Genetic diversity and virulence factors of Staphylococcus aureus strains isolated from bovine udder skin

Adame-Gómez, Roberto; Toribio-Jimenez, Jeiry; Castro-Alarcón, Natividad; Talavera-Alarcón, Karina; Flores-Gavilan, Jacqueline; Pineda-Rodríguez, Sandra-Alheli; Ramírez-Peralta, Arturo; Adame-Gómez, Roberto; Toribio-Jimenez, Jeiry; Castro-Alarcón, Natividad; Talavera-Alarcón, Karina; Flores-Gavilan, Jacqueline; Pineda-Rodríguez, Sandra-Alheli; Ramírez-Peralta, Arturo

doi:10.22319/rmcp.v12i3.5646

Servicios Personalizados

Revista

Articulo

Indicadores

Citado por SciELO
Accesos

Links relacionados

Similares en SciELO

Otros
Otros

Permalink

Revista mexicana de ciencias pecuarias

versión On-line ISSN 2448-6698versión impresa ISSN 2007-1124

Rev. mex. de cienc. pecuarias vol.12 no.3 Mérida jul./sep. 2021 Epub 14-Mar-2022

https://doi.org/10.22319/rmcp.v12i3.5646

Articles

Genetic diversity and virulence factors of Staphylococcus aureus strains isolated from bovine udder skin

Roberto Adame-Gómez^a

Jeiry Toribio-Jimenez^b

Natividad Castro-Alarcón^c

Karina Talavera-Alarcón^a

Jacqueline Flores-Gavilan^a

Sandra-Alheli Pineda-Rodríguez^d

Arturo Ramírez-Peralta^a^*

^{^a} Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Patometabolismo Microbiano. Chilpancingo, Guerrero, México.

^{^b} Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Microbiología Molecular y Biotecnología Ambiental. Chilpancingo, Guerrero, México.

^{^c} Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Microbiología. Chilpancingo, Guerrero, México.

^{^d} Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Parasitología. Chilpancingo, Guerrero, México.

Abstract

Staphylococcus aureus is a pathogen recognized as a cause of mastitis in cattle worldwide, so the objective of this work was to determine the presence of Staphylococcus aureus in the teat skin of the bovine udder and relate it to the presence of mastitis, as well as to determine the virulence factors and genetic diversity of the strains. Samples of 250 milking cows were taken in three farms, in two seasons of the year, dry and rainy. In addition, the California test was performed. Staphylococcus aureus was isolated in salt agar and mannitol and biochemically identified and confirmed with amplification of the femA gene. For the identification of virulence factors, the genes hlB, mec, saK, pvL, tsst-1, seA, seB, seC, seD and seE were used by end-point PCR. For the typing of S. aureus, amplification and restriction of the coag gene was performed. The frequency of S. aureus was 13.4 %. No statistical relationship between the presence of S. aureus in the bovine udder skin and the development of subclinical mastitis was found. The most frequent enterotoxin gene in the strains was enterotoxin A. Although the percentage of typing is low, it was possible to identify two restrictotypes that group strains isolated from different cows, which shows the infectious and contagious capacity of the microorganism.

Key words Bovine udder; Staphylococcus aureus; Genetic diversity; Mastitis

Resumen

Staphylococcus aureus es un patógeno reconocido como causa de mastitis en bovinos a nivel mundial, por lo cual el objetivo de este trabajo fue determinar la presencia de Staphylococcus aureus en la piel de pezón de la ubre bovina y relacionarlo a la presencia de mastitis, así como determinar los factores de virulencia y la diversidad genética de las cepas. En tres establos se tomaron muestras de 250 vacas de ordeña en dos temporadas del año, estiaje y lluvias. Además, se realizó la prueba de California. Staphylococcus aureus fue aislado en agar sal y manitol e identificado bioquímicamente y confirmado con la amplificación del gen femA. Para la identificación de los factores de virulencia se usaron los genes hlB, mec, saK, pvL, tsst-1, seA, seB, seC, seD y seE por PCR en punto final. Para la tipificación de S. aureus, se realizó la amplificación y restricción del gen coag. La frecuencia de S. aureus fue 13.4 %. No se encontró una relación estadística entre la presencia de S. aureus en la piel de la ubre bovina y el desarrollo de mastitis subclínica. El gen de la enterotoxina más frecuente en las cepas fue el de la enterotoxina A. Aunque el porcentaje de tipificación es bajo, se lograron identificar dos restrictotipos que agrupan cepas aisladas de diferentes vacas, lo cual evidencia la capacidad infectocontagiosa del microorganismo.

Palabras clave Ubre bovina; Staphylococcus aureus; Diversidad genética; Mastitis

Introduction

Bovine mastitis (MB) is the inflammation of the mammary gland caused in most cases by a microorganism, which invades the udder through the teat canal¹^,². This disease is classified, according to the clinical manifestations it presents, into clinical mastitis (CM) and subclinical bovine mastitis (SCM), the latter being the most common clinical entity³. Although there are numerous bacterial genera that cause mastitis, only a small number of species are prevalent and constitute a real public health problem².

Staphylococcus aureus is recognized as a pathogen worldwide for causing mastitis⁴, being responsible for approximately one third of cases of clinical and subclinical mastitis in cattle⁵^,⁶, being considered a problem in the livestock industry due to its pathogenicity, persistence in the environment, ease of contagion between cow and cow during the milking process²^,⁷, due to the low rates of resolution of the disease with current treatments⁸, leading to chronic infections, which persist between periods of lactation, with intermittent clinical episodes occurring from the elevation of temperature, degrees of anorexia, the appearance of clots in milk¹, which increases the risks of slaughter of the animal, work, treatment and replacement costs, veterinary visits, incorporation of protocols to avoid risk with investment in infrastructure as well as the implementation of diagnostic methods more frequently⁹. However, mastitis not only has an impact on the producer’s economy, but also becomes a public health problem by being a potential source of zoonotic transmission, since S. aureus has been described as capable of causing disease in humans¹⁰^,¹¹. Bovine mastitis has relevance in the context of food poisoning in humans. Ingestion of products contaminated with staphylococcal enterotoxins results in poisoning characterized by violent vomiting and diarrhea¹². Among the factors related to an infection by S. aureus in the mammary gland is hygiene both in milking and in the udder of the animal¹³^,¹⁴.

In recent years, it has been suggested that the colonization of the udder skin could be a predominant factor in the development of mastitis by dragging the microorganism during milking towards the animal’s teat; however, several studies differ in relation to this assertion. Cases of S. aureus mastitis have been described as being caused by strains highly adapted to the mammary gland and that they are different from skin isolates²^,¹⁵. While other studies suggest that most S. aureus isolated from the skin and teat canal as well as extra mammary sites such as vagina, nostrils and skin of the jaws are genetically the same as those found in mammary glands or milk¹⁶^-¹⁸. Therefore, the objective of this study was to determine the frequency of S. aureus in the skin of the teats of udders of cows from three dairy farms located in the south of the state of Guerrero, Mexico, the genetic diversity and virulence factors of the strains of S. aureus, as well as the possible relationship with bovine mastitis.

Material and methods

Farms and sampling

Three farms were included in the study. Based on the permission of the owners and the size of the farm. A sample of the teat skin was taken from the four quarters of the 250 milking cows, in two different seasons of the year: rains and dryness, having a total of 500 samples. The samples were taken with a cotton swab, which was slid on each edge of the teat and around it, covering an area of 2 cm. The California test was then performed, considering the interpretation of the test described above. All farms sell raw milk directly to consumers and one of them is characterized for being a site for the production of cheeses made with raw milk. On this farm, raw milk is collected during the morning and directly processed in a small artisanal cheese production plant.

Isolates

Samples taken with swabs from the teat skin were cultured in salt agar and mannitol. The isolates were presumptively identified as S. aureus according to the following scheme: mannitol positive, catalase positive, Gram positive cocci and coagulase positive in 6 h. The isolates were preserved at -20 °C in BHI (Brain Heart Infusion) broth with 15 % (V / V) of glycerol.

Molecular identification of S. aureus

The strains were cultured in brain-heart infusion broth and incubated at 37 °C. The control strains used in this study were S. aureus ATCC29231 (sea), S. aureus ATCC14458 (seb), S. aureus ATCC19095 (sec), S. aureus ATCC13563 (sed), S. aureus ATCC27664 (see) and S. aureus ATCC25923 (femA, coag, hlb, sak).

The total DNA was obtained from 1 ml from an 18 h culture of all bacterial strains including ATCC strains. The cells were sedimented from the centrifugation of cultures at 10,000 rpm for 10 min and suspended in 300 μl of lysis buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0, lysozyme 1 mg/ml) and incubated at 37 °C for half an hour or until viscosity is observed. DNA from all preparations was subsequently extracted with phenol chloroform and precipitated with ethanol. DNA samples were diluted in TE buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0)¹⁹.

An end-point PCR of the femA gene was performed on the strains for molecular confirmation of S. aureus with the oligonucleotides described in Table 1. The final PCR reaction mixture contained 0.2 mM of each dNTP, 3 mM of MgCl₂, 0.2 mM of oligonucleotides, 1 U taq DNA polymerase (Amplicon, Denmark) 5 μl of 10X buffer and 100 ng of DNA as a template.

Table 1 Oligonucleotides used for molecular identification, detection of enterotoxin genes, and molecular typing

Gene (virulence factor)	Sequence (5'- 3')	APS	Ref.
femA	femaF- AAAAAAGCACATAACAAGCG femaR- GATAAAGAAGAAAACCAGCAG	130	(20)
coa (coagulase)	coaF- CGAGACCAAGATTCAACAAG coaR- AAAGAAAACCACTCACATCA	600- 900	(22)
seA (enterotoxin A)	seaF- TGCAGGGAACAGCTTTAGGC seaR- GTGTACCACCCGCACATTGA	250	(20)
seB (enterotoxin B)	sebF- ATTCTATTAAGGACACTAAGTTAGGG sebR- ATCCCGTTTCATAAGGCGAGT	400
seC (enterotoxin C)	secF- GTAAAGTTACAGGTGGCAAAACTTG secR- CATATCATACCAAAAAGTATTGCCGT	297
seD (enterotoxin D)	sedF- GAATTAAGTAGTACCGCGCTAAATAATA TG sedR- GCTGTATTTTTCCTCCGAGAGT	492
seE (enterotoxin E)	seeF- CAAAGAAATGCTTTAAGCAATCTTAGGC seeR- CACCTTACCGCCCAAAGCTG	480
hlB (hemolysin β)	hlbF- GTGCACTTACTGACAATAGTGC hlbR- GTTGATGAGTAGCTACCTTCAGT	300
saK (staphylokinase)	sakF- ATCCCGTTTCATAAGGCGAGT sakR- CACCTTACCGCCCAAAGCTG	260	In this study
mecA (Methicillin resistance)	mecaF- TCCAGATTACAACTTCACCAGG mecaR- CCACTTCATATCTTGTAACG	180	(21)
tsst-1 (toxic shock syndrome toxin)	tsstF- CATCTACAAACGATAATATAAAGG tsstR- CATTGTTATTTTCCAATAACCACCCG	476	In this study

APS= amplified product size (pb); Ref.= reference.

Identification of coding genes for virulence factors

The detection of the genes hlB, mec, saK, pvL, tsst-1, seA, seB, seC, seD and seE encoding β-hemolysin, methicillin resistance region, staphylokinase, Panton Valentine toxin, toxic shock syndrome toxin and enterotoxins respectively, was based end-point PCR with the oligonucleotides described in Table 1. The final PCR reaction mixture contained: 0.2 mM of each dNTP, 3 mM MgCl₂, 0.2 μM of oligonucleotides, 1 U of Taq DNA polymerase (Ampliqon®, DEN), 1X Buffer and 100 ng of DNA as a template. The reaction mixtures were subjected to the following amplification conditions: initial denaturation for 5 min, at 94 °C; 30 cycles of 30 sec at 94 °C, 30 sec at 52 °C, 30 sec at 72 °C; and a final extension for 5 min at 72 °C for mec, hlB, pvL, tsst-1, seA and seE. Initial denaturation for 5 min at 94 °C; 30 cycles of 30 sec at 94 °C, 45 sec at 52 °C, 45 sec at 72 °C; and a final extension for 5 min at 72 °C for saK, seB, seC and seD²⁰^,²¹.

The electrophoresis of the PCR products was performed in 2 % agarose gels at 80 V for 60 min. The gels were stained with Midori green (Nippon Genetics®, GER) and visualized with LED light (Nippon Genetics®, GER) at 470 nm.

Phenotypic test to show the expression of the hlB gene

To demonstrate the expression of the β-hemolysin, the strains were cultured by cross-streak in 5 % ram blood agar, being incubated at 37 °C in CO₂ tension for 24 h. Strains that had a halo of transparency in the perimeter of the colonies are considered β-hemolytic (hlB+). Strains that presented α and γ-hemolysis are considered hlB ^-.

Molecular typing of S. aureus

In the strains molecularly confirmed as S. aureus, the coag gene was amplified by end-point PCR with the oligonucleotides described in Table 1 and with the following final mixture for each PCR reaction: 0.2 mM of each dNTP, 3 mM MgCl₂, 0.2 μM oligonucleotides, 1 U of Taq DNA polymerase (Ampliqon®, DEN), 1X Buffer and 100 ng of DNA as a template. The PCR protocol begins with initial denaturation for 5 min, at 94 °C; 30 cycles of 30 sec at 94 °C, 30 sec at 52 °C, 60 sec at 72 °C; and a final extension for 5 min at 72 °C²². PCR products were digested for 2 h at 37 °C with 10 U of the restriction enzyme AluI (Thermo Scientific®, USA) according to the protocol recommended by the manufacturer. Restriction fragments were detected by electrophoresis in 2 % agarose gels at 70 V for 60 min. The gels were stained with Midori green (Nippon Genetics®, GER) and visualized with LED light (Nippon Genetics®, GER).

Statistical analysis

The STATA V. 12 statistical package (STATA®, USA) was used to calculate simple frequencies and the Chi-square statistical test was used for possible relationships between the presence of S. aureus in the bovine udder skin and the development of subclinical mastitis, values of P= <0.05 are considered as statistically significant.

Results and discussion

In this study, of the total number of cows analyzed in the two periods, a frequency of subclinical mastitis of 6.6 % (33/500) and clinical mastitis of 0.8 % (4/500) was determined. The frequency of subclinical mastitis per dairy farm was higher in farm A (12 %) in relation to B (4 %) and C (1 %) (P=0.001) (Table 2). These differences in frequency may be related to the implementation or compliance with well-characterized strategies for the control of intra mammary infections or known as the 5-point plan, which includes the milking sequence, use of gloves, change of paper or cloth towel between the udder quarters, pre-seal and post-seal of the teat ²³. In addition to other factors such as the presence of infections and their time of evolution²⁴, the nature of the infectious agent, the parity and the state of lactation of the animal, as well as the nutrition and the environment where it is²⁵. In this last point, it is known that the rainy season (summer) is an environmental risk factor for the development of mastitis, being more frequent the appearance of cases during this season in relation to others such as winter²⁶, which was observed in our study, in which, during the rainy period, the frequency of subclinical mastitis was higher (10.8 %) in relation to the dry season (2.4 %) (P=0.001). Several authors agree on this statement, considering that humidity may have an important role; however, they also conclude that this period could coincide with the onset of lactation or the end of gestation, which should generally be considered for cows of first parity during the season with the most desirable climate, in this case summer, during which the availability of grass and therefore of feed is greater²⁷^,²⁸.

Table 2 Frequency of subclinical and clinical mastitis in relation to dairy farms, season and presence of S. aureus in the teat of cows’ udders

Characteristic	Total	California Test				p
Characteristic	Total	Negative	Traces	Subclinical mastitis	Clinical mastitis	p
Dairy farm
A	200	8 (4)	164 (82)	24 (12)	4 (2)	0.001
B	200	4 (2)	188 (94)	8 (4)	0
C	100	0	99 (99)	1 (1)	0
Season
Rainy	250	11 (4.4)	208 (83.2)	27 (10.8)	4 (1.6)	0.001
Dry	250	1 (0.4)	242 (97.8)	6 (2.4)	0	0.001
S. aureus in udder
Positive	67	0	66 (98.5)	1 (1.5)	0	0.106
Negative	433	12 (2.7)	385 (88.9)	32 (7.5)	4 (0.9)	0.106

Cases of clinical mastitis only occurred in dairy farm A (2 %) and in the rainy season (1.6 %) (P=0.001). In the case of the isolation of the microorganism of interest from the teat skin of the udder of the cows analyzed, the frequency of S. aureus from the identification of the femA gene was 13.4 % (67/500) (Figure 1, Table 2). Other markers are used to determine the species of S. aureus such as the thermonuclease gene (nuc)²⁹ and the region of the 16 rRNA gene³⁰; however, the nuc gene can be found in other Staphylococcus species coagulase-positive (S. hyicus, S. delphini, S. intermedius, S. pseudointermedius, S. schleiferi) and negative (S. capitis, S. caprae, S. epidermidis, S. warneri, S. simulans, S. carnosus, S. kloosii, S. saprophyticus)³¹, so it was decided to work with this gene, which is related to the synthesis of peptidoglycan and has a high identification power for S. aureus resistant to methicillin³².

A) 1, S522 (PL); 2, S528 (PL), 3; S519 (PL); 4, S529 (PL); 5, S521 (CL); 6, MPM; 7, negative control; 8, positive control (S. aureus ATCC25923); 9, S517 (PL); 10, S643 (CS).

B) 1, negative control; 2, S522 (PL); 3, S528 (PL); 4, S529 (PL); 5, S521 (CL); 6, MPM (100 PB); 7, S517 (PL); 8, S643 (CS); 9, S650 (CS).

A= barn a; B= barn B; L= rainy; S= dry; MPM= Molecular weight marker of 100 pb.

En b, las cepas débilmente positivas y positivas se volvieron a repetir y se modificaron las condiciones de electroforesis

Figure 1 Electrophoresis of femA gene amplification of S. aureus strains of bovine udder skin

S. aureus was isolated from most quarters that only had traces or low number of somatic cells, and isolated only from a cow with subclinical mastitis. Determining that there is no relationship between S. aureus isolates from the teat skin of cows’ udder with the development of mastitis symptoms (P=0.106). Several factors could explain the absence of this relationship, from the immune status of the animal, the inoculum of the microorganism and the genetic characteristics of the strain. Even in recent years, the role of the microbiota of cow’s udder has been described as an important factor in the development of mastitis, with the presence of other microorganisms that could act as antagonists of pathogens restricting their multiplication or establishment of the infection; for example, S. chromogenes has been described as producing bacteriocins capable of inhibiting the growth of most intramammary pathogens³³^,³⁴. Considering that factors such as parity and the state of immunosuppression generated during gestation, lactation, metabolic profile and genetic load of the animal could positively or negatively impact the composition of the udder microbiota and therefore the susceptibility of mastitis³⁵.

Although no relationship was found with the cases of subclinical mastitis in the study, other relationships were sought, such as the distribution of S. aureus in the three dairy farms (A, B and C), which was 14, 11.5 and 16 % respectively, with no statistically significant differences observed (P=0.531) (Table 3). These results could be explained by the ubiquity of the microorganism, the infectious and contagious capacity, as well as its persistence in the dairy environment². In this study, the most frequently observed differences in seasonality for S. aureus were in the dry season (23.6 %, 29/250) in relation to the rainy season (3.2 %, 8/250), they could be explained by the accelerated growth of microorganisms associated with the temperature and humidity of the season³⁶, as well as an altered metabolic state, including some type of immunocompromise due to food restriction³⁵, which favors the colonization of the microorganisms.

Table 3 Presence of S. aureus in the teat of cows’ udders in relation to dairy farms and season

Characteristics	Total	S. aureus		P
Characteristics	Total	Positive	Negative	P
Dairy farm
A	200	28 (14.0)	172 (86.0)	0.531
B	200	23 (11.5)	177 (88.5)
C	100	16 (16.0)	84 (84.0)
Season
Rainy	250	8 (3.20)	242 (96.8)	0.001
Dry	250	59 (23.6)	191 (76.4)	0.001

Similarly, no statistical relationship between the presence of S. aureus in the bovine udder skin and the development of subclinical mastitis was found; however, virulence factors that are key in both the development of infections and food poisoning were determined ³⁷^,³⁸. The most frequent enterotoxin gene in S. aureus strains was enterotoxin A (10.44 %), highlighting that no strains with the genes for enterotoxins B and C were found. As for toxins, 23 strains with the β hemolysin gene (34.32 %) were found; it is important to mention that this data is adjusted with the phenotypic test of hemolysis in ram’s blood, which was considered because oligonucleotides designed for this gene do not amplify it completely and this gene is susceptible to the insertion of phages and the inclusion of genes such as enterotoxin A and staphylokinase (saK)³⁹^,⁴⁰. In this study, no strains with one of the genes associated with Panton Valentine toxin were found.

Finally, only two strains with the saK gene (2.98 %) were found and three strains were defined as MRSA from the amplification of the mecA gene (4.47 %) (Table 4). In this sense, several studies have sought to establish a profile of virulence characteristic of the strains of S. aureus capable of causing subclinical mastitis, assuming that the microorganism must adapt to a certain environment when invading the bovine udder, the results have been diverse, however, as points in common, they converge in that hemolysin b and Panton Valentine toxin are virulence factors that could participate in the development of subclinical mastitis, having as their main function, the formation of pores or lysis of leukocytes²^,⁴¹^,⁴². Which could be confirmed with the results in this study, the strains having in low or no frequency, the genes of these toxins (both that of hemolysin and Panton Valentine toxin) were not associated with cases of subclinical mastitis. A relationship of these strains with particular clinical pictures in the bovine udder was not established; however, the strains have epidemiological importance due to the presence of enterotoxin genes, these could contaminate by dragging during milking and ultimately be found in the final dairy product and cause a problem of food poisoning⁴³.

Table 4 Virulence factors of S. aureus strains isolated from cow udders

Virulence factor	n(%), N= 67
Enterotoxins
seA	7 (10.44)
seB	-
seC	-
seD	2 (2.98)
seE	1 (1.49)
tsst-1	4 (5.97)
Toxins
hlB	23 (34.32)
pvL	-
Enzymes
saK	2 (2.98)
mecA	3 (4.47)

As for the molecular typing of the strains of S. aureus, the percentage of typing has shown important variations in relation to time; in the years close to the beginning of the use of the PCR-RFLP technique of the coag gene, the typing of 100 % of the strains was achieved⁴⁴^-⁴⁸; however, in recent years this percentage decreases to 40 %²⁹^,³⁰^,⁴⁹, which is still higher than the percentage determined in this study (19.47 %) (Figure 1a). In this sense, two events must be considered, in the first instance it has been proposed that the decrease in the percentage of typing could be related to mutations in the coagulase gene that impact on the specificity of the proposed oligonucleotides, but do not affect the activity of the enzyme, noting that oligonucleotides are the same as those used in the original technique and were established since 1992²²; on the other hand, it is important to compare the results in relation to the type of host from which S. aureus was isolated, because the change of host could involve important changes in the strain including the variability of the coag gene; however, if the percentage of typing in studies of S. aureus in cows is compared, results vary considerably between typing percentages²⁹^,³⁰^,⁴⁴^,⁴⁹. Although the percentage of typing is low, it was possible to identify a restrictotype (400 bp, 350 bp) that groups strains isolated from different cows from both barn A (Figure 2c, lane 4) and barn B (Figure 2b, lane 2, 3 and 4; Figure 2c, lane 1, 2 and 3), as well as the rainy season (Figure 2b, lane 2; Figure 2c, lane 1, 2 and 3) and dry season (Figure 2b, lane 3 and 4), which shows the infectious and contagious capacity of S. aureus, and this reaffirms the role of this microorganism in cases of mastitis of infectious type, which also emphasizes the importance of adopting measures that prevent the transmission of the microorganism in the dairy environment, being able to infect cattle, altering the quality of milk and cattle should be considered as a major source of contamination in the production of dairy products.

(A) 1, S528; 2, positive control (S. aureus ATCC25923); 3, negative control; 4, MPM; 5, S519 (PL); 6, S520 (PL); 7, S530 (PL); 8, S618; 9, S673 (PS).

(B) 1, S673 (PS); 2, S665 (PL); 3, 668 (PS); 4, 669 (PS); 671 (PS); 6, MPM

(c) 1, S522 (PL); 2, S528 (PL); 3, S529 (PL); 4, S521 (CL); 5, MPM (100 PB); 6, S517 (PL); 7, S643 (CS); 8, S650 (CS); 9, S618.

A= barn A, B= barn B; L= rainy; S= dry.

Figure 2 Electrophoresis of coag gene restriction of strains isolated from bovine udder skin

Conclusions and implications

In this study, no relationship was found between the presence of S. aureus in the teat skin of cattle udder and the development of mastitis; however, strains with genes for enterotoxins, which are a public health problem, were determined. In addition, the transmission of strains in dairy farms was evidenced, which highlights the importance of good milking practices.

Acknowledgments and conflicts of interest

Thanks are extended to all the owners of the cattle included in this study, who agreed to participate and collaborated in the handling of the cattle during the sampling and who also always expressed their concern for the health of their cattle. Special thanks to Dr. Elvia Rodríguez Bataz for the final comments on the manuscript review.

REFERENCES

1. Pumipuntu N, Tunyong W, Chantratita N, Diraphat P, Pumirat P, Sookrung N, et al. Staphylococcus spp. associated with subclinical bovine mastitis in central and northeast provinces of Thailand. Peer J 2019;7:e6587. doi:10.7717/peerj.6587. [ Links ]

2. Rainard P, Foucras G, Fitzgerald JR, Watts JL, Koop G, Middleton JR. Knowledge gaps and research priorities in Staphylococcus aureus mastitis control. Transbound Emerg Dis 2018;65:149-165. [ Links ]

3. Islam MA, Islam MZ, Islam M, Rahman M, Islam MT. Prevalence of subclinical mastitis in dairy cows in selected areas of Bangladesh. Trop Anim Health Prod 2012;9(1):73-78. [ Links ]

4. Zecconi AA, Calvinho LFL, Fox K. Staphylococcus aureus intramammary infections. International Dairy Federation; 2006. Report No 408. [ Links ]

5. Botrel MA, Haenni M, Morignat E, Sulpice P, Madec JY, Calavas D. Distribution and antimicrobial resistance of clinical and subclinical mastitis pathogens in dairy cows in Rhône-Alpes, France. Foodborne Pathog Dis 2010;7(5):479-487. [ Links ]

6. Bradley AJ, Leach KA, Breen JE, Green LE, Green MJ. Survey of the incidence and aetiology of mastitis on dairy farms in England and Wales. Vet Rec 2007;160(8):253-258. [ Links ]

7. da Costa LB, Rajala-Schultz PJ, Hoet A, Seo KS, Fogt K, Moon BS. Genetic relatedness and virulence factors of bovine Staphylococcus aureus isolated from teat skin and milk. J Dairy Sci 2014;97(11):6907-6916. [ Links ]

8. Peton V, Le Loir Y. Staphylococcus aureus in veterinary medicine. Infect Genet Evol 2014;21:602-615. [ Links ]

9. Halasa T, Huijps K, Østerås O, Hogeveen H. Economic effects of bovine mastitis and mastitis management: A review. Vet Q 2007;29(1):18-31. [ Links ]

10. Balaban N, Rasooly A. Staphylococcal enterotoxins. Int J Food Microbiol 2000;61(1):1-10. [ Links ]

11. Honeyman AL , editor. Staphylococcus aureus infection and disease. New York, NY: Kluwer Acad./Plenum Publ; 2001. [ Links ]

12. Fetsch A, Johler S. Staphylococcus aureus as a foodborne pathogen. Curr Clin Microbiol Rep 2018;5(2):88-96. [ Links ]

13. Neave FK, Dodd FH, Kingwill RG, Westgarth DR. Control of mastitis in the dairy herd by hygiene and management. J Dairy Sci 1969;52(5):696-707. [ Links ]

14. Schreiner DA, Ruegg PL. Relationship between udder and leg hygiene scores and subclinical mastitis. J Dairy Sci 2003;86(11):3460-3475. [ Links ]

15. Zadoks RN, van Leeuwen WB, Kreft D, Fox LK, Barkema HW, Schukken YH, et al. Comparison of Staphylococcus aureus isolates from bovine and human skin, milking equipment, and bovine milk by phage typing, pulsed-field gel electrophoresis, and binary typing. J Clin Microbiol 2002;40(11):3894-33902. [ Links ]

16. Capurro A, Aspán A, Ericsson UH, Persson WK, Artursson K. Identification of potential sources of Staphylococcus aureus in herds with mastitis problems. J Dairy Sci 2010;93(1):180-191. [ Links ]

17. Haveri M, Hovinen M, Roslof A, Pyorala S. Molecular types and genetic profiles of Staphylococcus aureus strains isolated from bovine intramammary infections and extramammary sites. J Clin Microbiol 2008; (11):3728-3735. [ Links ]

18. Mørk T, Kvitle B, Jørgensen HJ. Reservoirs of Staphylococcus aureus in meat sheep and dairy cattle. Vet Microbiol 2012;155(1):81-87. [ Links ]

19. Asadollahi P, Delpisheh A, Hossein MM, Azizi JF, Alikhani MY, Asadollahi K, et al. Enterotoxin and exfoliative toxin genes among methicillin-resistant Staphylococcus aureus isolates recovered from Ilam, Iran. Avicenna J Clin Microb Infec 2014;1(2):20208. doi:10.17795/ajcmi-20208. [ Links ]

20. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun 2002;70(2):631-341. [ Links ]

21. Milheiriço C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 2007;51(9):3374-3377. [ Links ]

22. Goh SH, Byrne SK, Zhang JL, Chow AW. Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J Clin Microbiol 1992;30(7):1642-1645. [ Links ]

23. Keane OM. Symposium review: Intramammary infections-major pathogens and strain-associated complexity. J Dairy Sci 2019;102(5):4713-4726. [ Links ]

24. Bradley AJ. Bovine Mastitis: An evolving disease. Vet J 2002;164(2):116-128. [ Links ]

25. Moyes KM. Triennial lactation symposium: Nutrient partitioning during intramammary inflammation: A key to severity of mastitis and risk of subsequent diseases? J Anim Sci 2015;93(12):5586-5593. [ Links ]

26. Joshi S, Gokhale S. Status of mastitis as an emerging disease in improved and periurban dairy farms in India. Ann N Y Acad Sci 2006;1081(1):74-83. [ Links ]

27. Morse D, DeLorenzo MA, Wilcox CJ, Collier RJ, Natzke RP, Bray DR. Climatic effects on occurrence of clinical mastitis. J Dairy Sci 1988;71(3):848-853. [ Links ]

28. Smith KL, Todhunter DA, Schoenberger PS. Environmental mastitis: cause, prevalence, prevention. J Dairy Sci 1985;68(6):1531-1553. [ Links ]

29. Javid F, Taku A, Bhat MA, Badroo GA, Mudasir M, Sofi TA. Molecular typing of Staphylococcus aureus based on coagulase gene. Vet World 2018;11(4):423-430. [ Links ]

30. Sharma V, Sharma S, Dahiya DK, Khan A, Mathur M, Sharma A. Coagulase gene polymorphism, enterotoxigenecity, biofilm production, and antibiotic resistance in Staphylococcus aureus isolated from bovine raw milk in North West India. Ann Clin Microbiol Antimicrob 2017;16(1):65. doi:10.1186/s12941-017-0242-9. [ Links ]

31. Hirotaki S, Sasaki T, Kuwahara-Arai K, Hiramatsu K. Rapid and accurate identification of human-associated Staphylococci by use of multiplex PCR. J Clin Microbiol 2011;49(10):3627-3631. [ Links ]

32. Vannuffel P, Heusterspreute M, Bouyer M, Vandercam B, Philippe M, Gala JL. Molecular characterization of from and-based discrimination of staphylococcal species. Res Microbiol 1999;150(2):129-141. [ Links ]

33. Braem G, Stijlemans B, Van Haken W, De Vliegher S, De Vuyst L, Leroy F. Antibacterial activities of coagulase-negative Staphylococci from bovine teat apex skin and their inhibitory effect on mastitis-related pathogens. J Appl Microbiol 2014;116(5):1084-1093. [ Links ]

34. Carson DA, Barkema HW, Naushad S, De Buck J. Bacteriocins of Non-aureus Staphylococci isolated from bovine milk. Appl Environ Microbiol 2017;83(17) doi:10.1128/AEM.01015-17. [ Links ]

35. Derakhshani H, Fehr KB, Sepehri S, Francoz D, De Buck J, Barkema HW, et al. Invited review: Microbiota of the bovine udder: Contributing factors and potential implications for udder health and mastitis susceptibility. J Dairy Sci 2018;101(12):10605-10625. [ Links ]

36. Hogan J, Smith KL. Managing environmental mastitis. Vet Clin North Am Food Anim Pract 2012;28(2):217-224. [ Links ]

37. Kadariya J, Smith TC, Thapaliya D. Staphylococcus aureus and Staphylococcal Food-borne disease: An ongoing challenge in public health. BioMed Res Int 2014;2014:1-9. [ Links ]

38. Tong SYC, Davis JS, Eichenberger E, Holland TL, Fowler VG. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev 2015;28(3):603-661. [ Links ]

39. van Wamel WJB, Rooijakkers SHM, Ruyken M, van Kessel KPM, van Strijp JAG. The innate immune modulators Staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on hemolysin-converting bacteriophages. J Bacteriol 2006;188(4):1310-1315. [ Links ]

40. Argudín MÁ, Mendoza MC, Rodicio MR. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010;2(7):1751-1773. [ Links ]

41. Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol 2005;3(12):948-958. [ Links ]

42. van Kessel KPM, Bestebroer J, van Strijp JAG. Neutrophil-mediated phagocytosis of Staphylococcus aureus. Front immunol 2014;26(5):467. doi: 10.3389/fimmu.2014.00467. [ Links ]

43. Piccinini R, Cesaris L, Daprà V, Borromeo V, Picozzi C, Secchi C, et al. The role of teat skin contamination in the epidemiology of Staphylococcus aureus intramammary infections. J Dairy Res 2009;76(1):36-41. [ Links ]

44. Aarestrup FM, Dangler CA, Sordillo LM. Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis. Can J Vet Res 1995;59(2):124-128. [ Links ]

45. Hookey JV, Richardson JF, Cookson BD. Molecular typing of Staphylococcus aureus based on PCR restriction fragment length polymorphism and DNA sequence analysis of the coagulase gene. J Clin Microbiol 1998;36(4):1083-1099. [ Links ]

46. Schlegelová J, Dendis M, Benedík J, Babák V, Rysánek D. Staphylococcus aureus isolates from dairy cows and humans on a farm differ in coagulase genotype. Vet Microbiol 2003;92(4):327-334. [ Links ]

47. Schwarzkopf A, Karch H. Genetic variation in Staphylococcus aureus coagulase genes: potential and limits for use as epidemiological marker. J Clin Microbiol 1994;32(10):2407-2412. [ Links ]

48. Su C, Herbelin C, Frieze N, Skardova O, Sordillo LM. Coagulase gene polymorphism of Staphylococcus aureus isolates from dairy cattle in different geographical areas. Epidemiol Infect 1999;122(2):329-336. [ Links ]

49. Momtaz H, Tajbakhsh E, Rahimi E, Momeni M. Coagulase gene polymorphism of Staphylococcus aureus isolated from clinical and sub-clinical bovine mastitis in Isfahan and Chaharmahal va Bakhtiari provinces of Iran. Comp Clin Path 2011;20(5):519-522. [ Links ]

Received: March 20, 2020; Accepted: January 08, 2021

Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons