SciELO - Scientific Electronic Library Online

 
vol.24 número2Efecto de Pseudomonas fluorescentes en la germinación de semilla y vigor de plántulas de jitomateEfecto de la condición ambiental del cultivo de Vanilla planifolia Jacks. ex Andrews sobre la concentración de fitoquímicos índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • No hay artículos similaresSimilares en SciELO

Compartir


Revista Chapingo. Serie horticultura

versión On-line ISSN 2007-4034versión impresa ISSN 1027-152X

Rev. Chapingo Ser.Hortic vol.24 no.2 Chapingo may./ago. 2018

https://doi.org/10.5154/r.rchsh.2017.12.038 

Phylogenetic analysis of some members of the subgenus Persea (Persea, Lauraceae)

María Edith Cruz-Maya1 

Alejandro Facundo Barrientos-Priego1  * 

Lily Xochitl Zelaya-Molina2 

José Luis Rodríguez-de la O1 

Juan Carlos Reyes-Alemán3 

1Universidad Autónoma Chapingo, Departamento de Fitotecnia. Carretera México-Texcoco km 38.5, Texcoco, Estado de México, C. P. 56230, MÉXICO.

2Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Centro Nacional de Recursos Genéticos. Av. Biodiversidad núm. 2498, col. Centro, Tepatitlán de Morelos, Jalisco, C. P. 47600, MÉXICO.

3Universidad Autónoma del Estado de México. Carretera Tenancingo-Villa Guerrero km 1.5, Tenancingo, Estado de México, C. P. 52400, MÉXICO.


Abstract

The avocado belongs to the genus Persea, which is one of the most controversial genera of the Lauraceae family, since the relationships within the subgenus Persea are not clear and only recognized two species, Persea americana and Persea schiedeana. Its relationship with the subgenus Eriodaphne is also complex and there is a debate as to whether it is an independent genus. For this reason, the study aims to analyze the phylogenetic relationships within the genus Persea, with an emphasis on the subgenus Persea, using maximum parsimony and bayesian inference with the sequence of eight different fragments from nuclear, chloroplast and mitochondrial DNA. Sequences of the chloroplast ndhF, rbcL, matK, rpoC, trnH-psbA; mitochondria atp4 and cox3 and nuclear 18S rRNA were used. Fourteen fixed mutations were found in species of the subgenus Eriodaphne. The maximum parsimony and bayesian phylogenetic analyses of the super-matrices of the five chloroplast sequences and the eight concatenated ones, separated the members of both subgenera into two different clades with high bootstrap and posterior probability support, suggesting that the origin of Persea is not monophyletic and therefore both subgenera, Persea and Eriodaphne, could be recognized as phylogenetically independent genera.

Keywords: “aguacatillo”; avocado; phylogeny; chloroplast DNA; mitochondrial DNA

Resumen

El aguacate pertenece al género Persea, el cual es uno de los más controversiales de la familia Lauraceae debido a que las relaciones entre el subgénero Persea no están claras, y solo se reconocen dos especies, Persea americana y Persea schiedeana. Su relación con el subgénero Eriodaphne también es compleja, y existe un debate sobre si este es un género independiente. Por ello, el objetivo de esta investigación fue analizar las relaciones filogenéticas dentro del género Persea, con énfasis en el subgénero Persea, utilizando la máxima parsimonia e inferencia bayesiana con la secuencia de ocho fragmentos diferentes de ADN nuclear, cloroplástico y mitocondrial. Se emplearon secuencias del cloroplasto ndhF, rbcL, matK, rpoC, trnH-psbA, mitocondrias atp4 y cox3, y 18S rARN nuclear. Se encontraron 14 mutaciones fijas en especies del subgénero Eriodaphne. La máxima parsimonia, los análisis filogenéticos bayesianos de las supermatrices de las cinco secuencias de cloroplastos y las ocho concatenadas separaron a los miembros de ambos subgéneros en dos clados diferentes con un alto bootstrap y soporte de probabilidad posterior. Lo anterior sugiere que el origen de Persea no es monofilético y, por lo tanto, ambos subgéneros, Persea y Eriodaphne, podrían ser reconocidos como géneros filogenéticamente independientes.

Palabras clave: “aguacatillo”; aguacate; filogenia; ADN de cloroplastos; ADN mitocondrial

Introduction

Avocado (Persea americana Mill.) is today among the most economically important subtropical/tropical fruit crops in the world (Bost, Smith, & Crane, 2013), with a production of avocado fruit that now exceeds 3.5 million tons, of which about 20 % is traded internationally (Schaffer, Wolstenholme, & Whiley, 2013). Chanderbali et al. (2008) consider avocado as the most important commodity from the Lauraceae.

The conservation of avocado genetic resources and their relatives is important to deal with the potential problems of the avocado industry in the future. Threats to the avocado industry have appeared recently, such as laurel wilt, caused by the fungus Raffaelea lauricola symbiont of the ambrosia beetle (Xyleborus glabratus) that has been responsible for the extensive death of native Lauraceae in the United States since 2000, when it was first detected (Fraedrich et al., 2008). In August 2011, a dooryard avocado tree immediately north of the focus was affected by laurel wilt (Ploetz et al., 2015), close to the center of avocado production in Florida, USA. Resistance to this disease is now of high priority; the pool to search for this resistance is in the genetic resources of the genus Persea.

Germplasm banks have tried to conserve the existing diversity of avocado and its relatives (Barrientos, 2010), one of them located in the Fundación Salvador Sánchez Colín-CICTAMEX, S.C., which is considered the richest in respect to diversity and variability, and which started to concentrate more diversity in 1988 (Barrientos, 1999). The variability of this germplasm bank has been reported (López-López, Barrientos-Priego, & Ben-Ya’acov, 1999), as well its potential (Ben-Ya’acov & Barrientos, 2003), along with molecular characterization of some accessions with RAPD (Reyes-Alemán, Valadez-Moctezuma, Simuta-Velázco, Barrientos-Priego, & Gallegos-Vázquez, 2013), ISSR (Reyes-Alemán, Valadez-Moctezuma, & Barrientos-Priego, 2016), SSR (Gutiérrez-Díez, Barrientos-Priego, & Campos-Rojas, 2015) and with the sequence trnL-trnF of cpDNA (Cabrera-Hernández et al., 2017). In these studies, the great variability existing in that germplasm bank was evident, where the accessions represent above all the diversity that exists in the subgenus Persea.

The knowledge of the phylogenetic relationships of the subgenus Persea with the subgenus Eriodaphne is important to take decisions in relation to management and organization of germplasm banks and to guide future collections, in addition to defining actions with respect to genetic improvement.

The genus Persea L. (Lauraceae) consists of about 85 species distributed in America (Barrientos-Priego, Muñoz-Pérez, Borys, & Martínez-Damián, 2015), some new species have been described (Lorea-Hernández, 2002; van der Werff, 2002) and there are probably over a 100 species. The genus is distributed from the southern United States (Persea borbonia [L.] Spreng) to Chile (Persea lingue Ruiz & Pavon), with one species in the Canary Islands (P. indica [L.] Spreng.) and probably some representatives in South Asia (Barrientos-Priego et al., 2015); nevertheless, it is controversial as to whether Persea should be treated as including species from Asia since results suggest that Persea is strictly American (Li et al., 2011). The genus is divided into the subgenera Persea and Eriodaphne (Kopp, 1966); the first one has fruits known as real avocados (~ 5 to 20 cm) and the second tiny avocados known as “aguacatillos” (< 5 cm).

Within subgenus Persea, P. americana Mill. is the most studied species, mainly for its importance as a human food resource, and especially for its high oil content. For these reasons, and considering the graft compatibility among species, attempts to use species of subgenus Eriodaphne as a rootstock for P. americana to improve resistance to Phytophthora cinnamomi Rands. have been explored; however, the unsuccessful results revealed a vegetative incompatibility between species of both subgenera (Frolich, Schroeder, & Zentmyer, 1958).

There is a great controversy about the monophyletic origin of the genus Persea, indicating that phylogenetic studies based on morphological characters are not conclusive (Rohwer et al., 2009), and the subgenera Persea and Eriodaphne might perhaps be recognized as independent genera. However, a recent study by Li et al. (2011) shows Persea as monophyletic again, if Apollonias is included and a few aberrant species excluded. Several studies of the Lauraceae family based on molecular data give some information about Persea phylogeny (Chanderbali, van der Werff, & Renner, 2001); nevertheless, the inclusion of few species and specimens made the results uninformative for the Persea-Eriodaphne clade. The subgenus Eriodaphne has been studied by sequencing fragments of nuclear and chloroplast DNA more extensively by other authors (Chanderbali et al., 2001; Li et al., 2011; Rohwer et al., 2009), while the subgenus Persea has not. Cabrera-Hernández et al. (2017) in their study indicated that other sequences (chloroplast, mitochondrial and nuclei) must be studied in a concatenated way to have a better resolution of the subgenus Persea.

Specifically, within Persea, the cladistic analysis of Campos-Rojas, Terraza, and López-Mata (2007), the ITS phylogenetic study of Rohwer et al. (2009) and the trnL-trnF of cpDNA study of Cabrera-Hernández et al. (2017) could separate into different clades the species of the subgenus Persea from the species of Eriodaphne, supporting the hypothesis of a polyphyletic origin of the genus Persea, and providing an explanation of the vegetative (Frolich et al., 1958) and gametic (Lahav & Lavi, 2013) incompatibility between the two subgenera. However, controversy still exists on this issue, because the phylogenetic relationships between the two subgenera are very complex (Kopp, 1966), and so far, there is insufficient evidence from molecular DNA data for the separation of the two subgenera of Persea.

In several families of angiosperms, DNA sequences of coding regions, intergenic spacers and internal transcribed spacers of the chloroplast, mitochondria, and nucleus have been used in a concatenated form to obtain a better understanding of the phylogenetic relationships of the taxa analyzed. Among the most used genes are: rbcL (Kress & Erickson, 2007), ndhF (Beilstein Nagalingum, Clements, Manchester, & Mathews, 2010), matK, rpoC1 (Chase et al., 2007), and the intergenic spacer region trnH-psbA (Dong, Liu, Yu, Wang, & Zhou, 2012) from chloroplast DNA. Also, fragments of mitochondrial DNA, such as atp4 gene (Duminil, Pemonge, & Petit, 2002), and the nuclear 18S rRNA gene have been considered. With these novel analyses, it is evident that information from different DNA genes of several Persea species is necessary to reconstruct the phylogenetic history of this genus. For this reason, the study aims to analyze the phylogenetic relationships within the genus Persea, with an emphasis on the subgenus Persea, using maximum parsimony and bayesian inference with the sequence of eight different fragments from nuclear, chloroplast and mitochondrial DNA.

Material and methods

Plant material

Plant material from 35 specimens of the genus Persea, 29 of Persea subgenus and five of Eriodaphne subgenus, and one from Beilschmiedia anay (Blake) Kosterm, were obtained from Fundación Salvador Sánchez Colín-CICTAMEX, S.C. germplasm bank (Coatepec Harinas, Mexico), and from specimens deposited at the herbarium of the Forestry Department at Universidad Autónoma Chapingo, Mexico (CHAP). The specimens are from locations inhabited by the genus in Mexico and other countries (Table 1). The accessions included in the study represent practically all the diversity (seven species) of the subgenus Persea, according to the Kopp (1966) classification, although the unrecognized species Persea zentmayerii is not included (Schieber & Bergh, 1987). In the case of Persea americana, all races or botanical varieties were included, as well as the proposed fourth race Persea americana var. costaricensis. In addition, some hybrids were considered (Table 1), as well as Beilschmiedia anay that was used as an outgroup.

Table 1 Fundación Salvador Sánchez Colín-CICTAMEX collection accession number, place of origin and GenBank accession numbers of the species used in the analysis. 

Species name Accession number Location of origin GenBank accession number
trnH-psbA matK rpoC1 cox3 18S rRNA atp4 rbcL ndh
genus Beilschmiedia
Beilschmiedia anay CG-Hu-56 Puebla, Mexico JF966434 JF966448 JF966482 JF966516 JF966550 JF966584 JF966618 JF966644
genus Persea
subgenus Eriodaphne
P. chamissonis CHAP 37473Z Hidalgo, Mexico JF966426 JF966466 JF966500 JF966534 JF966568 JF966602 JF966636 JF966661
P. cinerascens CH-C-30 Michoacan, Mexico JF966431 JF966452 JF966486 JF966520 JF966554 JF966588 JF966622 JF966670
P. lingue CH-Pl-1 Chile JF966423 JF966445 JF966479 JF966513 JF966547 JF966581 JF966615 JF966641
P. longipes CH-G-36 Veracruz, Mexico JF966424 JF966456 JF966490 JF966524 JF966558 JF966592 JF966626 JF966652
P. sp. ‘PR’ CH-PR-1 Veracruz, Mexico JF966432 JF966457 JF966491 JF966525 JF966559 JF966593 JF966627 JF966671
subgenus Persea
Persea americana (P.a.)
P. a. var. americana CH -CR- 28 Costa Rica JF966410 JF966454 JF966488 JF966522 JF966556 JF966590 JF966624 JF966650
P. a. var. americana CH-G-48 Yucatán, Mexico JF966396 JF966442 JF966476 JF966510 JF966544 JF966578 JF966612 JF966669
P. a. var. americana CH-G-45 Yucatán, Mexico JF966416 JF966450 JF966484 JF966518 JF966552 JF966586 JF966620 JF966646
P. a. var. americana CH-I-6 Veracruz, Mexico JF966403 JF966458 JF966492 JF966526 JF966560 JF966594 JF966628 JF966653
P. a. var. drymifolia x P. a. var. guatemalensis ‘Hass’ California, U.S.A. JF966409 JF966447 JF966481 JF966515 JF966549 JF966583 JF966617 JF966643
P. a. var. costaricensis CH-CR-25 Costa Rica JF966430 JF966438 JF966472 JF966506 JF966540 JF966574 JF966608 JF966665
P. a. var. costaricensis CH-CR-44 Costa Rica JF966407 JF966437 JF966471 JF966505 JF966539 JF966573 JF966607 JF966664
P. a. var. drymifolia CH-C-10 Puebla, Mexico JF966395 JF966441 JF966475 JF966509 JF966543 JF966577 JF966611 JF966668
P. a. var. drymifolia CH-C-47 Michoacan, Mexico JF966411 JF966462 JF966496 JF966530 JF966564 JF966598 JF966632 JF966657
P. a. var. drymifolia CH-C-57 Mexico, Mexico JF966397 JF966443 JF966477 JF966511 JF966545 JF966579 JF966613 JF966639
P. a. var. drymifolia CH-C-63 Mexico, Mexico JF966402 JF966453 JF966487 JF966521 JF966555 JF966589 JF966623 JF966649
P. a. var. drymifolia CH-Der-2 Mexico, Mexico JF966401 JF966451 JF966485 JF966519 JF966553 JF966587 JF966621 JF966648
P. a.var. guatemalensis CH-G-7 S2 Chiapas, Mexico JF966413 JF966464 JF966498 JF966532 JF966566 JF966600 JF966634 JF966659
P. a. var. guatemalensis CH-G-11 S1 Chiapas, Mexico JF966412 JF966463 JF966497 JF966531 JF966565 JF966599 JF966633 JF966658
P. a. var. guatemalensis CH-GU-5 Guatemala JF966417 JF966455 JF966489 JF966523 JF966557 JF966591 JF966625 JF966651
P. a. var. guatemalensis CH-GU-6 Guatemala JF966399 JF966449 JF966483 JF966517 JF966551 JF966585 JF966619 JF966645
P. floccosa CH-I-3 Veracruz, Mexico JF966406 JF966435 JF966469 JF966503 JF966537 JF966571 JF966605 JF966647
P. a. var. drymifolia CH-I-2 Mexico, Mexico JF966398 JF966444 JF966478 JF966512 JF966546 JF966580 JF966614 JF966640
P. nubigena CH-G-76 Chiapas, Mexico JF966414 JF966467 JF966501 JF966535 JF966569 JF966603 JF966637 JF966662
P. nubigena CH-I-4 Israel JF966425 JF966459 JF966493 JF966527 JF966561 JF966595 JF966629 JF966654
P. parvifolia CH-Ve-2 Veracruz, Mexico JF966408 JF966446 JF966480 JF966514 JF966548 JF966582 JF966616 JF966642
P. schiedeana CH-Der-1 Veracruz, Mexico - JQ352803 - - - - - -
P. schiedeana CH-Gu-1 Guatemala JF966420 JF966440 JF966474 JF966508 JF966542 JF966576 JF966610 JF966667
P. schiedeana CH-H-5 Honduras JF966404 JF966460 JF966494 JF966528 JF966562 JF966596 JF966630 JF966655
P. schiedeana CH-H-7 Honduras JF966418 JF966465 JF966499 JF966533 JF966567 JF966601 JF966635 JF966660
P. schiedeana x P. a. var. guatemalensis CH-C-62 Guatemala JF966405 JF966461 JF966495 JF966529 JF966563 JF966597 JF966631 JF966656
P. steyermarkii CH-G-Ch1 Chiapas, Mexico JF966429 JF966439 JF966473 JF966507 JF966541 JF966575 JF966609 JF966666
P. tolimanensis Mv1 Chiapas, Mexico JF966433 JF966468 JF966502 JF966536 JF966570 JF966604 JF966638 JF966663
P. sp. ‘Freddy 4’ CH-CR-29 Costa Rica JF966428 JF966436 JF966470 JF966504 JF966538 JF966572 JF966606 JF966672

zPlant material was taken from specimens deposited at herbarium of the Forestry Department at Universidad Autónoma Chapingo, Mexico (CHAP).

DNA extraction, amplification, and sequencing

DNA was extracted from ~ 50 to 100 mg of leaves previously dried in silica gel. In some cases, leaves from herbarium specimens were used. Genomic DNA was extracted by the cetyltrimethylammonium bromide (CTAB) based method (Gambino, Perrone, & Gribaudo, 2008). At the end of the procedure, the DNA was purified with Qiaquick columns (Qiagen®, USA) following manufacturer's instructions. The quality and quantity of the DNA were evaluated with a NanoDrop® ND-1000 spectrophotometer. The amplification of each of the eight fragments was performed in a total volume of 25 µL containing: 50 to 100 ng of DNA, 200 µM of dNTPs mix, 1X Colorless GoTaq® Flexi Reaction Buffer (Promega, USA), 20 pM of specific primers (Table 2), 2.5 mM of MgCl2 and 2 U of GoTaq® Flexi DNA Polymerase (Promega, USA). Amplification programs consisted of one cycle of an initial denaturation of 4 min at 94 °C, followed by 35 cycles of 45 s at 94 °C, 1 min at specific melting temperature (Table 2) and 1 min at 72 °C, finally an extension of 5 min at 72 °C. The amplification reactions were performed in a GeneAmp® PCR System 9700 thermocycler (Applied Biosystems, USA).

Table 2 Primers used in the amplification and sequencing of mitochondrial, nuclear and chloroplast DNA. 

Locus/segment Name Sequence 5’-3’ Tm (°C) Reference
nz 18S rRNA NS1 GTAGTCATATGCTTGTCTC 56 White, Bruns, Lee, & Taylor (1990)
NS4 CTTCCGTCAATTCCTTTAAG 56 White et al. (1990)
NS5 AACTTAAAGGAATTGACGGAAG 56 White et al. (1990)
NS8 TCCGCAGGTTCACCTACGGA 56 White et al. (1990)
cp rpoC1 1f GTGGATACACTTCTTGATAATGG 56 Ford et al. (2009)
4r TGAGAAAACATAAGTAAACGGGC 56 Ford et al. (2009)
cp trnH-psbA trnH2 CGCGCATGGTGGATTCACAATCC 51 Tate & Simpson (2003)
psbAF GTTATGCATGAACGTAATGCTC 51 Tate & Simpson (2003)
cp rbcL 1f ATGTCACCACAAACAGAAAC 56 Olmstead, Michaels, Scott, & Palmer (1992)
724r TCGCATGTACCTGCAGTAGC 56 Fay, Swensen, & Chase (1997)
cp ndhF 389f CTGCBACCATAGTMGCAGCA 59 This study
461r GATTRGGACTTCTRSTTGTTCCGA 59 This study
cp matK 1326R TCTAGCACACGAAAGTCGAAGT 48 Schmitz-Linneweber et al. (2001)
390F CGATCTATTCATTCAATATTTC 48 Schmitz-Linneweber et al. (2001)
mt atp4 Orf1 AAGACCRCCAAGCYYTCTCG 50 Duminil et al. (2002)
Orf2 TTGCTGCTATTCTATCTATT 50 Duminil et al. (2002)
mt cox3 Cox3r CTCCCCACCAATAGATAGAG 51 Duminil et al. (2002)
Cox3f CCGTAGGAGGTGTGATGT 51 Duminil et al. (2002)

zn: nuclear genome DNA; cp: chloroplast genome DNA; mt: mitochondrial genome DNA; Tm: melting temperature.

The amplified DNA fragments were visualized on a 1.2 % agarose gel stained with ethidium bromide. The polymerase chain reaction (PCR) products were cleaned using Qiaquick® PCR Purification Kit columns (Qiagen, USA), following the instructions provided by the manufacturer. The PCR products were sequenced directly using the same primers (Table 2) in an automated sequencing system in Macrogen Inc., South Korea. The sequences were edited and assembled with the BioEdit version 7.0.9.0 program (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).

Sequence alignment

The 34 sequences obtained from the intergenic spacer trnH-psbA, ndhF, rbcL, rpoC1, 18S rRNA, cox3, and atp4 genes, and 35 from the matK gene (Table 2) were aligned with MUSCLE version 3.8 (Edgar, 2004). Additionally, 16 sequences of matK were aligned with 36 sequences downloaded from GeneBank (http://ncbi.nlm.nih.gov): two of Persea and 18 from the closely related genera (Sassafras, Litsea, Lindera, Ocotea, Cinnamomum, Nectandra, Actinodaphne, Parasassafras, Sinosassafras, Neolitsea, Iteadaphne, Endlicheria, Aniba, Laurus, Umbellularia, Alseodaphne, Phoebe and Machilus). Afterward, two super-matrices, the first one with the chloroplast DNA sequences: ndhF + rbcL + matK + rpoC1 + trnH-psbA and the second with all eight, were built manually.

Phylogenetic analysis

The 52 aligned sequences of matK, and the two super-matrixes mentioned above were analyzed with maximum parsimony (MP) using PAUP ver. 4.0b10 software (Swofford, 2001) and bayesian inference (BI) using MrBayes ver. 3.1.2 (Ronquist & Huelsenbeck, 2003). The mitochondrial genes and the nuclear rDNA data were not analyzed separately since they did not show sufficient informative characters. In each analysis of MP, all the characters were weighted equally, and gaps treated as missing data. A set of the most parsimonious trees from the different datasets was obtained through heuristic searches of 1,000 replicates with random stepwise sequence addition, tree bisection-reconnection branch (TBR) swapping, ‘‘MulTrees’’ option in “effect”, and saving 10 trees from each random sequence addition. Robustness of clades was estimated by a bootstrap analysis with 1,000 replicates with simple sequence addition, TBR swapping and holding only 10 trees per replicate to reduce time spent in swapping on large numbers of suboptimal trees. The BI was performed using the GTR + G model and two independent replicates of four chains with a maximum of 10 million generations, with trees sampled every 100 generations.

Results

Features of the sequence alignments

A total of 273 sequences were obtained from ndhF, rbcL, matK, rpoC1, trnH-psbA, 18S rRNA, atp4 and cox3; all of them were deposited at GenBank under Accession numbers JF966395-JF966399, JF966401-JF966414, JF966416-JF966418, JF966420, JF966423-JF966426, JF966428-JF966672, and JQ352803 (Table 1). The trnH-psbA alignment held the highest variation, with 32 parsimony-informative sites (Pi, 6.44 %), and 67 variable sites (VS, 13.48 %) (Table 3). The mitochondrial genes atp4 and cox3 held the least variation, with 0 to 1 Pi sites, and 0.18 and 0.43 % VS, respectively (Table 3); despite the low informative sites obtained, it was decided to include them. Beilschmiedia anay CG-Hu-56 had the most divergent sequence in the eight sequences, by a variation of 0-4 % with P. americana sequences. B. anay CG-Hu-56 was used as an outgroup in the phylogenetic analysis.

Table 3 Description of sequence alignments of 34 materials of Persea genus and one of Beilschmiedia anay. 

Locus/segment Alignment length (bp) CRz NCR Pi (%) CS (%) VS (%) S EFM
n 18S rRNA 1748 0 1748 6 (0.34) 1719 (98.34) 29 (1.69) 23 2
cp rpoC1 599 599 0 2 (0.33) 577 (96.33) 22 (3.67) 20 2
cp trnH-psbA 497 98 399 32 (6.44) 428 (86.12) 67 (13.48) 41 5
cp rbcL 1481 1428 53 10 (0.67) 1390 (93.86) 91 (6.14) 81 4
cp ndhF 739 739 0 4 (0.54) 707 (95.67) 32 (4.33) 28 0
cp matK 909 909 0 7 (0.77) 866 (95.27) 43 (4.73) 36 1
mt atp4 507 507 0 1 (0.20) 501 (99.82) 6 (1.18) 5 0
mt cox3 695 695 0 0 (0.00) 692 (99.57) 3 (0.43) 3 0
matK+rbcL+ndhF+rpoC1+ trnH-psbA 4236 3773 463 55 (1.30) 3965 (93.60) 261 (6.16) 206 12
18S rRNA+cox3+atp4+matK+ rbcL+ ndhF+rpoC1+trnH-psbA 7183 4983 2200 62 (0.86) 6874 (95.69) 299 (4.16) 237 14

zCR: coding region; NCR: non-coding region; Pi: parsimony informative sites; CS: conserved sites; VS: variable sites; S: singleton sites; EFM: Eriodaphne exclusive fixed mutations

Phylogenetic analysis of matK

A large phylogenetic analysis was performed with the matK. To place the subgenera Persea and Eriodaphne inside the Lauraceae family, representatives of 18 closely related genera were included in the analysis. Both the BI and the MP approaches resulted in relatively congruent topologies concerning subgenus Eriodaphne and the Litsea-Ocotea clade, and although Persea subgenera species were grouped with a weak Posterior Probability (PP) in BI, the bootstrap (BS) majority rule consensus tree from MP does not support this clade (Figure 1). The MP and BI recovered the subgenus Eriodaphne and the Litsea-Ocotea clade with weak BS and strong PP, BS values for these clades are 52 and 66 %, and BI support for the same branches is 86 and 96 %, respectively. Within the Eriodaphne clade, both analyses support the subclade P. lingue-P. longipes, with 63 and 100 % of BS and PP, respectively. In the Litsea-Ocotea clade, both analyses support the formation of eight different subclades, mainly with species of the same genera, with 63 to 98 % of BS values and 71 to100 % of PP (Figure 1). Beilschmiedia anay JF966448 and Machilus rimosa AB259098 are separated from the main core (100 % PP).

Figure 1 Bayesian 50 % majority rule consensus phylogram resulting from the analysis of partial sequences of the matK gene of Persea and other genera of Lauraceae. Posterior probabilities are indicated above the nodes, and maximum parsimony bootstrap support values (where 50 %) appear below the nodes. In the parsimonious analysis, 133 equally parsimonious trees with a length of 121 steps, and a consistency index of 0.88, homoplasy index of 0.12 and a retention index of 0.88 were obtained. 

Analysis of the concatenated chloroplast sequences

The phylogenetic analysis of the five chloroplast sequences was performed with sequences of 34 different plant accessions evaluated in this study, with members of the subgenera Persea and Eriodaphne, plus Beilschmedia anay. The BI and MP analyses resulted in relatively congruent topologies (Figure 2). The analyses recovered two major clades, subgenus Eriodaphne and subgenus Persea, with well-supported BS/PP (88/100 %) and moderate values (82/84 %), respectively. This indicates that the additional parsimony informative characters from the other chloroplast sequences may have improved the phylogenetic signal.

Figure 2 Bayesian 50 % majority rule consensus tree resulting from the analysis of the concatenation of the five chloroplast sequences matK+rbcL+ndhF+rpoC1+trnH-psbA of Persea and Beilschmiedea anay (Lauraceae). Posterior probabilities are indicated above the nodes, and maximum parsimony bootstrap support values (where 50 %) appear below the nodes. In the parsimonious analysis, 160 equally parsimonious trees with a length of 311 steps, and a consistency index of 0.87, homoplasy index of 0.13 and a retention index of 0.82 were obtained. 

On the other hand, the five genes have a total of 261 VS, with 22 in rpoC1 to 91 of rbcL; of these, 55 are Pi sites, with two in rpoC to 32 in trnH-psbA (Table 3). Also, it is important to note the presence of 12 fixed mutations in the five species of subgenus Eriodaphne so far investigated, which have led to the formation of a very solid clade (Table 3).

Within the five accessions of the subgenus Eriodaphne clade, the BI supports two groups, in the MP-BS majority rule consensus tree, although just the Persea chamissonis-Persea sp. ‘PR’ clade has a weak support of 61 %. This clade was also supported in the matK analysis. Within the Persea clade, there was a basal polytomy of two accessions of species of Persea americana (var. americana, CH-G-45 from Yucatán, Mexico and var. guatemalensis CH-G-11 S1 from Chiapas, Mexico), Persea parvifolia (CH-Ve-2 from Veracruz, Mexico) and a clade comprising the rest of the accessions (Figure 2). In this subclade, the BI tree shows five clades; two of them strongly supported one with all the Persea americana var. drymifolia accessions and another with Persea nubigena CH-I-4, Persea steyermarkii CH-G-Ch1 and P. tolimanensis Mv1; one with weak support; another with negligible; plus, one consisting of the single Persea floccosa CH-I-3 (Figure 2).

Analysis of the eight concatenated sequences

The phylogenetic analysis of the eight sequences was performed with plant accessions of 29 members of the subgenus Persea, five of the subgenus Eriodaphne and Beilschmiedia anay. The BI and MP analyses also resulted in relatively congruent topologies (Figure 3), and in general very similar to the BI and MP tree of the concatenated chloroplast sequences. The subgenera Eriodaphne and Persea clades were also obtained, but with slightly higher BS/PP support, 94/100 % for Eriodaphne and 84/86 % for Persea (Figure 3). The addition of 18S rRNA, cox3, and atp4 genes provided 38 VS, seven of which are Pi (Table 3). This information was not able to significantly improve the phylogenetic signal. The Eriodaphne fixed mutations increased from 12 to 14, by the addition of two mutations of the 18S rRNA gene (Table 3).

Figure 3 Bayesian 50 % majority rule consensus phylogram resulting from the analysis of the concatenation of 18S rRNA+cox3+atp4+matK+rbcL+ndhF+rpoC1+trnH-psbA sequences of Persea and Beilschmiedea anay (Lauraceae). Posterior probabilities are indicated above the nodes, and maximum parsimony bootstrap support values (where 50 %) appear below the nodes. In the parsimonious analysis, 264 equally parsimonious trees with a length of 355 steps, and a consistency index of 0.87, homoplasy index of 0.13 and a retention index of 0.81 were obtained. 

Discussion

Persea is one of the most complex genera of the Lauraceae. Previous phylogenetic analyses of the matK gene (Chanderbali et al., 2001; Rohwer, 2000; Rohwer et al., 2009) have shown that the Persea group is a monophyletic group deeply nested within the Lauraceae, close to the Litsea and Ocotea complexes. In previous analyses, such as the trnL-trnF/trnH-psbA phylogenetic tree of Chanderbali et al. (2001), both subgenera of Persea are grouped in the same clade, related to Machilus thunbergii and Alseodaphne semecarpifolia. In the ITS phylogeny of Chanderbali et al. (2001), the three species of subgenus Eriodaphne formed a small clade (97 % BS), with Persea americana as its immediate sister group and several other, mainly Asian species of the Persea group as sister group to both. However, the small number of specimens analyzed of the two subgenera did not allow resolving the relationships within the Persea group.

Rohwer et al. (2009) used ITS sequences of several genera of the family. They found that the species of the subgenera Persea and Eriodaphne grouped separately from each other and from Machilus species. In our study, although matK gene showed a low degree of divergence in the sequences analyzed, BI and MP phylogenies could set the subgenus Eriodaphne in an independent clade, separated from species of the subgenus Persea and the other genera analyzed. Rohwer (2000) also found low levels of divergence within sequences of matK in Lauraceae (9.7 %) and less than 1 % within the genus Persea.

Although the trnH-psbA spacer region and the rbcL gene are more variable than matK (Table 3), these genes were not selected to investigate the position of Persea within the Lauraceae, because the trnH-psbA intergenic spacer has two areas subjected to frequent inversions that are not analyzed in this study and the phylogenetic trees of the rbcL (not shown) had the same topologies as the trees of matK.

The trees obtained from the analysis of chloroplast sequences and the eight concatenated ones are almost the same, due to the 55 PI sites of the chloroplast sequences, making them the most useful for the phylogenetic reconstruction of the clades, especially for the subgenus Persea. The mitochondrial and 18S rRNA genes only contributed to the separation of two accessions of Persea schiedeana (CH-H-5 and CH-Gu-1), although with moderate support.

In the subgenus Eriodaphne all species considered were resolved completely, but in the subgenus Persea the analysis failed to separate Persea americana from all the species, especially from Persea schiedeana, which has also been found in a study of avocado germplasm and additional species of subgenus Persea with ISSR markers (Reyes-Alemán et al., 2016). The genetic variability level of the avocado, despite its cross-pollination system, is not considered to be exceptionally high compared with estimates that have been made with temperate fruit species (Chen, Morrel, de la Cruz, & Clegg, 2008), which seems to be what was found in part in the present study.

Persea parvifolia L. O. Williams (Persea pallescens [Mez] Loera-Hernández), a shrub with thin shoots, small narrow obovate to elliptic leaves and small fruits (Figure 4), which was first described by L.O Williams (1977) and not considered by van der Werff (2002) as a subgenus Persea species, is one of the most ancestral species in the subgenus Persea clade, so it could be considered as a good candidate for the species that gave rise to the avocado; however, it was unresolved with the other two individuals of P. americana that also have a conserved sequence, so they could be primitive forms of those races. More individuals of this species are needed for a further analysis as well as other P. americana and other sources of P. parvifolia to support this.

Figure 4 Branch and fruit of Persea parvifolia L. O. Williams (Persea pallescens [Mez] Loera-Hernández). 

It has been indicated that although P. nubigena, P. steyermarkii and P. floccosa could be separated from P. americana by restriction fragment length polymorphism (RFLP), they are considered to be only variants of P. americana (Furnier, Cummings, & Clegg, 1990); however, the results show that some of these species cluster together, which is the case of P. nubigena, P. steyemarkii, and P. tolimanensis, species considered to contribute to the ancestry of P. americana var. guatemalensis (Schieber & Bergh, 1987); nevertheless, this does not seem to correspond to our findings.

With respect to P. americana, a well-supported clade that includes five accessions of the Mexican race (P. americana var. drymifolia) were grouped together with two of the West Indian one (P. americana var. americana) indicates that they are closely related. It can be assumed that the last two accessions are not completely pure and that they may have genetic characteristics of the Mexican race. Conversely, an apparent conflict between phenotypic and genotypic data can help adjust pedigree information (Ashworth & Clegg, 2003), and be used to reclassify accessions in the germplasm bank as possible hybrids. This last point also applies to another clade that grouped accessions of the Guatemalan race, possibly hybrid, one P. americana var. costaricensis, and a P. schiedeana from Honduras, the last of which was also reported using DFP and SSR markers which did not find unique DNA patterns which could characterize the three races of P. americana and the three accessions of P. schiedeana (Mhameed et al., 1997). This is also in accordance for the subclade that grouped two P. schiedeana, one from Honduras and the other from Guatemala. In the other subclade, two accessions of Costa Rica were together an unclassified one (‘Freddy 4’) and a P. americana var. americana (CH-CR-28), which is probably the West Indian Race subclade.

The complex legacy of ancient and recent avocado improvement has left a profusion of genotypes of uncertain affinities and with diffuse racial boundaries (Ashworth & Clegg, 2003), where other factors may have a role, including the possibility of remote hybridization events (Bufler & Ben-Ya’acov, 1992) or a more recent date for racial differentiation than previously thought (Ashworth & Clegg, 2003).

It must be considered that although the analyses of the eight concatenated sequences separate both subgenera of Persea, the variation of the eight sequences is low, 4.16 % of VS and 0.86 % of Pi sites (Table 3). This was reported for trnH-psbA (Chanderbali et al., 2001) and matK (Rohwer, 2000) in the family Lauraceae, but not for the other sequences. Therefore, it is necessary to find sequences showing a greater variation that allow a better resolution of the phylogenetic relationships within subgenus Persea. A suitable candidate may be the nuclear ITS region, which has 33 % parsimony-informative sites for many Lauraceae accessions (Rohwer et al., 2009), but in our experience it has the disadvantage of being difficult to amplify and sequence in some accessions of Persea, and to align because of too many indels. Liu, Chen, Song, Zhang, and Chen (2012) found that the ITS2 region produced a low success rate in direct PCR amplification and sequencing in Lauraceae species and it is also unsuitable to be the DNA barcode of the family.

Based on the hypothesis of a monophyletic origin of the genus Persea, our results partially suggest that this genus is not a monophyletic group; therefore, one could think that the subgenera Persea and Eriodaphne should be recognized as independent genera, confirming the analysis of Rohwer et al. (2009), where Persea does not appear to be monophyletic, because the subgenus Persea seems to be more closely related to Phoebe and Alseodaphne than to the subgenus Eriodaphne.

Conclusions

The eight concatenated sequences separated both subgenera (Persea and Eriodaphne) into two different clades, where 14 fixed mutations were found in the studied species of the subgenus Eriodaphne, supporting the hypothesis of independent genera. In the subgenus Persea, the concatenated sequences used failed to separate Persea americana from all the species, especially from Persea schiedeana, the most distinct species in the subgenus. The chloroplast intergenic spacer trnH-psbA sequence held the highest variation and informative sites, while the mitochondrial and nuclear rDNA sequences studied were not informative.

Acknowledgments

The first author was supported by a master scholarship from CONACYT-Mexico. This study was funded by project FRU-AGU-10-01 of the National System for Plant Genetic Resources for Foodand Agriculture in Mexico (SINAREFI-SNICS-SAGARPA) and by the Fundación Salvador Sánchez Colín-CICTAMEX, S.C.

References

Ashworth, V. E. T. M., & Clegg, M. T. (2003). Microsatellite markers in avocado (Persea americana Mill.): Genealogical relationships among cultivated avocado genotypes. Journal of Heredity, 94(5), 407-415. doi: 10.1093/jhered/esg076 [ Links ]

Barrientos-Priego, A. F. (1999). Conservation of avocado genetic resources in Mexico. Subtropical Fruit News, 7(1), 1-2. [ Links ]

Barrientos Priego, A. F. (2010). El aguacate. Biodiversitas, 88(1), 1-7. Retrieved from http://www.biodiversidad.gob.mx/Biodiversitas/Articulos/biodiv88art1.pdf [ Links ]

Barrientos-Priego, A. F., Muñoz-Pérez, R., Borys, M. W., & Martínez-Damián, M. T. (2015). Taxonomía, cultivares y portainjertos. In: Téliz, D. & Mora, A. (Eds.), El aguacate y su manejo integrado (pp. 31-62). Montecillos, México: Biblioteca Básica de Agricultura, Colegio de Postgraduados. [ Links ]

Beilstein, M. A., Nagalingum, N. S., Clements, M. D., Manchester, S. R., & Mathews, S. (2010). Dated molecular phylogenies indicate a Miocene origin for Arabidopsis thaliana. Proceedings of the National Academy of Sciences, 107(43), 18724-18728. doi: 10.1073/pnas.0909766107 [ Links ]

Ben-Ya’acov, A., & Barrientos-Priego, A. (2003). The Persea germplasm resources potential as discovered during an international collection project (pp. 21-26). Proceedings of The V World Avocado Congress. Malaga, Spain. [ Links ]

Bost, J. B., Smith, N. J. H., & Crane, J. H. (2013). History, distribution and uses. In: Schaffer, B. A., Whiley, A. W., & Wolstenholme, B. N. (Eds.), The avocado, botany and uses (pp. 10-30). Oxfordshire, UK: CAB International Publishing. doi: 10.1079/9781845937010.0010 [ Links ]

Bufler, G., & Ben-Ya’acov, A. (1992). A study of the avocado germplasm resources, 1988-1990. 3 Ribosomal DNA repeat unit polymorphism in avocado (pp. 545-550). Proceedings of the Second World Avocado Congress, University of California, Riverside, California. [ Links ]

Cabrera-Hernández, C., Valadez-Moctezuma E., Cruz-Maya, M. E., Zelaya-Molina, L. X., Barrientos-Priego, A. F., & Reyes-Alemán, J. C. (2017). EL trnL-trnF de cpADN contribuye a la separación de los subgéneros Persea y Eriodaphne (Lauraceae; Persea) como géneros independientes. Chilean Journal of Agricultural & Animal Sciences, 33(3), 231-240. doi: 10.4067/S0719-38902017005000701 [ Links ]

Campos-Rojas, E., Terrazas, T., & López-Mata, L. (2007). Persea (avocados) phylogenetic analysis based on morphological characters: hypothesis of species relationships. Genetic Resources and Crop Evolution, 54(2), 249-258. doi: 10.1007/s10722-005-3808-x [ Links ]

Chanderbali, A. S., van der Werff, H., & Renner, S. S. (2001). Phylogeny and historical biogeography of Lauraceae: Evidence from the chloroplast and nuclear genomes. Annals of the Missouri Botanical Garden, 88(1), 104-134. doi: 10.2307/2666133 [ Links ]

Chanderbali, A. S., Albert, V. A., Ashworth, V. E., Clegg, M. T., Litz, R. E., Soltis, D. E., & Soltis, P. S. (2008). Persea americana (avocado): bringing ancient flowers to fruit in the genomics era. BioEssays, 30(4), 386-396. doi: 10.1002/bies.20721 [ Links ]

Chase, M. W., Cowan, R. S., Hollingsworth, P. M., van den Berg, C., Madriñán, S., Petersen, G., Seberg, O., Jørgsensen, T., Cameron, K. M., Carine, M., & Pedersen, N. (2007). A proposal for a standardized protocol to barcode all land plants. Taxon, 56(2), 295-299. Retrieved from https://botanica.uniandes.edu.co/investigacion/pdfs/Chase-Plant%20Barcodes.pdf [ Links ]

Chen, H., Morrel, P. L., de la Cruz, M., & Clegg, M. T. (2008). Nucleotide diversity and linkage disequilibrium in wild avocado (Persea americana Mill.). Journal of Heredity, 99(4), 382-389. doi: 10.1093/jhered/esn016 [ Links ]

Dong, W., Liu, J., Yu, J., Wang, L., & Zhou, S. (2012). Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PloS One, 7(4), 35071. doi: 10.1371/journal.pone.0035071 [ Links ]

Duminil, J., Pemonge, M. H., & Petit, R. J. (2002). A set of 35 consensus primer pairs amplifying genes and introns of plant mitochondrial DNA. Molecular Ecology Notes, 2(4), 428-430. doi: 10.1046/j.1471-8286.2002.00263.x [ Links ]

Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32(5), 1792-1797. doi: 10.1093/nar/gkh340 [ Links ]

Fay, M. F., Swensen, S. M., & Chase, M.W. (1997). Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae). Kew Bulletin, 52(1), 111-120. doi: 10.2307/4117844 [ Links ]

Ford, C. S., Ayres, K. L., Toomey, N., Haider, N., Van Alphen, S. J., Kelly, L. J., Wikström, N., Hollingsworth, P. M., Duff, R. J., Hoot, S. B., Cowan, R. S., Chase, M. W., & Wilkinson, M. J. (2009). Selection of candidate coding DNA barcoding regions for use on land plants. Botanical Journal of the Linnean Society, 159(1), 1-11. doi: 10.1111/j.1095-8339.2008.00938.x [ Links ]

Fraedrich, S. W., Harrington, T. C., Rabaglia, R. J., Ulyshen, M. D., Mayfield, A. E., Hanula, J. L., Eickwort, J. M., & Miller, D. R. (2008). A fungal symbiont of the redbay ambrosia beetle causes a lethal wilt in redbay and other Lauraceae in the southeastern United States. Plant Disease, 92(2), 215-224. doi: 10.1094/PDIS-92-2-0215 [ Links ]

Frolich, E. F., Schroeder, C. A., & Zentmyer, G. A. (1958). Graft compatibility in the genus Persea. California Avocado Society, 42, 102-105. Retrieved from http://www.avocadosource.com/CAS_Yearbooks/CAS_42_1958/CAS_1958_PG_102-105.pdf [ Links ]

Furnier, G. R., Cummings, M. P., & Clegg, M. T. (1990). Evolution of the avocados as related by DNA restriction fragment variation. Journal of Heredity, 81(3), 183-188. doi: 10.1093/oxfordjournals.jhered.a110963 [ Links ]

Gambino, G., Perrone, I., & Gribaudo, I. (2008). A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochemical Analysis, 19(6), 520-525. doi: 10.1002/pca.1078 [ Links ]

Gutiérrez-Díez, A., Barrientos-Priego, A. F., & Campos-Rojas, E. (2015). Caracterización molecular y análisis filogenético de los subgéneros Persea y Eriodaphne (Lauraceae) (pp. 88-94). Recursos genéticos y manejo de viveros. Lima, Perú. [ Links ]

Kopp, L. E. (1966). A taxonomic revision of the genus Persea in the Western Hemisphere (Persea-Lauraceae). Memoirs of the New York Botanical Garden, 14(1), 1-120. [ Links ]

Kress, W. J., & Erickson, D. L. (2007). A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS One, 2(6), 508. doi: 10.1371/journal.pone.0000508 [ Links ]

Lahav, E., & Lavi, U. (2013). 4 Genetics and breeding. In: Schaffer, B. A., Whiley, A. W., & Wolstenholme, B. N. (Eds.), The avocado botany, and uses (pp. 51-85). Oxfordshire, UK.: CAB International Publishing. [ Links ]

Li, L., Li, J., Rohwer, J. G., van der Werff, H., Wang, Z. H., & Li, H. W. (2011). Molecular phylogenetic analysis of the Persea group (Lauraceae) and its biogeographic implications on the evolution of tropical and subtropical amphi-pacific disjunctions. American Journal of Botany, 98(9), 1520-1536. doi: 10.3732/ajb.1100006 [ Links ]

Liu, Z., Chen, S. L., Song, J. Y., Zhang, S. J., & Chen, K. L. (2012). Application of deoxyribonucleic acid barcoding in Lauraceae plants. Pharmacognosy Magazine, 8(29), 4-11. doi: 10.4103/0973-1296.93301 [ Links ]

López-López, L., Barrientos-Priego, A. F., & Ben-Ya’acov, A. D. (1999). Variabilidad genética de los bancos de germoplasma de aguacate preservados en el Estado de México. Revista Chapingo Serie Horticultura, 5, 19-23. doi: 10.5154/r.rchsh.1999.02.012 [ Links ]

Lorea-Hernández, F. G. (2002). La familia Lauraceae en el sur de México: diversidad, distribución y estado de conservación. Boletín de la Sociedad Botánica de México, 71, 59-70. Retrieved from http://www.redalyc.org/articulo.oa?id=57707104 [ Links ]

Mhameed, S., Sharon, D., Kaufman, D., Lahav, E., Hillel, J., Degani, C., & Lavi, U. (1997). Genetic relationships within avocado (Persea americana Mill.) cultivars and between Persea species. Theoretical and Applied Genetics, 94(2), 279-286. doi: 10.1007/s001220050411 [ Links ]

Olmstead, R., Michaels, H., Scott, K., & Palmer, J. (1992). Monophyly of the Asteridae and identification of their major lineages inferred from DNA sequences of rbcL. Annals of the Missouri Botanical Garden, 79(2), 249-265. doi: 10.2307/2399768 [ Links ]

Ploetz, R. C., Peña, J. E., Smith, J. A., Dreaden, T. J., Crane, J. H., Schubert, T., & Dixon, W. (2015). Laurel Wilt, caused by Raffaelea lauricola, is confirmed in Miami-Dade County, center of Florida's commercial avocado production. Plant Disease, 95(12), 33-44. doi: 10.1094/PDIS-08-11-0633 [ Links ]

Reyes-Alemán, J. C., Valadez-Moctezuma, E., Simuta-Velázco, L., Barrientos-Priego, A. F., & Gallegos-Vázquez, C. (2013). Distinción de especies del género Persea mediante RAPD e ISSR de ADN. Revista Mexicana de Ciencias Agrícolas, 4(4), 517-529. Retrieved from http://scielo.unam.mx/pdf/remexca/v4n4/v4n4a3.pdf [ Links ]

Reyes-Alemán, J. C., Valadez-Moctezuma, E., & Barrientos-Priego, A. F. (2016). Assessment of genetic relationship in Persea spp. by traditional molecular markers. Genetics and Molecular Research, 15(2), 1-11. doi: 10.4238/gmr.15027359 [ Links ]

Rohwer, J. G. (2000). Toward a phylogenetic classification of the Lauraceae: evidence from matK sequences. Systematic Botany, 25(1), 60-71. doi: 10.2307/2666673 [ Links ]

Rohwer, J. G., Li, J., Rudolph, B., Schmidt, S. A., van der Werff, H., & Li, H. W. (2009). Is Persea (Lauraceae) monophyletic? Evidence from nuclear ribosomal ITS sequences. Taxon , 58(4), 1153-1167. Retrieved from http://www.jstor.org/stable/27757009 [ Links ]

Ronquist, F., & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19(12), 1572-1574. doi: 10.1093/bioinformatics/btg180 [ Links ]

Schaffer, B., Wolstenholme, B. N., & Whiley, A. W. (2013). Introduction. In: Schaffer, B. A., Whiley, A. W., & Wolstenholme, B. N. (Eds.), The avocado, botany and uses (pp. 1-9). Oxfordshire, UK: CAB International Publishing . doi: 10.1079/9781845937010.0001 [ Links ]

Schieber, E., & Bergh, B. O. (1987). Persea zentmyerii: a new species from Guatemala. California Avocado Society, 71, 199-203. Retrieved from http://avocadosource.com/CAS_Yearbooks/CAS_71_1987/CAS_1987_PG_199-203.pdf [ Links ]

Schimitz-Linneweber, C., Maier, R. M., Alcaraz, J. P., Cottet, A., Herrmann, R. G., & Mache, D. R. (2001). The plastid chromosome of spinach (Spinacia oleracea): complete nucleotide sequence and gene organization. Plant Molecular Biology, 45(3), 307-315. doi: 10.1023/A:1006478403810 [ Links ]

Swofford, D. L. (2001). PAUP* Phylogenetic analysis using parsimony (*and other methods), 4.0 B5. Sunderland, USA: Sinauer Associates. Retrieved from http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.458.6867 [ Links ]

Tate, J. A., & Simpson, B. B. (2003). Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany, 28(4), 723-737. doi: 10.1043/02-64.1 [ Links ]

Van der Werff, H. (2002). A synopsis of Persea (Lauraceae) in Central America. Novon, 12(4), 575-586. doi: 10.2307/3393142 [ Links ]

White, T. J., Bruns, T., Lee, S., & Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., & White T. J. (Eds.), PCR Protocols: A guide to methods and applications (pp. 315-322). New York, USA: Academic Press, Inc. [ Links ]

Williams, L. O. (1977). The avocado, a synopsis of the genus Persea, subg. Persea. Economic Botany, 31(3), 315-320. Retrieved from http://www.jstor.org/stable/4253853 [ Links ]

Received: November 23, 2017; Accepted: March 20, 2018

*Corresponding author: abarrien@correo.chapingo.mx

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License