Frequency of M. hyopneumoniae, M. hyorhinis and M. hyosynoviae in nasal and lung samples from pigs with symptoms of porcine enzootic pneumonia

Miranda Morales, Rosa Elena; Rojas Trejo, Verónica; López-Cerino, Luis Enrique; Carrillo Casas, Erika Margarita; Sarmiento Silva, Rosa Elena; Trujillo Ortega, María Elena; Beltrán Figueroa, Rolando; Trigo Tavera, Francisco José; Miranda Morales, Rosa Elena; Rojas Trejo, Verónica; López-Cerino, Luis Enrique; Carrillo Casas, Erika Margarita; Sarmiento Silva, Rosa Elena; Trujillo Ortega, María Elena; Beltrán Figueroa, Rolando; Trigo Tavera, Francisco José

doi:10.22319/rmcp.v11i4.5124

Serviços Personalizados

Journal

Artigo

Indicadores

Citado por SciELO
Acessos

Links relacionados

Similares em SciELO

Mais
Mais

Permalink

Revista mexicana de ciencias pecuarias

versão On-line ISSN 2448-6698versão impressa ISSN 2007-1124

Rev. mex. de cienc. pecuarias vol.11 no.4 Mérida Out./Dez. 2020 Epub 02-Mar-2021

https://doi.org/10.22319/rmcp.v11i4.5124

Articles

Frequency of M. hyopneumoniae, M. hyorhinis and M. hyosynoviae in nasal and lung samples from pigs with symptoms of porcine enzootic pneumonia

Rosa Elena Miranda Morales^a^*

Verónica Rojas Trejo^a

Luis Enrique López-Cerino^a

Erika Margarita Carrillo Casas^b

Rosa Elena Sarmiento Silva^a

María Elena Trujillo Ortega^c

Rolando Beltrán Figueroa^c

Francisco José Trigo Tavera^d

^{^a} Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Microbiología e Inmunología. UNAM. Ciudad Universitaria, 04519, CDMX, México.

^{^b} Hospital General “Dr. Manuel Gea González”, Departamento de Biología Molecular e Histocompatibilidad. CDMX, México.

^{^c} Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia, Departamento de Cerdos. CDMX, México.

^{^d} Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia, Departamento de Patología. CDMX, México.

Abstract

M. hyopneumoniae, M. hyorhinis and M. hyosynoviae are genetically related species of the genus Mycoplasma that affect pig production. The objective of this work was the isolation and identification by PCR of M. hyopneumoniae, M. hyorhinis and M. hyosynoviae from nasal swabs and lung samples of pigs from different regions of Mexico in order to determine the frequency of these species and to evaluate PCR as a diagnostic tool for PEP. Pigs aged 4 to 8 weeks with clinical diagnosis of PEP were included. Lung samples and nasal swabs were obtained for the isolation of the Mycoplasma in liquid Friis medium and identified by species-specific PCR based on the 16S rRNA subunit. Isolation was achieved in 37.11 % (36/97) of the samples. The three Mycoplasma species were identified in lung and nasal swab samples. Mycoplasma co-infection was identified in 27.77 % (10/36). The bacterial genera associated with Mycoplasma infections were E. coli, Bordetella, Enterobacter, SCN, Corynebacterium, Pasteurella, Streptococcus, Shigella and Klebsiella. Mixed infection was present in 26 nasal swabs (45.61 %) and absent in the lungs. It was concluded that the frequency of Mycoplasma on production farms was higher than expected (40.27 %). It was also identified other Mycoplasma species involved in the development of PEP. Therefore, surveillance through isolation and molecular techniques can be of great help to breeding stock providers, as well as for removing Mycoplasma from pig farms.

Key words Mycoplasmosis; M. hyopneumoniae; M. hyorhinis; M. hyosynoviae; Porcine enzootic pneumonia

Resumen

M. hyopneumoniae, M. hyorhinis y M. hyopsynoviae son especies genéticamente relacionadas del género Mycoplasma que afectan la producción porcina. El objetivo de este trabajo fue el aislamiento e identificación por PCR de M. hyopneumoniae, M. hyorhinis y M. hyosynoviae a partir de hisopos nasales y muestras de pulmón de cerdos de diferentes regiones mexicanas para determinar la frecuencia de estas especies y evaluar la PCR como herramienta diagnóstica para NEP. Se incluyeron cerdos de 4 a 8 semanas con diagnóstico clínico de NEP. Se obtuvieron muestras de pulmón e hisopos nasales para el aislamiento de Mycoplasma en medio Friis líquido y se identificaron mediante la PCR especie-específica basada en la subunidad 16S rRNA. El aislamiento se logró en 37.11 % (36/97) muestras. Las tres especies de Mycoplasma se identificaron en muestras de pulmón e hisopos nasales. La co-infección por Mycoplasma se identificó en el 27.77 % (10/36). Los géneros bacterianos asociados a las infecciones por Mycoplasma fueron E. coli, Bordetella, Enterobacter, SCN, Corynebacterium, Pasteurella, Streptococcus, Shigella y Kebsiella. La infección mixta estuvo presente en 26 hisopos nasales (45.61 %) y ausente en pulmones. Se concluyó que la frecuencia de Mycoplasma en las fincas de producción fue mayor a la esperada (40.27 %). También se identificaron otras especies de Mycoplasma involucradas en el desarrollo de la NEP. Por lo tanto, la vigilancia asistida por el aislamiento y las técnicas moleculares pueden ser de gran ayuda para la eliminación de Mycoplasma de las explotaciones porcinas y para los proveedores de pie de cría.

Palabras clave Micoplasmosis; M. hyopneumoniae; M. hyorhinis; M. hyosynoviae; Neumonía enzoótica porcina

Introduction

The Swine Respiratory Disease Complex (PRDC) is a major health problem for the pig industry worldwide¹. It is caused by the association of infections such as Mycoplasma, porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), Pasteurella multocida, Actinobacillus pleuropneumoniae, Streptococcus suis, Haemophilus parasuis, Bordetella bronchiseptica, and Arcanobacterium pyogenes¹^,². A predisposing factor is porcine enzootic pneumonia (PEP), primarily caused by Mycoplasma hyopneumoniae³, which adheres to the respiratory epithelium, damages the ciliated cells of the trachea, bronchi and bronchioles⁴, and suppresses the immune response of the upper respiratory tract that favors the development of PRDC⁵^,⁶.

PEP is a high-prevalence chronic respiratory disease with high morbidity and low mortality. between 30 to 80 % of the pig programmed for slaughter exhibit typical consolidation lesions⁷^,⁸. Throughout the pig's productive life, the prevalence of M. hyopneumoniae increases until it reaches the age of slaughter, even in vaccinated animals⁹. Reproductive females are a reservoir that perpetuates the continuous circulation of respiratory pathogens associated with PEP¹⁰^,¹¹.

The severity of the disease differs among herds, with a high prevalence in conventional pig farms¹². The most significant clinical sign of PEP is a chronic, dry, non-productive cough that occurs in fattening pigs aged 16 to 22 wk. The main macroscopic lesion is cranio-ventral pulmonary consolidation⁵, which is histologically characterized by broncho-interstitial pneumonia with hyperplasia of the bronchus-associated lymphoid tissue (BALT)¹³. The main risk factor for PEP is vertical transmission from sow to piglet during lactation, given that vaccination does not guarantee protection¹⁴ since M. hyopneumoniae can circulate in vaccinated animals¹⁵ and in free-living animals such as wild boar, with which vulnerability to M. hyopneumoniae is shared, and which can be a reservoir of these bacteria¹⁶. The severity of the disease at the time of slaughter may be predicted of the initial prevalence at weaning, based on the variables indicative of infection (average of lung lesions, percentage of lung tissue affected, presence of M. hyopneumoniae in the bronchial epithelium and seroconversion), as there is a positive correlation between these two variables¹⁷.

Most Mycoplasma infections remain subclinical¹⁸ and may involve other species of the same bacterial genus such as M. hyorhinis, a commensal inhabitant of the upper respiratory tract mucosa and tonsils¹⁹. M hyosynoviae, a species mainly associated with acute arthritis and, to a lesser extent, with suppurative pneumonia with severe pulmonary consolidation, and pleurisy²⁰^,²¹^,²². M. hyopneumoniae, M. hyorhinis and M. hyosynoviae are genetically related species of porcine interest²³, which can be discriminated by PCR based on the hypervariable regions of the 16S subunit of the genus²³^,²⁴.

The objective of this work was the isolation and identification by PCR of M. hyopneumoniae, M. hyorhinis and M. hyosynoviae from nasal swabs and samples from pigs of different regions of the Mexican Republic, in order to determine the frequency of these species and to evaluate PCR as a diagnostic tool for enzootic swine pneumonia.

Material and methods

Animals and sample collection

Pigs aged 4 to 8 wk diagnosed with PEP according to clinical signs and with gross lesions in the lung (purple to gray areas of tissue consolidation in the cranio-ventral lung lobe) were included in this study. 40 lung samples and 57 nasal swabs were aseptically obtained by pressing against the structural wall of the tissue²⁵. Sample collection was conducted on farms in four regions of Mexico, from May 2015 to January 2016 (Table 1). Each sample was collected in duplicate for Mycoplasma isolation and for traditional bacteriology. All animal procedures were approved by the Institutional Committee for the Care and Use of Experimental Animals (CICUAE) of the National Autonomous University of Mexico, following international ethical standards.

Table 1 Regions of origin of the lung samples and nasal swabs included in this work

Samples	Geographic region	Number of samples
40 lungs	Mexico	12
40 lungs	Veracruz	28
57 nasal swabs	Hidalgo	25
57 nasal swabs	Guanajuato	32
Total		97

Mycoplasma isolation

For Mycoplasma isolation, nasal swabs were resuspended in 2 ml of Friis medium. Lung samples were frozen at -20°C until they were followed up in the laboratory. Lung samples were routinely processed by maceration in 3 ml of Friis medium for isolation¹⁸^,²⁶^,²⁷. 200 μl of the suspension of each sample in Friis medium were inoculated in 1.8 ml of Friis medium supplemented with pig serum (10 %), horse serum (10 %), and penicillin (100 μg/mL) to optimize the recovery of M. hyopneumoniae²⁸, and supplemented with L-arginine (0.05 %) for the recovery of M. hyosynoviae²⁹. Subsequently, up to 10^-6 serial dilutions were made, and, finally, 10 μL were plated onto Friis agar²⁷. Tubes were incubated at 37 °C until a color change was observed in the medium, or up to 30 d, before being discarded. Positive samples were those that developed at least one unit of color change, while samples that had no color change after 30 d were considered negative. The agar plates were incubated at 37 °C with 5 % CO₂ for 1 to 2 wk. Each isolated colony was further inoculated into 2 ml of Friis medium and incubated. After observing the color change, the cultures were evaluated to confirm their purity and subsequent use until PCR discrimination of the species.

Species-specific PCR for the identification of Mycoplasma

PCR based on the 16S rRNA subunit for the identification of the three Mycoplasma species was applied to each of the isolates. The reference strains M. hyopneumoniae ATCC 25617, M. hyorhinis ATCC 17981, M. hyosynoviae strain S-16, and M. bovis Donetta PG45-all kindly donated by Aarhus University, Aarhus, Denmark-were cultured in 50 ml medium, concentrated by centrifugation for DNA extraction according to the protocol with guanidinium thiocyanate³⁰. Each isolate was also processed for DNA extraction and stored at -70 °C until further analysis.

Amplification of the 16S rRNA subunit was performed in a total reaction volume of 25 µL containing 0.25 µL of Taq PCR Reaction Mix (Sigma-Aldrich, Austria), 10 pmol of each sense and antisense initiator (Table 2)²⁴, and 10 µl of DNA³¹. The reaction conditions were: initial denaturation at 96 °C, for 5 min, followed by 30 denaturation cycles at 94 °C for 45 s, alignment at 72 °C for 2 min, and extension at 72 °C for 4 min. DNA from pure cultures of M. hyopneumoniae ATCC 25617, M. hyorhinis ATCC 17981 and M. hyosynoviae strain S-16 were applied as positive controls, and M. bovis Donetta PG45, as negative control.

Table 2 PCR initiators based on 16S rRNA from M. hyopneumoniae, M. hyorhinis and M. hyosynoviae

Mycoplasma species	Sequence (5 -3)	Product (bp)	Reference
M. hyopneumoniae	F 5'-TTC AAA GGA GCC TTC AAG CTT C-3' R 5'-GAC GTC AAA TCA TCA TGC CTC T-3'	1000	30
M. hyorhinis	F 5' CGGGATGTAGCAATACATTCAG 3' R 5' GACGTCAAATCATCATGCCTCT 3'	1129	30
M. hyosynoviae	F 5' CAGGGCTCAACCCTGGCTCGC 3' R 5' GACGTCAAATCATCATGCCTCT 3'	585	This work Gen Bank Access No. NR029183. 1

Results

Mycoplasma isolation

97 samples were collected: 40 from lungs with typical Mycoplasma lesions suggestive of PEP (Figure 1) and 57 nasal swabs from pigs from different geographical regions of Mexico (Table 1). From the lung samples, 22.5 % (9/40) were positive to the isolation of Mycoplasma spp and 77.5 % (31/40) were negative. Of the nasal swabs, 47.36 % (27/57) were positive, and 52.63 % (30/57) were negative. In the positive samples, the color change of the culture medium was observed as early as the 5th d or until the 12th d. On average, the color change was observed on the 7th d. The remaining samples were considered as negative after 30 d without color change.

In (A) lung with typical PEP injury, distributed over all lobes of the lung, (B) approach to lung consolidation, (C) lung with higher degree of lung consolidation, (D) lung sequestration resulting from the evolution of the injury, (E) evidence of scarring in the lung tissue.

Figure 1 Typical Mycoplasma lesions in the lungs collected for this study

PCR results

Amplified fragments of 1,000 bp of M. hyopneumoniae, 1,129 bp of M. hyorhinis, and 585 bp of M. hyosynoviae using the reference strains (ATCC 25617, ATCC 17981, and M. hyosynoviae strain S-16), were visualized by 1.5% agarose gel electrophoresis at 80 V for 60 min, stained with ethidium bromide and displayed on a UV transilluminator, as shown in Figure 2. 22 % (2/9) of the lung sample isolates (LSIs) of Mycoplasma tested positive for M. hyopneumoniae; 55.5 % (5/9), for M. hyorhinis, and 44 % (4/9), for M. hyosynoviae. 44 % (4/9) of the LSIs tested negative with species-specific PCR. 7.40 % (2/27) of the nasal swab isolates (NSIs) tested positive for M. hyopneumoniae; 51.85% (14/27), for M. hyorhinis, and 33.3 % (9/27), for M. hyosynoviae. 22.22 % (6/27) of the NSIs tested negative with species-specific PCR (6/27) (Table 3). Despite having been successfully isolated, four LSIs and six NSIs remained unidentified with the species-specific PCR.

Lane 1, Molecular Weight Marker (1 Kb plus Invitrogen), Lane 2, M. hyopneumoniae ATCC 25617, 1000 bp; Lane 3. M. bovis Donetta PG45, donated by the University of Aarhus, Denmark, Lane 4, M. hyorhinis, ATCC17981, 585 bp, Lane 6, Unrelated product with 685 bp of p97 protein from M. hyopneumoniae, ATCC25617, Lane 7, M. hyosynoviae, strain S-16, 1129 bp, also donated by the University of Aarhus, Denmark, Lane 8, Molecular Weight Marker (1 Kb plus Invitrogen).

Figure 2 Electrophoretic profiles of the amplified fragments of M. hyopneumoniae, M. hyorhinis and 16S rRNA

Table 3 List of isolates identified by species-specific PCR for M. hyopneumoniae, M. hyorhinis, and M. hyosynoviae

Sample	Positive isolation (%)
Sample	M. hyopneumoniae	M. hyorhinis	M. hyosynoviae	Mycoplasma spp isolates
Lung	2/9 (22.0)	5/9 (55.5)	4/9 (44.0)	4/9 (44.0)
Nasal swab	2/27 (7.4)	14/27 (51.8)	9/27 (33.3)	6/27 (22.2)
Total	4/36 (11.1)	19/36 (52.7)	13/36 (36.1)	10/36 (27.7)

The coexistence of M. hyopneumoniae, M. hyorhinis and M. hyosynoviae was detected in ten samples representing 27.77 % (10/36): in two lungs all three species, in two other lungs and five nasal swabs M. hyorhinis and M. hyosynoviae were identified, and only one swab contained M. hyopneumoniae and M. hyorhinis (Complementary Table 1). Additionally, the associated bacterial genera identified by general bacteriology in nasal swabs were E. coli, Enterobacter, coagulase-negative Staphylococcus, Klebsiella, Bordetella, Corynebacterium, Pasteurella, Shigella and Streptococcus. No bacterial growth was identified in lung samples.

Supplementary table 1 Identification of Mycoplasma isolates by species-specific PCR

Number	Description	Type of sample*	M. hyop	M. hyor	M. hyos	Bacterial Genera
1	111	NS	-	+	-	CNS
2	112	NS	-	+	+	E. coli , Shigella
3	113	NS	-	-	-	Pasteurella
4	114	NS	-	-	-	Klebsiella, CNS
5	115	NS	-	+	+	Klebsiella, E. coli, CNS
6	116	NS	-	+	-	E. coli, CNS, Bordetella, Corynebacterium
7	117	NS	-	+	-	CNS, Corynebacterium
8	118	NS	-	+	-	CNS, Corynebacterium
9	119	NS	-	-	+	Enterobacter
10	120	NS	-	+	-	Corynebacterium
11	121	NS	-	-	-	Klebsiella, CNS
12	122	NS	-	+	+	Corynebacterium
13	123	NS	-	-	+	Klebsiella, CNS
14	124	NS	-	-	+	CNS
15	125	NS	-	+	-	Corynebacterium
16	126	NS	-	-	-	Corynebacterium
17	127	NS	-	-	-	Klebsiella, Corynebacterium
18	130	NS	+	-	-	CNS
19	133	NS	-	-	-	E. coli
20	148	NS	-	+	-	CNS
21	159	NS	+	+	-	No bacterial growth
22	160	NS	-	+	-	CNS
23	161	NS	-	-	+	Pasteurella
24	162	NS	-	+	+	E. coli, CNS
25	165	NS	-	+	-	Streptococcus, CNS
26	168	NS	-	+	-	E. coli
27	170	NS	-	+	+	CNS
28	182	L	-	+	+	No bacterial growth
29	183	L	-	+	+	No bacterial growth
30	186	L	-	-	-	No bacterial growth
31	188	L	-	-	-	No bacterial growth
32	194	L	+	+	+	No bacterial growth
33	206	L	+	+	+	No bacterial growth
34	207	L	-	+	-	No bacterial growth
35	208	L	-	-	-	No bacterial growth
36	210	L	-	-	-	No bacterial growth

M. hyop = M hyopneumoniae: M. hyor= M. hyorhinis; M. hyos= M. hyosynoviae; *NS= nasal swab, L= lung, CNS= Coagulase-negative Staphylococcus

Discussion

In Mexico there are few studies on the association of these three Mycoplasma species with PEP, mainly due to the difficulties for their isolation and to those inherent in the biological sample. The concentration of microorganisms is often below the detection limit as a result of the widespread use of antibiotics for the control of porcine mycoplasmosis. Therefore, isolation procedures are necessary to encourage their growth and identification for research and surveillance purposes. The procedure used allowed the association identification of the three species related to pig production.

M. hyopneumoniae is the most frequently isolated species of Mycoplasma from pigs with clinical signs of pneumonia and has a low transmission rate. However, in association can increase the severity of infections caused by viruses and bacteria³².

M. hyorhinis has gone from being a secondary pathogen³³^,³⁴, to being considered a causal agent of PEP and PRDC³⁵. In this study, this species of Mycoplasma is the most prevalent in nasal swabs 51.85% (14/57); this observation can be explained by the success of the control measures that have been implemented in pig production farms. This study reports herein that M. hyosynoviae is in close interaction with the other two Mycoplasma species in lungs with typical PEP lesions. M. hyosynoviae was present in nasal swabs as a microorganism associated in a high percentage of the cases (33%, i.e. 9/27). Therefore, this commensal Mycoplasma species may have pathogenic potential, and further studies will be required to assess its role in the development of PEP.

Bacteriological culture is the "gold standard" for diagnosis. However, among its drawbacks, it is very laborious, it is seldom used as a routine method, and it does not distinguish between species associated with PEP. PCR based on the 16S rRNA subunit allowed to discern, quickly and precisely, between M. hyopneumoniae and M. hyorhinis. On the other hand, 10 cases were identified in which the species evaluated in this work were not involved. This result raises the possibility that other Mycoplasma species may be involved.

The collection method (nasal swab, tracheobronchial mucus, deep postmortem swab, bronchoalveolar lavage or lung tissue) has a significant effect on the frequency of M. hyopneumoniae, since the reported frequency varies between 3 and 40 %, according to the method used³⁶. Hitherto, nasal swabs have been the method of antemortem sample collection in piglets at herd level²⁸^,³⁷. Pieters et al³⁸ suggest that laryngeal swabs are useful in the early stage of infection in piglets. Other authors state that the optimal sampling site for detection by molecular methods for M. hyopneumoniae is tracheobronchial mucus collection (TBMC), since its sensitivity is 3.5 times more sensitive in piglets aged under 25 d³⁶.

The upper respiratory tract (nasal cavity and pharynx) plays an important role in monitoring and cleansing pathogenic microorganisms and also in inducing the appropriate immune response. M. hyopneumoniae mainly colonizes the cilia of the respiratory tract of the pigs³⁹. In adult animals from production farms, TBMC becomes difficult and expensive to obtain. Animal handling is restricted in keeping with current swine influenza prevention measures, and, based on this experience, it is recommend the use of nasal swabs as the appropriate sampling technique.

The prevalence of M. hyopneumoniae in naturally infected sows is 36.4 %⁴⁰; in piglets, it can vary from 3.6 to 16 %. The frequency of Mycoplasma determined here was higher than expected, namely: 37.11 % (36/97). Mycoplasma was present in the lungs of 22.50 % of the animals, (9/40), and in nasal swabs, in 47.36 % (27/57). Infection by a single Mycoplasma species was 44.44 % (16/36): in LSIs 11.11 % (1/9) and in NSIs 55.55 % (15/27). The association of more than one Mycoplasma species was present in 27.77 % (10/36): the association of the three species represented 2 % (2/10), and the association of M. hyorhinis and M. hyosynoviae 5.15% (5/10). Co-infection of M. hyopneumoniae and M. hyorhinis, and M. hyosynoviae and M. hyorhinis have previously been associated with joint problems. In this work, both associations were identified in the respiratory tract of animals in pig farms with PEP.

The rate of Mycoplasma associated with PEP is variable, regardless of whether the rate of mixed infections remains constant³⁵. In this study, the bacterial genera associated in mixed infections were similar to those previously reported⁴¹. PCR can be complementary or alternative to histopathological diagnosis and represents an option for epidemiological surveillance and research. In addition, it can assist in the elimination of Mycoplasma spp from swine production farms, as it is the best long-term control strategy, so far, for many swine producers and breeding stock suppliers⁴².

Conclusions and implications

The frequency of Mycoplasma in pig farms in the states of Hidalgo, Guanajuato, Veracruz and Mexico was higher than expected (40.27 %). There are other Mycoplasma species that may be involved in the development of PEP, and this paper adds evidence of M. hyorhinis as a causal agent of PEP.

Acknowledgements

This work was supported by the Project DGAPA UNAM PAPITT IN 222515.

REFERENCES

1. Hansen MS, Pors SE, Jensen HE, Bille-Hansen V, Bisgaard M, Flachs EM, et al. An investigation of the pathology and pathogens associated with porcine respiratory disease complex in Denmark. J Comp Pathol 2010;143(2-3):120-131. [ Links ]

2. Sibila M, Pieters M, Molitor T, Maes D, Haesebrouck F, Segales J. Current perspectives on the diagnosis and epidemiology of Mycoplasma hyopneumoniae infection. Vet J 2009;181(3):221-231. [ Links ]

3. Maes D, Segales J, Meyns T, Sibila M, Pieters M, Haesebrouck F. Control of Mycoplasma hyopneumoniae infections in pigs. Vet Microbiol 2008;126(4):297-309. [ Links ]

4. Seymour LM, Deutscher AT, Jenkins C, Kuit TA, Falconer L, Minion FC, et al. A processed multidomain Mycoplasma hyopneumoniae adhesin binds fibronectin, plasminogen, and swine respiratory cilia. J Biol Chem 2010;285(44):33971-33978. [ Links ]

5. Thacker EL, Minnion FC. Mycoplasmosis. In. Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW, editors. Diseases of Swine. USA; Wiley-Blackwell; 2012:779-797. [ Links ]

6. Shen Y, Hu W, Wei Y, Feng Z, Yang Q. Effects of Mycoplasma hyopneumoniae on porcine nasal cavity dendritic cells. Vet Microbiol 2017;198:1-8. [ Links ]

7. Pointon AM, Byrt D, Heap P. Effect of enzootic pneumonia of pigs on growth performance. Aust Vet J 1985;62(1):13-18. [ Links ]

8. Ross RF, Mycoplasmal diseases. In: Leman AD, Straw B, Mengeling W, D’Allaire S, Taylor D, editors. Diseases of swine,7 ^th ed. Ames, Iowa, USA: Iowa State University Press; 1992:537-551. [ Links ]

9. Sibila M, Nofrarias M, López-Soria S, Segalés J, Valero O, Espinal A, et al. Chronological study of Mycoplasma hyopneumoniae infection, seroconversion and associated lung lesions in vaccinated and non-vaccinated pigs. Vet Microbiol 2007;122(1-2):97-107. [ Links ]

10. Fablet C, Marois C, Kuntz-Simon G, Rose N, Dorenlor V, Eono F, et al. Longitudinal study of respiratory infection patterns of breeding sows in five farrow-to-finish herds. Vet Microbiol 2011;147:329-339. [ Links ]

11. Takeuti K, De Barcellos D, de Lara A, Kunrath C, Pieters M. Detection of Mycoplasma hyopneumoniae in naturally infected gilts over time. Vet Microbiol 2007;203:215-220. [ Links ]

12. Sibila M, Calsamiglia M, Vidal D, Badiella L, Aldaz A, Jensen JC. Dynamics of Mycoplasma hyopneumoniae infection in 12 farms with different production systems. Can J Vet Res 2004;68(1):12-18. [ Links ]

13. Caswell JL, Williams K. The respiratory system. In: Maxie MG et al. editors. Jubb, Kennedy, and Palmer’s Pathology of Domestic Animals, 5^th ed. Edinburgh, UK: Elsevier; 2007:523-655. [ Links ]

14. Meyns T, Dewulf J, de Kruif A, Calus D, Haesebrouck F, Maes D. Comparison of transmission of Mycoplasma hyopneumoniae in vaccinated and non-vaccinated populations. Vaccine 2006:24(49-50):7081-7086. [ Links ]

15. Maes D, Deluyker H, Verdonck M, Castryck F, Miry C, Vrijens B, et al. Effect of vaccination against Mycoplasma hyopneumoniae in pig herds with an all-in/all-out production system. Vaccine 1999;17(9):1024-1034. [ Links ]

16. Sibila M, Mentaberre G, Boadella M, Huerta E, Casas-Díaz E, Vicente J, et al. Serological, pathological and polymerase chain reaction studies on Mycoplasma hyopneumoniae infection in the wild boar. Vet Miocrobiol 2010;144(1-2):214-218. [ Links ]

17. Fano E, Pijoan C, Dee S, Deen J. Effect of Mycoplasma hyopneumoniae colonization at weaning on the disease severity in growing pigs. Can J Vet Res 2007;71(3):195-200. [ Links ]

18. Friis FN. A selective medium for Mycoplasma suipneumoniae. Acta Vet Scand 1971;12(3):454-466. [ Links ]

19. Maré CJ, Switzer WP. Virus pneumonia of pigs: propagation and characterization of a causative agent. Am J Vet Res 1966;27(121):1687-1693. [ Links ]

20. Ross R, Hill M, Wood RL. Swine Arthritis. Pork Industry Handbook. Herd Health. USA, Michigan State University Cooperative Extension Service; 2003:1-4. [ Links ]

21. Hagedorn-Olsen T, Nielsen NC, Friis NF. Induction of arthritis with Mycoplasma hyosynoviae in pigs: Clinical response and re-isolation of the organism from body fluids and organs. Zentralbl Veterinarmed A 1999;46(6):317-325. [ Links ]

22. Dahlia H, Tan LJ, Zarrahimah Z, Maria J. Isolation of Mycoplasma hyosynoviae from pneumonic lung of swine. Trop Biomed 2009;26(3):341-345. [ Links ]

23. Stemke GM, Laigret F, Grau O, Bove JM. Phylogenetic relationships of three porcine mycoplasmas; Mycoplasma hyopneumoniae, Mycoplasma flocculare, and Mycoplasma hyorhinis, and complete 16S rRNA sequence of M. flocculare. Int J Syst Bacteriol 1992;42(2):220-225. [ Links ]

24. Stakenborg T, Vicca J, Butaye P, Imberechts H, Peeters J, De Kruif A, et al. A Multiplex PCR to identify porcine Mycoplasmas present in broth cultures. Vet Res Comm 2006;30(3):239-247. [ Links ]

25. Pieters M, Pijoan C, Fano E, Dee S. An assessment of the duration of Mycoplasma hyopneumoniae infection in an experimentally infected population of pigs. Vet Microbiol 2009;134(3-4):261-266. [ Links ]

26. Cook BS, Beddow JG, Manso-Silván L, Maglennon GA, Rycroft AN. Selective medium for culture of Mycoplasma hyopneumoniae. Vet Microbiol 2016;195:158-164. [ Links ]

27. Friis NF. Some recommendations concerning primary isolation of Mycoplasma suipneumoniae and Mycoplasma flocculare a survey. Nord Vet Med 1975;27(6):337-339. [ Links ]

28. Marois C, Le Carrou J, Kobisch M, Gautier-Bouchardon AV. Isolation of Mycoplasma hyopneumoniae from different sampling sites in experimentally infected and contact SFP piglets. Vet Microbiol 2007;120(1-2):96-104. [ Links ]

29. Kobisch M, Friis NF. Swine Mycoplasmoses. Rev Sci Tech Off Int Epiz 1996;15(4):1569-1605. [ Links ]

30. Nelson JE, Krawetz SA. Purification of cloned and genomic DNA by guanidine thiocyanate/isobutyl alcohol fractionation. Ann Biochem 1992;207(1):197-201. [ Links ]

31. Nathues H, Beilage E, Kreienbrock L, Rosengarten R, Spergser J. RAPD and VNTR analyses demonstrate genotypic heterogeneity of Mycoplasma hyopneumoniae isolates from pigs housed in a region with high pig density. Vet Microbiol 2011;152(3-4):338-345. [ Links ]

32. Opriessnig T, Thacker EL, Yu S, Fenaux M, Meng XJ, Halbur PG. Experimental reproduction of postweaning multisystemic wasting syndrome in pigs by dual infection with Mycoplasma hyopneumoniae and porcine circovirus type 2. Vet Pathol 2004;41(6):624-640. [ Links ]

33. Charlebois A, Marois-Créhan C, Hélie P, Gagnon CA, Gottschalk M, Archambault M. Genetic diversity of Mycoplasma hyopneumoniae isolates of abattoir pigs. Vet Microbiol 2014;168(2-4):348-356. [ Links ]

34. Kawsashima K, Yamada S, Kobayashi H, Narita M. Detection of porcine reproductive and respiratory syndrome virus and Mycoplasma hyorhinis antigens in pulmonary lesions of pigs suffering from respiratory distress. J Comp Pathol 1996;114(3):315-323. [ Links ]

35. Lin J, Chen S, Yeh K, Weng C. Mycoplasma hyorhinis in Taiwan: Diagnosis and isolation of swine pneumonia pathogen. Vet Microbiol 2006;115(1-3):111-116. [ Links ]

36. Vangroenweghe F, Karriker L, Main R, Christianson E, Marsteller T, Hammen K, et al. Assessment of litter prevalence of Mycoplasma hyopneumoniae in preweaned piglets utilizing an antemortem tracheobronchial mucus collection technique and a real-time polymerase chain reaction assay. J Vet Diagn Invest 2015;27(5):606-610. [ Links ]

37. Kurth KT, Hsu T, Snook ER, Thacker EL, Thacker BJ, Minion FC. Use of a Mycoplasma hyopneumoniae nested polymerase chain reaction test to determine the optimal sampling sites in swine. J Vet Diagn Invest 2002;14(6):463-469. [ Links ]

38. Pieters M, Daniels J, Rovira A. Comparison of sample types and diagnostic methods for in vivo detection of Mycoplasma hyopneumoniae during early stages of infection. Vet Microbiol 2017;203:103-109. [ Links ]

39. Maes D, Verdonck M, Deluyker H, de Kruif A. Enzootic pneumonia in pigs. Vet Q 1996;18(3):104-109. [ Links ]

40. Takeuti KL, de Barcellos DESN, de Lara AC, Kunrath CF, Pieters M. Detection of Mycoplasma hyopneumoniae in naturally infected gilts over time. Vet Microbiol 2017;203:215-220. [ Links ]

41. Siquiera FM, Pérez-Wohlfeil E, Carvalho FM, Trelles O, Schrank IS, Vasconcelos ATR, et al. Microbiome overview in swine lungs. PLosONE 2017;12(7):e0181503. [ Links ]

42. Holst S, Yeske P, Pieters M. Elimination of Mycoplasma hyopneumoniae from breed-to-wean farms: a review of current protocols with emphasis on herd closure and medication. J Swine Health Prod 2015;23(6):321-230. [ Links ]

Received: October 29, 2018; Accepted: September 09, 2019

Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons