Mi SciELO
Servicios Personalizados
Artículo
Indicadores
Citado por SciELO
Accesos
Links relacionados
Similares en SciELO
Bookmark
Revista de investigación clínica
versión impresa ISSN 0034-8376
Rev. invest. clín. v.58 n.4 México jul./ago. 2006
Artículo original
Molecular characterization of the SEA alpha thalassemia allele in Mexican patients with HbH disease
Caracterización molecular del alelo SEA de talasemia alfa en pacientes mexicanos con enfermedad por HbH
Maria Paulina Nava,* ** Jorge Martin Trejo,*** Carlos AguilarLuna,**** Patricio BarrosNúñez,*** Ma. de la Luz Chávez,* ** María Teresa Magaña,* ** Javier Perea,* ** Bertha Ibarra*
* División de Genética del Centro de Investigación Biomédica de Occidente, CMNO, IMSS.
** Universidad de Guadalajara.
*** Hospital de Pediatría, CMN Siglo XXI.
**** Hospital de Pediatría CMNO, IMSS.
Correspondence and reprint request:
Bertha Ibarra MSc
División de Genética, CIBO, CMNO, IMSS,
Sierra Mojada No. 800, Col. Independencia,
44340, Guadalajara, Jal.
Fax: +52 33 3618 1756.
Email address: bibarra@mail.udg.mx
Recibido el 8 de noviembre de 2005.
Aceptado el 18 de abril de 2006.
ABSTRACT
αThalassemia is one of the most prevalent hemoglobin disorders in the world, in SouthEast Asians, theSEA allele is widely found in the HbH disease patients. The purpose of this work is to describe the molecular characteristics of Hemoglobin H disease in three patients from two Mexican families, as well to analyze the DNA sequence of the SEA allele to determine the precise site of the crossover. The α3.7 and SEA alleles were identified using an established longPCR method modified in our laboratory. The crossover site of SEA mutation was analyzed by DNA sequencing. The three HbH subjects showed the same genotype α3.7/SEA. The α3.7 allele has been observed in almost every racial studied group, whereas the SEA allele is predominant in SouthEast Asian countries. DNA analysis through the breakpoint sites of the SEA allele in both families showed the 5' breakpoint at the third base of codon 28 in the ψα2 gene and the 3' breakpoint within an AluJo sequence, 1,328 nucleotides upstream of the 3'HVR. Therefore the size of the deletion is 19,303 nucleotides. This is the first report in which the flanking deletion sites of theSEA mutation have been analyzed in Mexican patients, the 5' and 3' ends of the deletion is well determined.
Key words. αThalassemia. Hemoglobin H disease, α3.7 deletion. SEA deletion.
RESUMEN
La Talasemiaα es uno de los desórdenes de la hemoglobina más prevalences en el mundo. En el sureste de Asia, SEA es el alelo más frecuente en pacientes con enfermedad por HbH (EHbH). En el presente trabajo se describen las características moleculares de tres pacientes con EHbH de dos familias mexicanas, y se analiza la secuencia de DNA del alelo SEA, para determinar los sitios de ruptura. Los alelos α3.7y SEA se identificaron por un método de PCR modificado en nuestro laboratorio y los sitios de ruptura por secuenciación de DNA. Los tres pacientes con EHbH mostraron el genotipo a3.7/SEA. El alelo α3.7 está ampliamente distribuido en el mundo, mientras que el aleloSEA predomina en los países del sureste de Asia. El análisis de DNA del aleloSEA mostró en 5' el sitio de ruptura en el codón 28 del pseudogén ψα2 y en 3', dentro de la secuencia AluJo, localizada a 1,328 nucleótidos de la región HVR3', lo que da un segmento delecionado de 19,303 nucleótidos. Éste es el primer reporte en el que se analizan los sitios que flanquean la deleción del alelo SEA en pacientes mexicanos y se definen con precisión los extremos 5' y 3' de la deleción.
Palabras clave. Talasemiaα. Enfermedad por hemoglobina H. Deleción α3.7. Deleción SEA
INTRODUCTION
αThalassemia (αthal) is one of the most prevalent hemoglobin disorders in the world. It is caused by deletions of variable length or point mutations in one (αthal2) or both αthal genes (αthal1).1 To date, more than 60 mutations have been reported.2
Hemoglobin H (HbH) disease is one of the αthal syndromes, characterized by chronic hemolytic anemia and a clinical picture of thalassemia intermedia. The disease generally results when the total output of a genes is equivalent to one functional gene, because of the interaction between the αthal1 and αthal 2 alleles. The loss of three genes causes a severe imbalance in the production of globin chains leading to an excess of β globins and the formation of the homotetramer designated HbH (P4).3
HbH disease is found widely in SouthEast Asians and some Middle Eastern and Mediterranean populations. Its prevalence has been associated with malaria. The frequency of αthal2 is rarely less than 10% in malarial regions and in some populations it is over 80% (Nepal, India, and Papua New Guinea). It has been observed in almost every ethnic group studied, with low frequencies outside tropical and subtropical regions. The αthal1 has a limited geographical distribution, and is found primarily in malarial regions of SouthEast Asia and the Mediterranean region.4 The SEA deletion is approximately 19.3 kb in length, and involves the removal of the 81, a2, and al genes and the ψα2 and ψαl pseudogenes in cis. It has been found in Thai, Filipino, Vietnamese, and Chinese populations .5 With population migrations in recent decades, αthalassemias of clinical significance are now encountered in several other regions of the world.3
HbH disease was first reported in Mexico in 1977 in a mestizo family from Guerrero state located on the western coast.6 Two additional cases were later reported and characterized at the molecular level: one with the α3.7/ SEA genotype and the other with αHphα/FIL, together comprising three deletional alleles and one point mutation allele.7 The relative frequency of the α3.7 type 1 allele in selected Mexican populations by the presence of microcytosis, is 11%.8
We describe here three subjects with HbH disease from two Mexican families, with the same genotype, α3.7/ SEA. We analyzed the DNA sequence of the SEA allele determine the precise site of the crossover.
MATERIAL AND METHODS
Patients
We studied 10 subjects from two unrelated Mexican mestizo families with HbH disease. The index cases of the first family were 12yearold dizygotic twins (a boy, subject 1, and a girl, subject 2) presenting anemia, microcytosis, hypochromia, and slight splenomegaly from one year of age. The parents were born in Acapulco, Guerrero state, of unknown nonMexican ancestries. Patient 3 was a 10yearold boy, born in Puerto Vallarta. He developed hemolytic anemia of unknown etiology at the age of six years. The father was of Chinese ancestry through one of his grandfathers.
About 10 mL of venous blood was collected from each individual with EDTAanticoagulant to determine the hematological and biochemical parameters, and to extract genomic DNA.
Hematological and biochemical tests
Red blood cell indices were determined using an ABXPENTRA 120 analyzer (ABX Diagnostics, Montpellier, France). Levels of HbA2 and fetal Hb (HbF), hemoglobin electrophoresis, and stability tests were evaluated by conventional methods.9 Inclusion bodies in erythrocytes were demonstrated using the enriched reticulocyte method with methylene blue staining.10 HbH was quantified by densitometry of electrophoretic separations on a neutral cellulose acetate system with the EDAS program (Electrophoresis Documentation and Analysis System, Kodak Scientific Company).
DNA studies
Genomic DNA was isolated from leukocytes using the saltingout extraction method.11 The alleles SEA and α3.7 were identified by multiplex long polymerase chain reaction (PCR) amplification.12 The primers were designed using the Oligo 4.0 program. For SEA the primers used were 5CTCTGTGTTCTCAGTÁTTGGAGGGAAGGAG3' (GenBank 2612926158) and 5ATATATGGGTCTGGAAGTGTATCCCTCCCA3' (GenBank 31483177). For α3.7, the primers were 5CCCTCCCCCTCGCCAAGTCCACCC C3' (GenBank 3274132765) and 5GGGGGGAGGCCCAAGGGGCAAGAA3' (GenBank 3829638320). After 10 min at 95 °C, PCR reactions for both alleles were subjected to 30 cycles of amplification: the first 10 cycles of 1.5 min denaturation at 96 °C, 45 s annealing at 58 °C (63 °C for α3.7), and 5 min extension at 72 °C; for the next 20 cycles, the extension time was increased by 20 s after each cycle.
TheSEA allele was sequenced using an ABIPRISM 310 Genetic Analyzer and BigDyeTM Terminators version 3.0 DNA sequencing reagents (Applied Biosystems, Foster City, CA, USA). Genomic template DNA (100 ng) was amplified for 35 cycles under the conditions specified with the kit: each cycle consisted of 3 min at 94 °C, 30 s at 94 °C, 30 s at 58 °C, and 1 min at 72 °C, finishing with 3 min at 72 °C. Besides the analysis of the two families, we also included DNA samples from a third Mexican family known to carry theSEA mutation.
RESULTS
The subjects' hematological and biochemical parameters are summarized in Table 1. Inclusion bodies were observed in all three subjects, together with a normal iron status. Mild anemia, with microcytosis and low HbA2 levels, was present in the three patients. Both dizygotic twins showed a mean corpuscular volume (MCV) lower than that of subject 3, suggesting the involvement of other unknown genetic or environmental factors. All three subjects showed the α3.7 /SEA genotype.
DNA sequencing of the SEA allele in the three families showed that the 5' breakpoint is in the third base of codon 28 of the ψα2 gene and the 3' breakpoint lies within an AluJo sequence, 1,328 nucleotides upstream of the 3'HVR. Therefore the size of the deletion is 19,303 nucleotides (Figure 1).
The α3.7 allele found in both families is the commonest αthal2 deletional allele described worldwide, whereas the SEA allele in the second family clearly came to Mexico through the father's Chinese ancestors. Its origin in the first family is unknown.
DISCUSSION
Although HbH disease is usually considered benign, there is marked phenotypic variability, ranging from asymptomatic to severe anemia with hemolysis and hepatosplenomegaly, depending on the αthal genotype.3 All three subjects described here had the same genotype, α3.7/SEA. Their hematological and biochemical data were quite similar except for lower MCVs in subjects 1 and 2, even though all three individuals had normal iron levels (Table 1). A MCV range of 5173 fL has been reported for patients with this disease, suggesting other genetic or environmental factors are involved in its phenotypic expression .3
Deletional α3.7 alleles are caused by misalignment crossovers during meiosis, because of the presence of three duplicated homologous boxes designated X, Y, and Z C1). In the αthal1 alleles such as SEA, the deletion could be the result of an illegitimate recombination event associated with Alu repeats along the a globin gene cluster,13 however in our analyzed DNA samples, we observed two inverted repeats, one at ψα2 gene 5'GGAGGTTC3' and the other close to the 3'HVR region 5'CTTGGAGG3' (Figure 1), which could be the true responsible of the SEA deletion. DNA sequence analysis of the sea deletion boundaries in the three families studied showed the same sequence reported previously.14,15 This suggests that all the SEA alleles studied to date have the same origin. However, it is likely that further analysis in this matter with the a haplotypes will reveal different origins around the world. Although Nicholls et al. 15 located the 5' breakpoint in the 3' ψξ gene, our analysis locates this breakpoint in the ψα2 gene, at nucleotide 83 or codon 28 according to GenBank.16
In Latin America, HbH disease has been reported in Cuba with the same α3.7/SEA genotype observed in our patients.17 However, in Brazil, HbH disease has been observed with the α3.7 Vota1TM genotype, wherein the common α3.7 allele occurs with a rare αthal1 deletional allele.18
This is the first report in which the breakpoint site of the SEA mutation was analyzed and the 5' and 3' end of the deletion is well determined.
We want to stress that thalassemia in Mexico is not an unusual event since both a and βthalassemia is well documented. 1921 The diagnosis of the most severe forms of αthal, as HbH disease, is primarily based on clinical, hematological and biochemical studies, and the mutation confirmed by molecular analyses, while the identification of αthal healthy carriers with moderate or silent phenotype, is often hindered by the absence of specific diagnostic hematologic parameters. Since in Mexican patients the molecular pathology of αthal is heterogeneous, because deletional and non deletional alleles have been observed,7 the molecular DNA analysis is a fundamental tool to validate hematological findings, in particular when microcytosis or mild microcytic anemia can not be explained by iron deficiency or atypical βglobin mutations.
ACKNOWLEDGMENT
This work was partially supported by a grant from Sistema de Investigación José Ma. Morelos, Mexico; CONACYTREGIONAL No. 2002249016.
REFERENCES
1. Higgs DR. AlphaThalassaemia. In: Higgs DR and Weatherall DJ eds. Bailliere's Clinical Haematology International Practice and Research: The Haemoglobinopathies. Vol. 6, no. 1. London: Bailliere Tindall; 1993, pp. 11750. [ Links ]
2. HbVar: A Database of Human Hemoglobin Variants and Thalassemias. http://globin.cse.psu.edu.hbuar/menu.html [ Links ]
3. Chui DHK, Fucharoen S, Chan V. Hemoglobin H disease: not necessarily a benign disorder. Blood 2003; 101: 791800. [ Links ]
4. Weatherall DJ, Clegg JB. The Thalassaemia Syndromes, 4th ed. Oxford: Blackwell; 2000. [ Links ]
5. Chui DHK, Waye JS. Hydrops fetalis caused by αthalassemia: An emerging health care problem. Blood 1998; 91: 221322. [ Links ]
6. AnglesCano E, RoblesArredondo I, Ferrer V, GonzálezConstanse R, OrtizTrejo JF. Talasemia alfa (Hemoglobinopatia H) en una familia mestiza Mexicana. Sangre 1977; 22: 36676. [ Links ]
7. Ibarra B, Perea FJ, VillalobosArámbula AR. Alelos talasémicos en mestizos mexicanos. Rev Invest Clin 1995; 47: 12731. [ Links ]
8. CasasCastañeda M, HernándezLugo I, Torres O, Barajas H, Cibrian S, Zamudio G, VillalobosArámbula AR, HermosilloBañuelos RM, Perea FJ, Ibarra B. Alphathalassemia in a selected population of Mexico. Rev Invest Clin 1998; 50: 3958. [ Links ]
9. Huisman THJ, Jonxis JHP. The Hemoglobinopathies: Techniques of Identification, Clinical and Biochemical Analysis. New York: Marcel Dekker Inc.; 1977. [ Links ]
10. Sabath DE, Cross ST, Mamiya MY. An improved method for detecting red cells with hemoglobin H inclusions that does not require glass capillary tubes. Clin lab Haem 2003; 25: 8791. [ Links ]
11. Miller SA, Dykes DD, Polesky HF. A simple saltingout procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988; 16: 121516. [ Links ]
12. Shaji RV, Srivastava A, Chandy M, Krishnamoorthy R. A single tube multiplex PCR method to detect the common a thalassemia alleles. Blood 2000; 95: 187980. [ Links ]
13. Bernini LF, Harteveld CL. AlphaThalassaemia. In: Rodgers GP (Ed.). Bailliere's Clinical Haematology International Practice and Research: Sickle Cell Disease and Thalassaemia. Vol. 11, No. 1. London: Bailliere Tindall; 1998, pp. 5390. [ Links ]
14. Chang JG, LongShyong L, ChePin L, PaoHuei C, ChihPing C. Rapid diagnosis of αthalassemia1 of southeast Asia type and hydrops fetalis by polymerase chain reaction. Blood 1991; 78: 8534. [ Links ]
15. Nicho 11s RD, RischelGhodsian N, Higgs DR. Recombination of human αglobin gene cluster: Sequence features and topological constraints. Cell 1987; 49: 36978. [ Links ]
16. GenBank data base http://www.ncbi.nlm.nih.gov/(l)/genoma/ seg/BlastGen.cgi?taxid=9606NoAccessAy207443. [ Links ]
17. Martínez G, Ferreira R, Hernández A, Di Rienzo A, Felicetti L, Colombo B. Molecular characterization of HbH disease in the Cuban population. Hum Genet 1986; 72: 31819. [ Links ]
18. Wenning MRSC, Harteveld CL, Giordano PC, Kimura EM, Saad STO, Costa FF, Sonati MF. Hemoglobin H disease resulting from the association of the α3.7 rightward deletion and the ααMM deletion in a Brazilian patient. Eur J Haematol 2002; 69: 17981. [ Links ]
19. RuizArguelles GJ, LópezMartínez B, RuizReyes G. Heterozygous betαthalassemia: not infrequent in Mexico. Arch Med Res 2001; 32: 2935. [ Links ]
20. Perea FJ, Magaña MT, Cobián JG, SánchezLópez JY, Chavez ML, Zamudio G, Esparza MA, LópezGuido B, Ibarra B. Molecular spectrum of βthalassemia in the Mexican population. Blood Cells Mol Dis 2004; 33: 1502. [ Links ]
21. Nava MP, Ibarra Bertha, Magaña MT, Perea FJ. Prevalence of α+ thalassemia rightward and leftward alleles in sickle cell trait and βthalassemia patients in Mexico. Blood Cells Mol Dis 2006; 36: 2558. [ Links ]












