SciELO - Scientific Electronic Library Online

 
vol.142 issue5Human defensin: prophilaxis and therapy against HIV? author indexsubject indexsearch form
Home Pagealphabetic serial listing  

Gaceta médica de México

Print version ISSN 0016-3813

Gac. Méd. Méx vol.142 n.5 México Sep./Oct. 2006

 

Opinión

 

Análisis de los polimorfismos G199A, Ncol del gen ANK1 y Memphis I del gen SLC4A1 en Individuos sanos y pacientes mexicanos con esferocitosis hereditaria

 

Polymorphism analysis of G199A, Ncol in ANK1 and Memphis I in SLC4A1 genes in Mexican healthy individuals and subjects affected with hereditary spherocytosis

 

Ana Luisa Camacho–Torres, Josefina Yoaly Sánchez–López, Viviana Matilde Mesa–Cornejo, Bertha Ibarra y Francisco Javier Perea–Díaz*

 

División de Genética Humana, Centro de Investigación Biomédica de Occidente, Centro Médico Nacional de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jal., México

 

* Correspondencia y solicitud de sobretiros:
Dr. F. Javier Perea
División de Genética, Centro de Investigación Biomédica de Occidente, CMNO, IMSS.
Sierra Mojada No. 800, Col. Independencia, 44340, Guadalajara, Jal., México. AP 1–3838
Fax: 01(523) 3618–1756
Correo electrónico: javier_perea_diaz@yahoo.com.mx

 

Recibido en su versión modificada: 17 de abril de 2006
Aceptado: 12 de mayo de 2006

 

Resumen

Antecedentes. En México la esferocitosis hereditaria (EH) es la causa principal de anemia hemolítica hereditaria y se debe a mutaciones en uno o más genes implicados en la membrana eritrocitaria, lo que dificulta la identificación del gen primario.

Objetivo. Con el fin de valorar la utilización de los polimorfismos G199A y Ncol del gen ANK1, y Memphis I del gen SLC4A1 como marcadores genéticos para identificar esta enfermedad estimamos sus frecuencias alélicas y genotípicas en 45 muestras de ADN de pacientes con EH y 28 de individuos sanos, las cuales fueron similares en uno y otro grupos para los polimorfismos G199A y Memphis I, con baja frecuencia de heterocigotos, lo que limita su utilidad como marcador genético.

Resultados. El polimorfismo Ncol no mostró diferencias alélicas y genotípicas en los grupos de estudio, pero sí mayor frecuencia de heterocigotos (0.49 y 0.43 en enfermos y sanos respectivamente), caracteristica que le confiere ventajas para ser utilizado como marcador genético en familias conEH.

Conclusiones. Finalmente, debido a que existen otros genes implicados en la patología molecular de la EH, consideramos que es necesario analizar otros polimorfismos de genes que codificanpara las proteínas involucradas en las deficiencias que conducen a esferocitosis hereditaria en la población mexicana.

Palabras clave: Esferocitosis hereditaria, polimorfismos del gen ANK1, polimorfismos del gen SLC4A1

 

Summary

Background. In Mexico, Hereditary Spherocytosis (HS) is the main cause of hereditary hemolytic anemia, due to mutations of one or more genes involved in the erythrocyte membrane, making it difficult to identify the primary gene.

Objective. With the purpose of estimating the use of the polymorphisms G199A and Ncol of ANKl gene, and Memphis I of SLC4A1 gene, as genetic markers to screen this disease, we searched the allelic and genotypic frequencies in 45 DNA samples of HS patients and 28 from healthy individuals.

Results. Allelic and genotypic frequencies were similar in both studied groups for the G199A and Memphis I polymorphisms, with low frequency of heterozygosis showing its limited use as a genetic marker. The allelic and genotypic frequencies of the Ncol polymorphism were also similar in both groups, however a higher heterozygote frequency was observed (0.49 and 0.43 in patients and healthy individuals), a feature that may turn it into a useful genetic marker.

Conclusions. Since there are other genes implicated in the molecular pathology of the HS, we consider it necessary to continue analyzing other polymorphisms of the genes involved in Hereditary Spherocytosis among the Mexican population,

Key words: Hereditary Spherocytosis, gene ANK1 polymorphisms, gene SLC4A1 polymorphisms

 

Introducción

La EH en México es una enfermedad frecuente (31.3%) en población seleccionada por anemia hemolítica.1 El defecto bioquímico se localiza en el citoesqueieto proteico del eritrocito, principalmente en las proteínas implicadas en las interacciones verticales como son Ankirina, Espectrinas, Proteína 4.2 y Proteína Intercambiadora de Aniones 1 o banda 3.1,2

La cuantificación de las proteínas de membrana del eritrocito en pacientes mexicanos con EH muestra que la deficiencia proteica combinada con más de dos proteínas deficientes tiene una frecuencia de 52.0%, la de una sola se presenta en 39.0%, y el resto son pacientes sin deficiencia aparente.1 Del grupo de deficiencia única se encuentran como proteínas deficientes a la espectrina–alfa con una frecuencia de 13.0%, proteína intercambiadora de aniones con 10.0% de los casos, ankirina y proteína 4.2 se presentan cada una con 6.0% y la espectrina–beta tiene una frecuencia del 3.0%.1

Un polimorfismo es una variación en la secuencia de un sitio determinado de ADN observada en al menos 1.0% de los individuos en una población. Se han descrito varios polimorfismos en los genes ANK1 (gen de Ankirina 1) y SLC4A1 (gen de la proteína intercambiadora de aniones eritrocitaria) que han sido utilizados para realizar análisis de ligamiento genético con el propósito de facilitar el rastreo molecular del gen defectuoso implicado en la deficiencia proteica combinada en los casos con EH.2

El presente trabajo se realizó con el propósito de estimar las frecuencias alélicas y genotípicas de los polimorfismos G199Aen el exón 6 y Ncol en el intrón 38 del gen ANK13,4 y el polimorfismo Memphis I o K56E localizado en el exón 4 del gen SLC4A1,5con la intención de estimar la presencia de este tipo de marcadores genéticos que puedan ser de utilidad en el esclarecimiento de los casos de EH con deficiencia proteica combinada.

 

Material y métodos

Analizamos 45 muestras de ADN genómico provenientes de pacientes con EH previamente estudiados y 28 de ADN genómico obtenidas de donadores voluntarios sanos no relacionados del Banco de Sangre Central del CMNO, IMSS.

Todos los fragmentos descritos se amplificaron con las condiciones estándares para Reacción en Cadena de la Polimerasa (RCP). Los tres polimorfismos mencionados fueron visualizados por medio de electroforesis en un gel de agarosa al 2.0% teñido con bromuro de etidio y fotografiado con una cámara digital para su posterior interpretación (Figura 1).

El polimorfismo de G199A está situado en el codón 199 del exón 6, del gen ANK1. La transición GA deshace un sitio de reconocimiento para la enzima de restricción Mspl. Se amplificó un segmento de 325 pares de bases (pb) con los iniciadores descritos previamente.3 La digestión del producto amplificado con la enzima de restricción Mspl permitió identificar los siguientes alelos: el alelo con corte (G199) presenta los fragmentos de 143,110y 72 pb; alelo sin corte (A199) presenta los siguientes segmentos 182 y 143 pb (Figura 1A).

El polimorfismo de Ncol, localizado en el intrón 38 del gen ANK1 se identificó en un segmento 740 pb amplificado con los iniciadores previamente descritos.4 La digestión de los productos amplificados con la enzima Ncol permitió identificar los siguientes alelos: el alelo sin corte (o alelo 1 en el Cuadro I) deja intacto el fragmento amplificado (740 pb); alelo con corte (alelo 2 en el Cuadro I) se observan los fragmentos de 550 y 190 pb (Figura 1B).

El polimorfismo Memphis I (K56E) se localiza en el exón 4 del gen SLC4A1, fue identificado por un procedimiento de amplificación alelo específico diseñado en este laboratorio. Las secuencias de los iniciadores alelo específico son: alelo K56 5'–GGAGGCTGGGGTCCTCAGCTT–3', y alelo E56 5'–GGAGGCTGGGGTCCTCAGCTC–3'. La amplificación fue realizada en dos reacciones separadas, cada una para el iniciador específico (K56 o E56) que va acompañado con los iniciadores 5'–AGCCTCATTCTGCTGAGTGG–3'; y 5'–CCT–CACTCCTCTATCTGCTG–3', los cuales funcionaron también como control interno de amplificación y forman un fragmento de 366 pb. Los alelos se identificaron por la presencia de un fragmento de 250 pb (Figura 1C).

Con el programa Excel de MS–Office 2003 se estimaron las frecuencias relativas de alelos y genotipos de acuerdo con los procedimientos convencionales, y la comparación de frecuencias entre poblaciones se realizó con la prueba chi–cuadrada.

 

Resultados y discusión

Las frecuencias de los alelos y genotipos de los tres polimorfismos estudiados son mostrados en el Cuadro I.

La frecuencia alélica y genotípica del polimorfismo G199A del gen ANK1 es similar en los grupos de estudio. No hay diferencia significativa entre ellos lo que sugiere que el polimorfismo G199Ase encuentra en equilibrio Hardy–Weinberg. La frecuencia alélica observada para el polimorfismo G199A en pacientes mexicanos con EH es idéntica a la reportada en pacientes alemanes con EH en donde A199 tiene 0.13 y G199 con 0.87,3 pero en individuos sanos alemanes se observan las siguientes frecuencias 0.21 para el alelo A199 y 0.79 para G199 en comparación con los individuos sanos mexicanos cuyas frecuencias son 0.16 y 0.84 respectivamente. Se considera que debido a la frecuencia de 0.22 de heterocigotos en los pacientes estudiados, su utilidad como marcador genético del gen ANK1 es baja.

La frecuencia alélica observada para el polimorfismo Ncol del intrón 38 en el gen ANK1 fue similar en ambos grupos de estudio. En los pacientes con EH la distribución del alelo con corte fue similar (0.71) a la de los individuos sanos (0.60). En los pacientes con EH se observa que la distribución de genotipos tiene una tendencia al aumento de heterocigotos y homocigotos del alelo con corte. Al comparar la frecuencia alélica observada en este trabajo con la reportada para individuos norteamericanos sanos4 se aprecia que la frecuencia del alelo sin corte (alelo 1) es mayor (0.58) a la observada en mexicanos (0.29). La frecuencia de heterocigotos observada en pacientes con EH (0.49) de este polimorfismo sugiere que puede ser utilizado como marcador genético del gen ANK1.

En relación con el polimorfismo Memphis I del gen SLC4A1, en el Cuadro I se puede apreciar que la frecuencia de 0.15 del alelo E56 en pacientes con EH es similar en comparación con el grupo de individuos sanos (0.11).

El polimorfismo Memphis I (K56E) del gen SLC4A1 ha sido observado en varias poblaciones del mundo con frecuencias variables desde 0.05 a 0.24.6 En amerindiosy población africana se observan los valores más altos.6,7 Lafrecuencia descrita para el polimorfismo Memphis I en inmigrantes mexicanos sanos de Estados Unidos6 es de 0.083 y la frecuencia observada en este trabajo fue de 0.11 sin diferencia estadística significativa. La frecuencia del polimorfismo Memphis I entre los individuos sanos y enfermos no mostró diferencia significativa. La frecuencia de heterocigotos (0.28) observada para el polimorfismo Memphis I en los pacientes con EH es mayor a la observada en los individuos sanos (0.14) por lo que este polimorfismo tiene una utilidad limitada como marcador genético para el gen SCL4A1.

En conclusión, por los resultados de las frecuencias alélicas y genotípicas observadas en este trabajo, consideramos que únicamente el polimorfismo Ncol puede ser utilizado como marcador genético para rastreo de EH en nuestra población. Finalmente, es necesario establecer las frecuencias genéticas de otros polimorfismos de estos genes o de otros genes cuyos productos proteicos constituyen la membrana eritrocitaria, para elegir en nuestra población los que permitan analizar la asociación de genes implicados con esferocitosis hereditaria en los pacientes mexicanos.

 

Referencias

1. Sánchez–López JY, Camacho AL, Magaña MT, Ibarra B, Perea FJ. Red cell membrane protein deficiencies In Mexican patients with hereditary spherocytosls. Blood Cells Mol Dis 2003; 31:357–359.        [ Links ]

2. Bolton–Maggs PH, Stevens RF, Dodd NJ, Lamont G, Tittensor P, King MJ; Guidelines for the diagnosis and management of hereditary spherocytosis. Br J Haematol 2004; 126:455–474.        [ Links ]

3. Eber SW, Gonzalez JM, Lux ML, Scarpa AL, Tse WT, Dornwell M, et al. Ankyrln–1 mutations are a major cause of dominant and recessive hereditary spherocytosis. Nat Genet 1996; 13:214–218.        [ Links ]

4. Gallagher PG, Tse WT, Forget BG. Polymerase chain reaction analysis of an Ncol polymorphism of the human erythrocyte ankyrln gene. Blood 1992; 80:1856–1857.        [ Links ]

5. Jarolim P, Rubin HL, Zhai S, Sahr KE, Liu SC, Mueller TJ, Palek J. Band 3 Memphis: a widespread polymorphism with abnormal electrophoretic mobility of erythrocyte band 3 protein caused by substitution AAGGAG (LysGlu) in codon 56. Blood 1992; 80:1592–1598.        [ Links ]

6. Ranney HM, Rosenberg GH, Morrison M, Mueller TJ. Frequencies of Band 3 variants of human red cell membranes in some different populations. Br J Haematol 1990; 75:262–267.        [ Links ]

7. Online Mendelian Inheritance in Man, OMIMTM. Johns Hopkins University, Baltimore, MD. MIM Number: 109270: Date last edited 01/04/2006. World Wide Web URL: http://www.ncbl.nlm.nlh.gov/omlm/        [ Links ]