My SciELO
Services on Demand
article
Indicators
Cited by SciELO
Access statistics
Related links
Similars in SciELO
Bookmark
Salud Pública de México
Print version ISSN 0036-3634
Salud pública Méx vol.54 no.2 Cuernavaca Mar./Apr. 2012
CARTAS AL EDITOR
Incidence of positive DNA from Cytomegalovirus, Human Parvovirus B19 and Hepatitis B virus, at birth
Víctor Javier Lara-Díaz, MC, M CMyBI,II; Víctor Arízaga-Ballesteros, MCI; Adriana Garrido-Rodríguez, MCIII,IV; Rolando Ruiz-de la Garza, MCIII,IV; Jorge Eugenio, Moreno-Cuevas, MC, D en C.I,II
ICátedra de Terapia Celular, Programa Multicéntrico de Neonatología, Areas de Investigación e Innovación y Posgrado, Escuela de Medicina y Ciencias de la Salud, ITESM. Monterrey, México
IISecretaría de Salud. Monterrey, Nuevo León, México
IIIServicios de Salud del Estado de Nuevo León. México
VIHospital Metropolitano Bernardo Sepúlveda, Servicio de Neonatología
To the editor: Hepatitis B virus (HBV), Human Parvovirus B19 (PVB19) and Cytomegalovirus (CMV), all DNA virus, can produce perinatal infection. HBV prevalence in North America, Northern Europe and Oceania is 0.1%.1 PVB19 prevalence of IgG antibodies in children is 2 to 15%.2 Congenital CMV occurs in 1:100 live births; up to 85% of those congenitally infected have no symptoms at birth.3 In Mexico, the incidence of HBV, CMV and PVB19 DNA positivity in cord blood is not known. For these reasons, we performed a cross-sectional study, to establish the incidence of positivity of these viruses DNA in umbilical cord blood of infants born from July to September, in two consecutive years, 2008 and 2009, at Hospital Metropolitano Dr. Bernardo Sepulveda, a public facility in the metropolitan area of Monterrey, Nuevo León, in the northeast of Mexico, serving middle and low-class population. For each mother we recorded demographic data, and for neonates we recorded gender, birth weight, and gestational age. This study was approved by the institutional Ethics and Research Commissions.
Venous blood was drowned from the umbilical cord immediately after birth. DNA extraction was performed with the Maxwell 16 Blood DNA purification kit (Promega Cat#AS1010), and the Maxwell 16 Instrument (Promega Cat#AS1000), within 72 hours after obtaining the sample, which were identified and preserved at -20ºC, and then taken to DNA amplification, by the polymerase chain reaction (PCR) technique,4 with further electrophoresis in 2% agarose gel, with 0.5 µg/mL ethidium bromide added as a DNA intercalation dye.
For HBV, we used Hepatitis B Virus Kit, Core antigen primer set, 433 base pairs (bp), HBV Maxim Biotech, cat SP-10262; for CMV we used Major Immediately early gene primer set, 435 bp, Maxim Biotech Cytomegalovirus, cat SP-10133; for PVB19 we designed primers to obtain a product length of 162 bp Forward 1 TTTCCCCAATAAAGGAACCC 20, Tm 59.99ºC, GC 45%, 4479-4498 , reverse 1 CCTCCTAAGGCTGCAAACTG 20, Tm 60.01ºC, GC 55%, 4640-4621, directed against VP2 region, according to genomic sequence at GenBank accession number AF162273.1. As internal quality control for genomic DNA we included constitutive protein human β-globin, which yielded a 280 bp band. Detection (positive) of viral DNA was defined as the presence of a band of equal size to the positive control in electrophoresis, 433 bp for HBV; 435 bp for CMV, and 162 bp for PVB19.
During the study period, 8270 neonates were delivered; 392 infants met inclusion criteria and 379 samples were analyzed. Observed incidence was: CMV, seven cases in 379 samples (1.8%); PVB19, one positive in 379 (0.26%), and no positive sample for HBV. All cases were asymptomatic. Electrophoresis gels of positives are shown in Figure 1. CMV positivity was associated with younger maternal age (19.0 ± 4.6 versus 23.3 ± 6.1 years; mean ± SD, T test, p <0.05) and lower birth weight (2970 ± 248 versus 3205 ± 538 grams; mean ± SD, T test, p <0.05); CMV and PBV19 positives were associated with lower birth weight (2991 ± 236 versus 3205 ± 538 grams; mean ± SD, T test, p <0.04). To our knowledge, this is the first report of viral DNA in cord blood from Mexican infants, with nucleic-acid based techniques.
References
1. Chang MH. Hepatitis B virus infection. Semin Fetal Neonatal Med 2007;12:160-167. [ Links ]
2. Anderson L, Tsou C, Parker R, Chorba T, Wulff H, Tattersall P, et al. Detection of antibodies and antigens of human parvovirus B19 by enzyme-linked immunosorbent assay. J Clin Microbiol 1986;24:522-526. [ Links ]
3. Malm G. Congenital cytomegalovirus infections. Semin Fetal Neonatal Med 2007;12(3):154-159. [ Links ]
4. Kovacs B, Carlson D, Shahbahrami B, Platt L. Prenatal diagnosis of human parvovirus B19 in nonimmune hydrops fetalis by polymerase chain reaction. Am J Obstet Gynecol 1992;167:461-466. [ Links ]












