening in the community studied, so it is an urban environment that has relatively well-established drinking water and drainage systems, since all EPEC strains isolated from farm animals were atypical.

To better understand the genetic relatedness of these pathogenic E. coli isolates, PFGE were performed. It has been shown that animal pathogenic E. coli strains share common genetic backgrounds.²³ Pulsed-field gel electrophoresis demonstrated that EPEC and EHEC isolates from swine tend to be closely related.³³^,³⁴ This is consistent with our results; however also we found that PFGE patterns were heterogeneous among EPEC, EHEC, ETEC, EIEC strains. Taken together, our data suggest that PFGE patterns of diarrheagenic E. coli are not highly correlated with pathotype. This very interesting finding confirms the presence in Mexico of different clones among one of the most prevalence pathotypes isolated from swine.

Conclusion

In this study were identified four E. coli pathotypes among swine colonized by these bacteria. Thus, these swine are potential reservoirs of EPEC, but not of EHEC and ETEC. Pulsotypes analysis showed that, although isolates with the same virulence markers share the same PFGE group, there is a high genetic variation, among EPEC, EHEC, ETEC and EIEC. The findings of our study are important for public health and veterinary medicine because there is a potential risk of causing diarrhea on swine and in the population consuming the meat.

Acknowledgement

This investigation was supported by Consejo Nacional de Ciencia y Tecnología (Grant 215146). The authors thank Dr. Hugo Lopez-Gatell (currently in under-Secretary of Health Prevention and Promotion) for his support the development of the model, and Dr. Carlos Eslava (UNAM) for providing us the pathogen E. coli control strains. We also thank Rosa Medina Julián, Fátima Hernández and Fernando Mariscal, as well as the Health Services of Morelos and its personnel for their excellent technical assistance.

References

Da Silva GJ, Mendonça N. Association between antimicrobial resistance and virulence in Escherichia coli. Virulence. 2012;3(1):18-28. https://doi.org/10.4161/viru.3.1.18382 [ Links ]

Farfán-García AE, Ariza-Rojas SC, Vargas-Cárdenas FA, Vargas-Remolina LV. Mecanismos de virulencia de Escherichia coli enteropatógena. Rev Chil Infectol. 2016;33(4):438-50. https://doi.org/10.4067/S0716-10182016000400009 [ Links ]

Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2(2):123-40. https://doi.org/10.1038/nrmicro818 [ Links ]

Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11(1):142-201. https://doi.org/10.1128/CMR.11.1.142 [ Links ]

Bosák J, Hrala M, Pirková V, Micenková L, Cízek A, Smola J, et al. Porcine pathogenic Escherichia coli strains differ from human fecal strains in occurrence of bacteriocin types. Vet Microbiol. 2019;232:121-27. https://doi.org/10.1016/j.vetmic.2019.04.003 [ Links ]

Trabulsi LR, Keller R, Tardelli TA. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8(5):508-13. https://doi.org/10.3201/eid0805.010385 [ Links ]

Singh P, Sha Q, Lacher DW, Del Valle J, Mosci RE, Moore JA, et al. Characterization of enteropathogenic and Shiga toxin-producing Escherichia coli in cattle and deer in a shared agroecosystem. Front Cell Infect Microbiol. 2015;5(29):1-13. https://doi.org/10.3389/fcimb.2015.00029 [ Links ]

Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med. 1983;308(12):681-5. https://doi.org/10.1056/NEJM198303243081203 [ Links ]

Cabal A, García-Castillo M, Cantón R, Gortázar C, Domínguez L, Álvarez J. Prevalence of Escherichia coli virulence genes in patients with diarrhea and a subpopulation of healthy volunteers in Madrid, Spain. Front Microbiol. 2016;7:641. https://doi.org/10.3389/fmicb.2016.00641 [ Links ]

Sunabe T, Honma Y. Relationship between O-serogroup and presence of pathogenic factor genes in Escherichia coli. Microbiol Immunol. 1998;42(12):845-49. https://doi.org/10.1111/j.1348-0421.1998.tb02360.x [ Links ]

Wang L, Zhang S, Zheng D, Fujihara S, Wakabayashi A, Okahata K, et al. Prevalence of diarrheagenic Escherichia coli in foods and fecal specimens obtained from cattle, pigs, chickens, asymptomatic carriers, and patients in Osaka and Hyogo, Japan. Jpn J Infect Dis. 2017;70(4):464-69. https://doi.org/10.7883/yoken.JJID.2016.486 [ Links ]

Fairbrother JM, Nadeau E, Gyles CL. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim Health Res Rev. 2005;6(1):17-39. https://doi.org/10.1079/ahr2005105 [ Links ]

Al-Gallas N, Bahri O, Bouratbeen A, Ben-Haasen A, Ben Aissa R. Etiology of acute diarrhea in children and adults in Tunis, Tunisia, with emphasis on diarrheagenic Escherichia coli: prevalence, phenotyping, and molecular epidemiology. Am J Trop Med Hyg. 2007;77(3):571-82. https://doi.org/10.4269/ajtmh.2007.77.571 [ Links ]

Souza T, Lozer D, Kitagawa S, Spano L, Silva N, Scaletsky I. Real-time multiplex PCR assay and melting curve analysis for identifying diarrheagenic Escherichia coli. J Clin Microbiol. 2013;51(3):1031-3. https://doi.org/10.1128/JCM.02478-12 [ Links ]

Kaufmann ME. Pulsed-field gel electrophoresis. Methods Mol Med. 1998;15:33-50. https://doi.org/10.1385/0-89603-498-4:33 [ Links ]

Centers for Disease Control and Prevention. Standard operating procedure for PulseNet PFGE of Escherichia coli O157: H7, Escherichia coli non-O157 (STEC), Salmonella serotypes, Shigella sonnei and Shigella flexneri. Atlanta: Centers for Disease Control and Prevention, 2013. [ Links ]

Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33(9):2233-9. [ Links ]

Luppi A. Swine enteric colibacillosis: diagnosis, therapy and antimicrobial resistance. Porc Health Manag. 2017;3:16. https://doi.org/10.1186/s40813-017-0063-4 [ Links ]

Matías J, Berzosa M, Pastor Y, Irache JM, Gamazo C. Maternal Vaccination. Immunization of Sows during Pregnancy against ETEC Infections. Vaccines (Basel). 2017;5(4):48. https://doi.org/10.3390/vaccines5040048 [ Links ]

Melkebeek V, Goddeeris BM, Cox E. ETEC vaccination in pigs. Vet Immunol Immunopathol. 2013;152(1-2):37-42. https://doi.org/10.1016/j.vetimm.2012.09.024 [ Links ]

Toledo A, Gómez D, Cruz C, Carreón R, López J, Giono S, et al. Prevalence of virulence genes in Escherichia coli strains isolated from piglets in the suckling and weaning period in Mexico. J Med Microbiol. 2012;61(1):148-56. https://doi.org/10.1099/jmm.0.031302-0 [ Links ]

Liu W, Yuan C, Meng X, Du Y, Gao R, Tang J, Shi D. Frequency of virulence factors in Escherichia coli isolated from suckling pigs with diarrhoea in China. Vet J. 2014; 199(2): 286-9. https://doi.org/10.1016/j.tvjl.2013.11.019 [ Links ]

Yang GY, Guo L, Su JH, Zhu YH, Jiao LG, Wang JF. Frequency of Diarrheagenic Virulence Genes and Characteristics in Escherichia coli Isolates from Pigs with Diarrhea in China. Microorganisms. 2019;7(9):308. https://doi.org/10.3390/microorganisms7090308 [ Links ]

Vu Khac H, Holoda E, Pilipcinec E, Blanco M, Blanco J E, Mora A, et al. Serotypes, virulence genes, and PFGE profiles of Escherichia coli isolated from pigs with postweaning diarrhoea in Slovakia. BMC Vet Res. 2006;2:10. https://doi.org/10.1186/1746-6148-2-10 [ Links ]

Caprioli A, Nigrelli A, Gatti R, Zavanella M, Blando AM, Minelli F, et al. Characterization of verocytotoxin-producing Escherichia coli isolated from pigs and cattle in northern Italy. Vet Rec. 1993;133(13):323-24. https://doi.org/10.1136/vr.133.13.323 [ Links ]

DesRosiers A, Fairbrother JM, Johnson RP, Desautels C, Letellier A, Quessy S. Phenotypic and genotypic characterization of Escherichia coli verotoxin-producing isolates from humans and pigs. J Food Prot. 2001;64(12):1904-11. https://doi.org/10.4315/0362-028x-64.12.1904 [ Links ]

Li S, Wang L, Zhou Y, Miao Z. Prevalence and characterization of virulence genes in Escherichia coli isolated from piglets suffering post-weaning diarrhoea in Shandong Province, China. Vet Med Sci. 2019;6(1):1-7. https://doi.org/10.1002/vms3.207 [ Links ]

Barman N, Deb R, Ramamurthy T, Sharma RK, Borah P, Wani SA, Kalita D. Molecular characterization of shiga like toxin-producing Escherichia coli (STEC) isolates from pigs oedema. Indian J Med Res. 2008;127(6):602-06. [ Links ]

Tahamtan Y, Hayati M, Namavari MM. Prevalence and distribution of the stx1, stx2 genes in Shiga toxin producing E. coli (STEC) isolates from cattle. Iran J Microbiol. 2010;2(1):8-13. [ Links ]

Watson VE, Jacob ME, Flowers JR, Strong SJ, DebRoy C, Gookin JL. Association of Atypical Enteropathogenic Escherichia coli with Diarrhea and Related Mortality in Kittens. J Clin Microbiol. 2017;55(9):2719-35. https://doi.org/10.1128/JCM.00403-17 [ Links ]

Malik A, Nagy B, Kugler R, Szmolka A. Pathogenic potential and virulence genotypes of intestinal and faecal isolates of porcine post-weaning enteropathogenic Escherichia coli. Res Vet Sci. 2017;115:102-8. https://doi.org/10.1016/j.rvsc.2017.02.002 [ Links ]

Zhou Y, Zhu X, Hou H, Lu Y, Yu J, Mao L, et al. Characteristics of diarrheagenic Escherichia coli among children under 5 years of age with acute diarrhea: a hospital-based study. BMC Infect Dis. 2018;18(1):63. https://doi.org/10.1186/s12879-017-2936-1 [ Links ]

Vu Khac H, Holoda E, Pilipcinec E, Blanco M, Blanco JE, Mora A, et al. Serotypes, virulence genes, and PFGE profiles of Escherichia coli isolated from pigs with postweaning diarrhoea in Slovakia. BMC Vet Res. 2006;2:10. https://doi.org/10.1186/1746-6148-2-10 [ Links ]

Tseng M, Fratamico PM, Bagi L, Delannoy S, Fach P, Manning SD, Funk JA. Diverse virulence gene content of Shiga toxin-producing Escherichia coli from finishing swine. Appl Environ Microbiol. 2014;80:6395-402. https://doi.org/10.1128/AEM.01761-14 [ Links ]

Received: February 21, 2020; Accepted: June 24, 2020; Published: October 06, 2020

Corresponding author: Dra. Celia Mercedes Alpuche Aranda. Centro de Investigación sobre Enfermedades Infecciosas, Instituto Nacional de Salud Pública. Av. Universidad 655, col. Santa María Ahuacatitlán. 62100 Cuernavaca, Morelos, Mexico. email: celia.alpuche@insp.mx

Declaration of conflict of interests. The authors declare that they have no conflict of interests.

This is an open-access article distributed under the terms of the Creative Commons Attribution License